postinfection  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen postinfection
    Viral proliferation assay of GLV-1h153-in PANC-1 cells . a. PANC-1 cells were grown in 6-well plates and infected with GLV-1h153 or GLV-1h68 at an MOI of 0.01 and 1.0. Three wells of each virus were harvested at 1, 24, 48, and 72 hours <t>postinfection.</t> GLV-1h153 replicated in a similar manner to GLV-1h68, with a 4-log increase in viral load at an MOI of 0.01 by 72 hours, reaching similar levels as that in cells infected with an MOI of 1.0. This demonstrates that GLV-1h153 is able to replicate efficiently within PANC-1 cells in vitro as well as parental virus GLV-1h68. b. GFP expression was quantified via flow cytometry in PANC-1 cells infected with GLV-1h153 at MOIs of 1.0 and 0.01 and was shown to be MOI dependent. GFP expression mimicked the viral replication growth curve, with GFP expression in the MOI 0.01 infected cells reaching similar levels as the MOI of 1.0 by 72 hours after infection. c. GFP expression was quantified via flow cytometry in PANC-1 cells infected with an MOI of 0.01, 0.1, 0.5, 1.0 2.0, and 5.0 at 24 hours after infection, and was shown to be MOI-dependent.
    Postinfection, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 179 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/postinfection/product/Qiagen
    Average 99 stars, based on 179 article reviews
    Price from $9.99 to $1999.99
    postinfection - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus"

    Article Title: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus

    Journal: Journal of Translational Medicine

    doi: 10.1186/1479-5876-9-36

    Viral proliferation assay of GLV-1h153-in PANC-1 cells . a. PANC-1 cells were grown in 6-well plates and infected with GLV-1h153 or GLV-1h68 at an MOI of 0.01 and 1.0. Three wells of each virus were harvested at 1, 24, 48, and 72 hours postinfection. GLV-1h153 replicated in a similar manner to GLV-1h68, with a 4-log increase in viral load at an MOI of 0.01 by 72 hours, reaching similar levels as that in cells infected with an MOI of 1.0. This demonstrates that GLV-1h153 is able to replicate efficiently within PANC-1 cells in vitro as well as parental virus GLV-1h68. b. GFP expression was quantified via flow cytometry in PANC-1 cells infected with GLV-1h153 at MOIs of 1.0 and 0.01 and was shown to be MOI dependent. GFP expression mimicked the viral replication growth curve, with GFP expression in the MOI 0.01 infected cells reaching similar levels as the MOI of 1.0 by 72 hours after infection. c. GFP expression was quantified via flow cytometry in PANC-1 cells infected with an MOI of 0.01, 0.1, 0.5, 1.0 2.0, and 5.0 at 24 hours after infection, and was shown to be MOI-dependent.
    Figure Legend Snippet: Viral proliferation assay of GLV-1h153-in PANC-1 cells . a. PANC-1 cells were grown in 6-well plates and infected with GLV-1h153 or GLV-1h68 at an MOI of 0.01 and 1.0. Three wells of each virus were harvested at 1, 24, 48, and 72 hours postinfection. GLV-1h153 replicated in a similar manner to GLV-1h68, with a 4-log increase in viral load at an MOI of 0.01 by 72 hours, reaching similar levels as that in cells infected with an MOI of 1.0. This demonstrates that GLV-1h153 is able to replicate efficiently within PANC-1 cells in vitro as well as parental virus GLV-1h68. b. GFP expression was quantified via flow cytometry in PANC-1 cells infected with GLV-1h153 at MOIs of 1.0 and 0.01 and was shown to be MOI dependent. GFP expression mimicked the viral replication growth curve, with GFP expression in the MOI 0.01 infected cells reaching similar levels as the MOI of 1.0 by 72 hours after infection. c. GFP expression was quantified via flow cytometry in PANC-1 cells infected with an MOI of 0.01, 0.1, 0.5, 1.0 2.0, and 5.0 at 24 hours after infection, and was shown to be MOI-dependent.

    Techniques Used: Proliferation Assay, Infection, In Vitro, Expressing, Flow Cytometry, Cytometry

    2) Product Images from "Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses"

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.00397-19

    Compound 10 prevention of disease caused by DENV-2 infection in infected mice. A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0. Disease and inflammatory parameters were measured on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (starting on day 0) or therapeutically (starting on day 2 postinfection). (A) Numbers of platelets. (B) Changes in body weight, analyzed daily. Results are expressed as a percentage of initial weight loss after DENV-2 inoculation. (C) Total and differential cell counts in blood, represented as the numbers of different cell types (leukocytes, mononuclear cells, and neutrophils) normalized to the total cell counts. (D) Neutrophil influx into the spleen. (E) Neutrophil influx into the brain. (F) Concentrations of IL-6 in mouse serum. (G) Concentrations of CCL5 in mouse serum. (H) Semiquantitative analysis (histopathological score) and representative pictures for each group after hematoxylin and eosin staining of liver sections from control and DENV-2-infected mice, treated with compound 10 or not, 6 days after infection. ND, not determined. Original magnification, ×200. Scale bar, 100 μm. (I) Compound 10 induction of elevated IFN-γ levels upon DENV-2 infection. Results are expressed as means ± SEMs and are representative of two experiments. *, P
    Figure Legend Snippet: Compound 10 prevention of disease caused by DENV-2 infection in infected mice. A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0. Disease and inflammatory parameters were measured on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (starting on day 0) or therapeutically (starting on day 2 postinfection). (A) Numbers of platelets. (B) Changes in body weight, analyzed daily. Results are expressed as a percentage of initial weight loss after DENV-2 inoculation. (C) Total and differential cell counts in blood, represented as the numbers of different cell types (leukocytes, mononuclear cells, and neutrophils) normalized to the total cell counts. (D) Neutrophil influx into the spleen. (E) Neutrophil influx into the brain. (F) Concentrations of IL-6 in mouse serum. (G) Concentrations of CCL5 in mouse serum. (H) Semiquantitative analysis (histopathological score) and representative pictures for each group after hematoxylin and eosin staining of liver sections from control and DENV-2-infected mice, treated with compound 10 or not, 6 days after infection. ND, not determined. Original magnification, ×200. Scale bar, 100 μm. (I) Compound 10 induction of elevated IFN-γ levels upon DENV-2 infection. Results are expressed as means ± SEMs and are representative of two experiments. *, P

    Techniques Used: Infection, Mouse Assay, Staining

    Antiviral effects of compound 10 against DENV-2 in vivo . A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0, and viral loads were quantified with a plaque assay on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (from day 0 to day 6) or therapeutically (from day 2 to day 6). Viral loads recovered from serum (A), spleen (B), liver (C), and brain (D) were determined. The median values for viral loads are represented as lines. #, P
    Figure Legend Snippet: Antiviral effects of compound 10 against DENV-2 in vivo . A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0, and viral loads were quantified with a plaque assay on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (from day 0 to day 6) or therapeutically (from day 2 to day 6). Viral loads recovered from serum (A), spleen (B), liver (C), and brain (D) were determined. The median values for viral loads are represented as lines. #, P

    Techniques Used: In Vivo, Mouse Assay, Infection, Plaque Assay

    3) Product Images from "Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿"

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿

    Journal: Infection and Immunity

    doi: 10.1128/IAI.05574-11

    Enhanced proinflammatory responses in hip1 mutant-infected macrophages. C57BL/6 BMM were infected with the wt or hip1 mutant strain at an MOI of 10. At 24 h postinfection, cell-free supernatants were harvested for cytokine assays and macrophage RNA was
    Figure Legend Snippet: Enhanced proinflammatory responses in hip1 mutant-infected macrophages. C57BL/6 BMM were infected with the wt or hip1 mutant strain at an MOI of 10. At 24 h postinfection, cell-free supernatants were harvested for cytokine assays and macrophage RNA was

    Techniques Used: Mutagenesis, Infection

    Rapid induction of proinflammatory cytokines in the absence of Hip1. C57BL/6 BMM were infected with the wt or hip1 mutant strain at an MOI of 10. Supernatants were collected at 5, 8, 24, and 72 h postinfection and were assayed for IL-1β, IL-6,
    Figure Legend Snippet: Rapid induction of proinflammatory cytokines in the absence of Hip1. C57BL/6 BMM were infected with the wt or hip1 mutant strain at an MOI of 10. Supernatants were collected at 5, 8, 24, and 72 h postinfection and were assayed for IL-1β, IL-6,

    Techniques Used: Infection, Mutagenesis

    4) Product Images from "Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿"

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01441-10

    Numbers of dsRNA-positive foci detected in BHK-21 cells at different times postinfection with SINV/nsP3GFP, SINV/2V/nsP3GFP, and SINV/1V2V/nsP3GFP. The dsRNA-positive foci in 3D images were quantitated using a Spot function in Imaris 3D rendering software. The P values were calculated using the Mann-Whitney test. Average values are indicated in red.
    Figure Legend Snippet: Numbers of dsRNA-positive foci detected in BHK-21 cells at different times postinfection with SINV/nsP3GFP, SINV/2V/nsP3GFP, and SINV/1V2V/nsP3GFP. The dsRNA-positive foci in 3D images were quantitated using a Spot function in Imaris 3D rendering software. The P values were calculated using the Mann-Whitney test. Average values are indicated in red.

    Techniques Used: Software, MANN-WHITNEY

    At late times postinfection with SIN/nsP3GFP and ns polyprotein cleavage mutants, SINV-specific dsRNAs retain mostly plasma membrane-specific localization. BHK-21 cells were infected with the indicated viruses at an MOI of 20 PFU/cell. At 8 h (and 16 h) postinfection, cells were fixed, permeabilized, and stained with a dsRNA-specific MAb. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz sections are presented as a multiple-intensity projection of 2-μm section. Bars correspond to 5 μm. White arrowheads indicate positions of stained dsRNAs demonstrating cytoplasmic localization.
    Figure Legend Snippet: At late times postinfection with SIN/nsP3GFP and ns polyprotein cleavage mutants, SINV-specific dsRNAs retain mostly plasma membrane-specific localization. BHK-21 cells were infected with the indicated viruses at an MOI of 20 PFU/cell. At 8 h (and 16 h) postinfection, cells were fixed, permeabilized, and stained with a dsRNA-specific MAb. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz sections are presented as a multiple-intensity projection of 2-μm section. Bars correspond to 5 μm. White arrowheads indicate positions of stained dsRNAs demonstrating cytoplasmic localization.

    Techniques Used: Infection, Staining, Microscopy, Software

    At 2 h postinfection with SIN/nsP3GFP and ns polyprotein cleavage mutants, virus-specific dsRNAs are located at the plasma membrane. BHK-21 cells were infected with the indicated viruses at an MOI of 20 PFU/cell. At 2 h postinfection, they were fixed, permeabilized, and stained with dsRNA-specific MAb. The 3D image stacks were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. They were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz sections are presented as multiple-intensity projections of 2-μm section. Bars correspond to 5 μm.
    Figure Legend Snippet: At 2 h postinfection with SIN/nsP3GFP and ns polyprotein cleavage mutants, virus-specific dsRNAs are located at the plasma membrane. BHK-21 cells were infected with the indicated viruses at an MOI of 20 PFU/cell. At 2 h postinfection, they were fixed, permeabilized, and stained with dsRNA-specific MAb. The 3D image stacks were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. They were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz sections are presented as multiple-intensity projections of 2-μm section. Bars correspond to 5 μm.

    Techniques Used: Infection, Staining, Microscopy, Software

    At early times postinfection, dsRNAs are located in membrane spherules presented on the external surface of the plasma membrane. (A) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At 2 h postinfection, cells were fixed with 4% PFA, permeabilized with either 0.02% or 0.5% saponin, treated with dsRNA-specific MAb and rabbit anti-SINV nsP1 Ab, and further stained with appropriate secondary Abs. Images were acquired on a Zeiss LSM700 META confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. Bars correspond to 10 μm. (B) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At 3 h postinfection, cells were fixed with 4% PFA, permeabilized with 0.02% saponin, treated with dsRNA-specific MAb and gold-labeled secondary Abs, and further processed for EM. (C) The same cell sample as in panel B was processed for EM without permeabilization and immunostaining.
    Figure Legend Snippet: At early times postinfection, dsRNAs are located in membrane spherules presented on the external surface of the plasma membrane. (A) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At 2 h postinfection, cells were fixed with 4% PFA, permeabilized with either 0.02% or 0.5% saponin, treated with dsRNA-specific MAb and rabbit anti-SINV nsP1 Ab, and further stained with appropriate secondary Abs. Images were acquired on a Zeiss LSM700 META confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. Bars correspond to 10 μm. (B) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At 3 h postinfection, cells were fixed with 4% PFA, permeabilized with 0.02% saponin, treated with dsRNA-specific MAb and gold-labeled secondary Abs, and further processed for EM. (C) The same cell sample as in panel B was processed for EM without permeabilization and immunostaining.

    Techniques Used: Infection, Staining, Microscopy, Software, Labeling, Immunostaining

    In situ PLA demonstrates colocalization of dsRNA with SINV nsP1, nsP2, and nsP3 proteins. (A and B) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At 2 h postinfection, cells were fixed with 4% PFA, permeabilized with either 0.02% (A) or 0.5% (B) saponin, treated with dsRNA-specific MAb and rabbit anti-SINV nsP1 Ab, and further processed for in situ PLA. Red signals indicate colocalization of nsP1 and dsRNA. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stacks, and xz sections are presented as multiple-intensity projections of a 2-μm section. Bars correspond to 5 μm. (C) Numbers of PLA-positive foci detected in the cells by using dsRNA MAbs and nsP-specific, affinity-purified Abs. The nsP1-, nsP2-, or nsP3-specific Abs used and the concentrations of saponin are indicated. The dsRNA-positive foci in 3D images were quantitated using a Spot function in Imaris 3D rendering software. The P values were calculated using the Mann-Whitney test. Average values are indicated in red. (D) Results of PLA performed using dsRNA-specific MAb and nsP1-specific rabbit Ab with mock-infected cells.
    Figure Legend Snippet: In situ PLA demonstrates colocalization of dsRNA with SINV nsP1, nsP2, and nsP3 proteins. (A and B) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At 2 h postinfection, cells were fixed with 4% PFA, permeabilized with either 0.02% (A) or 0.5% (B) saponin, treated with dsRNA-specific MAb and rabbit anti-SINV nsP1 Ab, and further processed for in situ PLA. Red signals indicate colocalization of nsP1 and dsRNA. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stacks, and xz sections are presented as multiple-intensity projections of a 2-μm section. Bars correspond to 5 μm. (C) Numbers of PLA-positive foci detected in the cells by using dsRNA MAbs and nsP-specific, affinity-purified Abs. The nsP1-, nsP2-, or nsP3-specific Abs used and the concentrations of saponin are indicated. The dsRNA-positive foci in 3D images were quantitated using a Spot function in Imaris 3D rendering software. The P values were calculated using the Mann-Whitney test. Average values are indicated in red. (D) Results of PLA performed using dsRNA-specific MAb and nsP1-specific rabbit Ab with mock-infected cells.

    Techniques Used: In Situ, Proximity Ligation Assay, Infection, Microscopy, Software, Affinity Purification, MANN-WHITNEY

    The plasma membrane is the site of viral RNA synthesis. BHK-21 cells were infected with SINV/nsP3GFP at an MOI of ca. 20 PFU/cell. At 4 h postinfection, they were treated with digitonin (1 μg/ml) in the presence of ActD, and an in vitro transcription reaction was performed as described in Materials and Methods. Cells were then stained with BrU-specific and dsRNA-specific antibodies. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz and yz sections are presented as multiple-intensity projections of a 0.06-μm section. Bars correspond to 5 μm. White arrowheads indicate sites of colocalization of dsRNA and incorporated BrU. The white arrow points to one of the BrU-positive foci that are not associated with dsRNA staining. Mock-infected cells demonstrated no detectable staining under these experimental conditions; therefore, their images are not presented.
    Figure Legend Snippet: The plasma membrane is the site of viral RNA synthesis. BHK-21 cells were infected with SINV/nsP3GFP at an MOI of ca. 20 PFU/cell. At 4 h postinfection, they were treated with digitonin (1 μg/ml) in the presence of ActD, and an in vitro transcription reaction was performed as described in Materials and Methods. Cells were then stained with BrU-specific and dsRNA-specific antibodies. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz and yz sections are presented as multiple-intensity projections of a 0.06-μm section. Bars correspond to 5 μm. White arrowheads indicate sites of colocalization of dsRNA and incorporated BrU. The white arrow points to one of the BrU-positive foci that are not associated with dsRNA staining. Mock-infected cells demonstrated no detectable staining under these experimental conditions; therefore, their images are not presented.

    Techniques Used: Infection, In Vitro, Staining, Microscopy, Software

    ) in the P2/3 cleavage site, and SINV/1V2V/nsP3GFP contains mutations inactivating both cleavage sites in P123. (B) Spherules at the plasma membrane of BHK-21 cells at 2 h postinfection with the indicated viruses at an MOI of 20 PFU/cell. The patches of spherules at the plasma membrane are characteristic for early times postinfection. Bars correspond to 100 nm.
    Figure Legend Snippet: ) in the P2/3 cleavage site, and SINV/1V2V/nsP3GFP contains mutations inactivating both cleavage sites in P123. (B) Spherules at the plasma membrane of BHK-21 cells at 2 h postinfection with the indicated viruses at an MOI of 20 PFU/cell. The patches of spherules at the plasma membrane are characteristic for early times postinfection. Bars correspond to 100 nm.

    Techniques Used:

    Application of endocytosis inhibitors does not result in a strong negative effect on SINV/nsP3GFP and SINV/nsP3GFP RNA replication. (A and B) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. After 1-h virus adsorption, cells were washed with PBS and further incubated in complete medium for 1 h at 37°C, and then the medium was replaced with medium containing drugs at the indicated concentrations. Medium replacements continued at the indicated time points, and virus concentrations in the collected samples were measured by standard plaque assay. (C) Comparative analysis of viral genomic RNA concentration in BHK-21 cells infected with SINV/nsP3GFP as described above and treated with either 80 μM dynasore or 20 μM nocodazole. RNAs were isolated at 6 h postinfection, corresponding to 5 h of drug treatment. Concentrations of viral genomic RNA were measured using RT-qPCR and normalized on the concentration of β-actin mRNA. (D) In parallel, at 6 h postinfection (5 h of drug treatment), concentrations of SINV nsP2 and capsid were measured by Western blotting using specific Abs. Quantitation was performed on an Odyssey imager (Li-Cor), and data were normalized per the amount of β-actin.
    Figure Legend Snippet: Application of endocytosis inhibitors does not result in a strong negative effect on SINV/nsP3GFP and SINV/nsP3GFP RNA replication. (A and B) BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. After 1-h virus adsorption, cells were washed with PBS and further incubated in complete medium for 1 h at 37°C, and then the medium was replaced with medium containing drugs at the indicated concentrations. Medium replacements continued at the indicated time points, and virus concentrations in the collected samples were measured by standard plaque assay. (C) Comparative analysis of viral genomic RNA concentration in BHK-21 cells infected with SINV/nsP3GFP as described above and treated with either 80 μM dynasore or 20 μM nocodazole. RNAs were isolated at 6 h postinfection, corresponding to 5 h of drug treatment. Concentrations of viral genomic RNA were measured using RT-qPCR and normalized on the concentration of β-actin mRNA. (D) In parallel, at 6 h postinfection (5 h of drug treatment), concentrations of SINV nsP2 and capsid were measured by Western blotting using specific Abs. Quantitation was performed on an Odyssey imager (Li-Cor), and data were normalized per the amount of β-actin.

    Techniques Used: Infection, Adsorption, Incubation, Plaque Assay, Concentration Assay, Isolation, Quantitative RT-PCR, Western Blot, Quantitation Assay

    At early times postinfection of mosquito cells, nsP3-GFP and dsRNAs are distributed at both the plasma membrane and endosomes. C 7 10 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. After 4 h of incubation at 30°C, cells were fixed, permeabilized, and stained with dsRNA-specific MAb and Alexa Fluor 555-labeled secondary Ab as described in Materials and Methods. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective, and image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz sections are presented as multiple-intensity projections of a 2-μm section. White arrowheads indicate positions of stained dsRNAs having a cytoplasmic, endosome-like distribution. White arrows indicate plasma membrane-associated dsRNAs. Bars correspond to 5 μm.
    Figure Legend Snippet: At early times postinfection of mosquito cells, nsP3-GFP and dsRNAs are distributed at both the plasma membrane and endosomes. C 7 10 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. After 4 h of incubation at 30°C, cells were fixed, permeabilized, and stained with dsRNA-specific MAb and Alexa Fluor 555-labeled secondary Ab as described in Materials and Methods. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective, and image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. The xy images are presented as multiple-intensity projections of the entire stack, and xz sections are presented as multiple-intensity projections of a 2-μm section. White arrowheads indicate positions of stained dsRNAs having a cytoplasmic, endosome-like distribution. White arrows indicate plasma membrane-associated dsRNAs. Bars correspond to 5 μm.

    Techniques Used: Infection, Incubation, Staining, Labeling, Microscopy, Software

    Re-localization of spherules from the plasma membrane into the cytoplasm. (A) Plasma membrane invaginations and vacuole formation in BHK-21 cells, infected with SINV/nsP3GFP, at 3 h postinfection. The bar corresponds to 200 nm. (B) CPV1 in BHK-21 cells, infected with SINV/nsP3GFP, at 6 h postinfection. The bar corresponds to 100 nm. (C and D) Distribution of nsP1, nsP3-GFP, and dsRNA in the cells at 2 and 8 h postinfection with SINV/nsP3GFP, respectively. BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At the indicated times, cells were fixed, permeabilized, and stained with dsRNA- and nsP1-specific Abs. Panels a, xy panels represent multiple-intensity projections of a 1-μm xy section of the cell fragment, and xz and yz panels represent multiple-intensity projections of a 2-μm xy section as denoted on the xy panel. Panels b, c, and d, enlarged single xz section of the cell presented in panels a. Panels b show the distributions of nsP1 (red) and dsRNA (blue). A magenta color indicates colocalization of dsRNA and nsP1. Panels c show the distributions of nsP3 (green) and dsRNA (blue). A cyan color indicates colocalization of dsRNA and nsP3. Panels d demonstrate the distributions of nsP1 (red), nsP3 (green), and dsRNA (blue). A white color indicates colocalization of dsRNA and nonstructural proteins nsP1 and nsP3. The white arrowhead indicates the position of one of the endosomes stained with nsP1- and dsRNA-specific Ab and positive for the presence of nsP3-GFP. The red arrowhead indicates one of the nsP1-positive cytoplasmic complexes that lack nsP3-GFP and dsRNA. White arrows point to the cytoplasmic dsRNA-positive foci lacking nsP3-GFP and nsP1 association. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. Bars correspond to 5 μm.
    Figure Legend Snippet: Re-localization of spherules from the plasma membrane into the cytoplasm. (A) Plasma membrane invaginations and vacuole formation in BHK-21 cells, infected with SINV/nsP3GFP, at 3 h postinfection. The bar corresponds to 200 nm. (B) CPV1 in BHK-21 cells, infected with SINV/nsP3GFP, at 6 h postinfection. The bar corresponds to 100 nm. (C and D) Distribution of nsP1, nsP3-GFP, and dsRNA in the cells at 2 and 8 h postinfection with SINV/nsP3GFP, respectively. BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell. At the indicated times, cells were fixed, permeabilized, and stained with dsRNA- and nsP1-specific Abs. Panels a, xy panels represent multiple-intensity projections of a 1-μm xy section of the cell fragment, and xz and yz panels represent multiple-intensity projections of a 2-μm xy section as denoted on the xy panel. Panels b, c, and d, enlarged single xz section of the cell presented in panels a. Panels b show the distributions of nsP1 (red) and dsRNA (blue). A magenta color indicates colocalization of dsRNA and nsP1. Panels c show the distributions of nsP3 (green) and dsRNA (blue). A cyan color indicates colocalization of dsRNA and nsP3. Panels d demonstrate the distributions of nsP1 (red), nsP3 (green), and dsRNA (blue). A white color indicates colocalization of dsRNA and nonstructural proteins nsP1 and nsP3. The white arrowhead indicates the position of one of the endosomes stained with nsP1- and dsRNA-specific Ab and positive for the presence of nsP3-GFP. The red arrowhead indicates one of the nsP1-positive cytoplasmic complexes that lack nsP3-GFP and dsRNA. White arrows point to the cytoplasmic dsRNA-positive foci lacking nsP3-GFP and nsP1 association. Images were acquired on a Zeiss LSM700 confocal microscope with a 63× 1.4NA PlanApochromat oil objective. The image stacks were further processed using Huygens Professional deconvolution and Imaris 3D rendering software. Bars correspond to 5 μm.

    Techniques Used: Infection, Staining, Microscopy, Software

    5) Product Images from "Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein"

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00436-13

    Expression of Cp Clec in C. parvum -infected Caco-2 cells. (A) Quantitative reverse trancsription-PCR was performed on total RNA extracted from C. parvum -infected Caco-2 cells at various times postinfection (pi), from 0.5 to 72 h, using primers specific
    Figure Legend Snippet: Expression of Cp Clec in C. parvum -infected Caco-2 cells. (A) Quantitative reverse trancsription-PCR was performed on total RNA extracted from C. parvum -infected Caco-2 cells at various times postinfection (pi), from 0.5 to 72 h, using primers specific

    Techniques Used: Expressing, Infection, Polymerase Chain Reaction

    6) Product Images from "Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †"

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †

    Journal: Journal of Virology

    doi: 10.1128/JVI.01437-09

    Δ vpx SIVmac and HIV-1 is blocked at reverse transcription in MDM. (A) MDM were either not infected (mock), infected with wild-type SIV (SIV WT), or with Δ vpx SIV (SIV X − ). Cellular DNA was purified 6, 24, and 48 h postinfection
    Figure Legend Snippet: Δ vpx SIVmac and HIV-1 is blocked at reverse transcription in MDM. (A) MDM were either not infected (mock), infected with wild-type SIV (SIV WT), or with Δ vpx SIV (SIV X − ). Cellular DNA was purified 6, 24, and 48 h postinfection

    Techniques Used: Infection, Purification

    7) Product Images from "Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy"

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy

    Journal: Journal of Virology

    doi: 10.1128/JVI.00136-16

    Quantitation of hGM-CSF and IFN-β in infected cells. HT1080 and HeLa cells were infected with 73T-R and 73T-R-198 at an MOI of 0.5 or 5.0 PFU/cell. Aliquots of cell culture supernatants were taken at 16 h or 32 h postinfection (hpi). The hGM-CSF
    Figure Legend Snippet: Quantitation of hGM-CSF and IFN-β in infected cells. HT1080 and HeLa cells were infected with 73T-R and 73T-R-198 at an MOI of 0.5 or 5.0 PFU/cell. Aliquots of cell culture supernatants were taken at 16 h or 32 h postinfection (hpi). The hGM-CSF

    Techniques Used: Quantitation Assay, Infection, Cell Culture

    8) Product Images from "Bracoviruses Contain a Large Multigene Family Coding for Protein Tyrosine Phosphatases"

    Article Title: Bracoviruses Contain a Large Multigene Family Coding for Protein Tyrosine Phosphatases

    Journal: Journal of Virology

    doi: 10.1128/JVI.78.23.13090-13103.2004

    Expression of CcBV PTPA and PTPM from baculovirus infections and screen for protein tyrosine phosphatase activity. Sf21 insect cells were infected with wild-type A. californica nucleopolyhedrovirus (lane WT) or recombinant baculovirus Rec-PTPA or Rec-PTPM. Infected cell RNA was collected and subjected to reverse transcription-PCR, and the products were analyzed by electrophoresis on 1.5% agarose gels (A and C). PTPA- and PTPM-specific bands (A and C, respectively) are indicated with arrows. DNA markers (lane M), template-free reaction (lane −), and reaction lacking reverse transcriptase (lane no RT) are indicated. Panel B shows protein metabolic labeling and SDS-PAGE of proteins from Rec-PTPA-infected cells, and panel D shows SDS-PAGE and Coomassie brilliant blue staining of proteins from Rec-PTPM-infected cells at various times postinfection (hours). Pol, A. californica nucleopolyhedrovirus very late structural protein. Infected cell lysates (E), precleared of free phosphate, were exposed to a synthetic tyrosine phosphopeptide (Promega), and liberated phosphate was measured spectrophotometrically at 600 nm. +I indicates the presence of a protein tyrosine phosphatase inhibitor. The asterisk denotes significantly more protein tyrosine phosphatase activity ( P = 0.02) compared to wild-type-infected extracts.
    Figure Legend Snippet: Expression of CcBV PTPA and PTPM from baculovirus infections and screen for protein tyrosine phosphatase activity. Sf21 insect cells were infected with wild-type A. californica nucleopolyhedrovirus (lane WT) or recombinant baculovirus Rec-PTPA or Rec-PTPM. Infected cell RNA was collected and subjected to reverse transcription-PCR, and the products were analyzed by electrophoresis on 1.5% agarose gels (A and C). PTPA- and PTPM-specific bands (A and C, respectively) are indicated with arrows. DNA markers (lane M), template-free reaction (lane −), and reaction lacking reverse transcriptase (lane no RT) are indicated. Panel B shows protein metabolic labeling and SDS-PAGE of proteins from Rec-PTPA-infected cells, and panel D shows SDS-PAGE and Coomassie brilliant blue staining of proteins from Rec-PTPM-infected cells at various times postinfection (hours). Pol, A. californica nucleopolyhedrovirus very late structural protein. Infected cell lysates (E), precleared of free phosphate, were exposed to a synthetic tyrosine phosphopeptide (Promega), and liberated phosphate was measured spectrophotometrically at 600 nm. +I indicates the presence of a protein tyrosine phosphatase inhibitor. The asterisk denotes significantly more protein tyrosine phosphatase activity ( P = 0.02) compared to wild-type-infected extracts.

    Techniques Used: Expressing, Activity Assay, Infection, Recombinant, Polymerase Chain Reaction, Electrophoresis, Labeling, SDS Page, Staining

    9) Product Images from "Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients"

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients

    Journal: Journal of Virology

    doi: 10.1128/JVI.02516-15

    Characterization of the LyE1E2-HCVcc lymphotropism. (A) Quantification of cell-associated viral RNA following Raji cell infection with HCVcc harboring the different E1E2 proteins (H77, L1a, and L3k) or no E1E2 (ΔE1E2). Four days postinfection,
    Figure Legend Snippet: Characterization of the LyE1E2-HCVcc lymphotropism. (A) Quantification of cell-associated viral RNA following Raji cell infection with HCVcc harboring the different E1E2 proteins (H77, L1a, and L3k) or no E1E2 (ΔE1E2). Four days postinfection,

    Techniques Used: Infection

    10) Product Images from "APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿"

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02358-09

    Comparison of effects of A3F and A3G on U5 viral DNA ends of the 3′-LTR. (A) Schematic representation of HIV-1 reverse transcription and U5 viral DNA end fragments detected after restriction enzyme digestion with HindIII. (i) Virion-incorporated tRNA binds to the primer binding site (PBS) of viral genomic RNA and initiates minus-strand DNA synthesis. (ii) Minus-strand strong stop (−SSS) DNA is transferred to the 3′ end of genomic RNA and continues the synthesis of viral minus-strand DNA. (iii) Viral plus-strand DNA synthesis initiates from the polypurine tract (PPT) and is elongated until the end of the PBS region of minus-strand DNA. (iv) In the absence of A3G or in the presence of A3F, RNase H cleaves the tRNA primer between the 3′ adenosine and cytosine nucleotides. (v) The released plus-strand strong-stop (+SSS) DNA is transferred and annealed to the PBS of minus-strand DNA. (vi) Both strands are extended to complete full-length cDNA synthesis, and integrase (IN) removes the 3′ GT dinucleotide from the proviral DNA. After digestion with HindIII, the processed U5 plus-strand DNA generates a 103-nt fragment, the unprocessed end generates a 105-nt fragment, and the 122-nt fragment corresponds to viral +SSS DNA; A3F inhibits the 3′-processing reaction. (vii) In the presence of A3G, an aberrant cleavage of the tRNA primer by RNase H occurs 6 nt upstream. (viii) The partially released +SSS DNA is transferred and annealed to the PBS of minus-strand DNA. (ix) Both strands are extended to the complete full-length cDNA synthesis, and reverse transcription of the fragment of the tRNA primer that remains associated with the minus-strand DNA generates a 6-nt extension at the 3′ end of the plus-strand DNA. This generates an aberrant 111-nt fragment following digestion with HindIII. The thin line represents RNA; the thick line, DNA; dashed thin lines, RNA template degraded by RNase H; arrows, the direction of DNA synthesis; the black box, the riboprobe that hybridizes to the plus strand of U5 at the 3′-LTR. (B) Southern blot analysis of U5 viral DNA plus strand at the 3′-LTR. Viral preintegration complexes (PICs) were harvested at 6 h postinfection, and viral late RT products were quantified by real-time PCR probing the U5-ψ region. The virions were produced in the absence of A3G/A3F or in the presence of 0.5 or 2 μg of A3G or 2 μg of A3F. Viral late RT products (3 × 10 7 copies) from each sample were digested with HindIII and analyzed by Southern blotting. The +SSS DNA fragment (122 nt), aberrant DNA fragment (111 nt), unprocessed 3′-U5 plus-strand DNA fragment (105 nt), and the processed 3′-U5 plus-strand DNA fragment (103 nt) are shown. The 3′-processing efficiency was calculated by the proportion of processed band (103 nt) to the processed plus unprocessed bands (103 nt and 105 plus 106 nt). The 106-nt band is not labeled. The values are averages from two independent experiments ± standard errors.
    Figure Legend Snippet: Comparison of effects of A3F and A3G on U5 viral DNA ends of the 3′-LTR. (A) Schematic representation of HIV-1 reverse transcription and U5 viral DNA end fragments detected after restriction enzyme digestion with HindIII. (i) Virion-incorporated tRNA binds to the primer binding site (PBS) of viral genomic RNA and initiates minus-strand DNA synthesis. (ii) Minus-strand strong stop (−SSS) DNA is transferred to the 3′ end of genomic RNA and continues the synthesis of viral minus-strand DNA. (iii) Viral plus-strand DNA synthesis initiates from the polypurine tract (PPT) and is elongated until the end of the PBS region of minus-strand DNA. (iv) In the absence of A3G or in the presence of A3F, RNase H cleaves the tRNA primer between the 3′ adenosine and cytosine nucleotides. (v) The released plus-strand strong-stop (+SSS) DNA is transferred and annealed to the PBS of minus-strand DNA. (vi) Both strands are extended to complete full-length cDNA synthesis, and integrase (IN) removes the 3′ GT dinucleotide from the proviral DNA. After digestion with HindIII, the processed U5 plus-strand DNA generates a 103-nt fragment, the unprocessed end generates a 105-nt fragment, and the 122-nt fragment corresponds to viral +SSS DNA; A3F inhibits the 3′-processing reaction. (vii) In the presence of A3G, an aberrant cleavage of the tRNA primer by RNase H occurs 6 nt upstream. (viii) The partially released +SSS DNA is transferred and annealed to the PBS of minus-strand DNA. (ix) Both strands are extended to the complete full-length cDNA synthesis, and reverse transcription of the fragment of the tRNA primer that remains associated with the minus-strand DNA generates a 6-nt extension at the 3′ end of the plus-strand DNA. This generates an aberrant 111-nt fragment following digestion with HindIII. The thin line represents RNA; the thick line, DNA; dashed thin lines, RNA template degraded by RNase H; arrows, the direction of DNA synthesis; the black box, the riboprobe that hybridizes to the plus strand of U5 at the 3′-LTR. (B) Southern blot analysis of U5 viral DNA plus strand at the 3′-LTR. Viral preintegration complexes (PICs) were harvested at 6 h postinfection, and viral late RT products were quantified by real-time PCR probing the U5-ψ region. The virions were produced in the absence of A3G/A3F or in the presence of 0.5 or 2 μg of A3G or 2 μg of A3F. Viral late RT products (3 × 10 7 copies) from each sample were digested with HindIII and analyzed by Southern blotting. The +SSS DNA fragment (122 nt), aberrant DNA fragment (111 nt), unprocessed 3′-U5 plus-strand DNA fragment (105 nt), and the processed 3′-U5 plus-strand DNA fragment (103 nt) are shown. The 3′-processing efficiency was calculated by the proportion of processed band (103 nt) to the processed plus unprocessed bands (103 nt and 105 plus 106 nt). The 106-nt band is not labeled. The values are averages from two independent experiments ± standard errors.

    Techniques Used: Binding Assay, DNA Synthesis, Southern Blot, Real-time Polymerase Chain Reaction, Produced, Labeling

    Comparison of effects of A3F and A3G proteins on U3 viral DNA ends of the 5′-LTR. (A) Reverse transcription products of U3 viral DNA of the 5′-LTR were detected after digestion with the restriction enzyme EarI and by using an RNA probe (black box) that hybridizes to the U3 minus strand of the viral 5′-LTR. The unprocessed fragment of the 3′ end of the minus strand after EarI treatment is 171 nt in length; the processed fragment is 169 nt in length. (B) Southern blot analysis of the U3 minus strand at 5′-LTR. Viral PICs were harvested at 6 h postinfection and quantified by real-time PCR to determine the viral late RT products by probing the U5-ψ region. A total of 3 × 10 7 copies of viral late RT products from each sample listed at the top and as described for panel A were digested with EarI and analyzed by Southern blotting. The processing efficiency was calculated by the proportion of processed band (169 nt) to both processed and unprocessed bands (169 and 171 nt). The values are averages from three independent experiments ± standard deviations.
    Figure Legend Snippet: Comparison of effects of A3F and A3G proteins on U3 viral DNA ends of the 5′-LTR. (A) Reverse transcription products of U3 viral DNA of the 5′-LTR were detected after digestion with the restriction enzyme EarI and by using an RNA probe (black box) that hybridizes to the U3 minus strand of the viral 5′-LTR. The unprocessed fragment of the 3′ end of the minus strand after EarI treatment is 171 nt in length; the processed fragment is 169 nt in length. (B) Southern blot analysis of the U3 minus strand at 5′-LTR. Viral PICs were harvested at 6 h postinfection and quantified by real-time PCR to determine the viral late RT products by probing the U5-ψ region. A total of 3 × 10 7 copies of viral late RT products from each sample listed at the top and as described for panel A were digested with EarI and analyzed by Southern blotting. The processing efficiency was calculated by the proportion of processed band (169 nt) to both processed and unprocessed bands (169 and 171 nt). The values are averages from three independent experiments ± standard deviations.

    Techniques Used: Southern Blot, Real-time Polymerase Chain Reaction

    11) Product Images from "Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations"

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations

    Journal: Journal of Virology

    doi: 10.1128/JVI.01507-12

    Viral growth and DNA accumulation kinetics of the AcMNPV APC r and ABC r primary drug escape mutants. (A) Sf21 cells were independently infected with the APC r and ABC r mutants and parental AcMNPV (MOI = 0.1) in the absence of drugs. The production of budded virus was assayed by using TCID 50 endpoint dilution assays at different times postinfection (0 to 72 hpi). (B) Sf21 cells were infected with WT AcMNPV or the APC r or ABC r mutant at an MOI of 10. (C) The APC r mutant and AcMNPV were grown in the presence of either abacavir (100 μM) or aphidicolin (6.25 μM) throughout, as indicated. (D) The ABC r mutant and AcMNPV were grown in the presence of either abacavir (100 μM) or aphidicolin (6.25 μM) throughout, as indicated. For panels B to D, total intracellular DNA was extracted at different times postinfection from infected cells treated with aphidicolin and abacavir, and AcMNPV DNA copy numbers were determined by qPCR. Bars in the panels represent standard deviations determined from three independent replicates.
    Figure Legend Snippet: Viral growth and DNA accumulation kinetics of the AcMNPV APC r and ABC r primary drug escape mutants. (A) Sf21 cells were independently infected with the APC r and ABC r mutants and parental AcMNPV (MOI = 0.1) in the absence of drugs. The production of budded virus was assayed by using TCID 50 endpoint dilution assays at different times postinfection (0 to 72 hpi). (B) Sf21 cells were infected with WT AcMNPV or the APC r or ABC r mutant at an MOI of 10. (C) The APC r mutant and AcMNPV were grown in the presence of either abacavir (100 μM) or aphidicolin (6.25 μM) throughout, as indicated. (D) The ABC r mutant and AcMNPV were grown in the presence of either abacavir (100 μM) or aphidicolin (6.25 μM) throughout, as indicated. For panels B to D, total intracellular DNA was extracted at different times postinfection from infected cells treated with aphidicolin and abacavir, and AcMNPV DNA copy numbers were determined by qPCR. Bars in the panels represent standard deviations determined from three independent replicates.

    Techniques Used: Infection, Mutagenesis, Real-time Polymerase Chain Reaction

    Analysis of virus production and viral DNA replication of WT rep , APC rep , and ABC rep repair viruses. (A) Monolayers were transfected with 5 μg of APC rep , ABC rep , WT rep , or Ac KO GFP bacmid in the absence of the drugs. (B) Sf21 cells were infected by APC rep , ABC rep , and WT rep viruses at an MOI of 0.01 in the absence of the drugs. For panels A and B, supernatant samples were collected at the indicated time points and assayed for the production of infectious virus by a TCID 50 assay. (C) Sf21 cells were infected by APC rep , ABC rep , and WT rep viruses at an MOI of 10 in the absence of the drugs. Total intracellular DNA was extracted at different times postinfection. The quantification of AcMNPV DNA copy numbers was performed by qPCR. Each datum point represents the average value from three independent transfections, and error bars represent standard errors.
    Figure Legend Snippet: Analysis of virus production and viral DNA replication of WT rep , APC rep , and ABC rep repair viruses. (A) Monolayers were transfected with 5 μg of APC rep , ABC rep , WT rep , or Ac KO GFP bacmid in the absence of the drugs. (B) Sf21 cells were infected by APC rep , ABC rep , and WT rep viruses at an MOI of 0.01 in the absence of the drugs. For panels A and B, supernatant samples were collected at the indicated time points and assayed for the production of infectious virus by a TCID 50 assay. (C) Sf21 cells were infected by APC rep , ABC rep , and WT rep viruses at an MOI of 10 in the absence of the drugs. Total intracellular DNA was extracted at different times postinfection. The quantification of AcMNPV DNA copy numbers was performed by qPCR. Each datum point represents the average value from three independent transfections, and error bars represent standard errors.

    Techniques Used: Transfection, Infection, Real-time Polymerase Chain Reaction

    12) Product Images from "TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection"

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00899-17

    Plasmodium berghei ANKA induces expression of TCRβ on neutrophils in C57BL/6 and BALB/c mice. Mice were infected with 10 6 Plasmodium berghei ANKA ( Pb-A ) parasites. The proportion of neutrophils that were TCRβ + CD3ε − (A) was then determined and graphed as proportion (B) and absolute number (C) during a strain ANKA infection in C57BL/6 and BALB/c mice. (D) TCRβ and CD3ε expression was also measured on brain-sequestered neutrophils of susceptible C57BL/6 mice on days 0, 3, and 6 postinfection and resistant BALB/c mice on day 6 postinfection. Findings are presented as proportion (E) and absolute number (F). A fluorescence-minus-one control for TCRβ was used for gating purposes. n = 5 (spleen) and n = 4 (brain) for each time point for each strain of mouse, and results presented are representative of three independent experiments.
    Figure Legend Snippet: Plasmodium berghei ANKA induces expression of TCRβ on neutrophils in C57BL/6 and BALB/c mice. Mice were infected with 10 6 Plasmodium berghei ANKA ( Pb-A ) parasites. The proportion of neutrophils that were TCRβ + CD3ε − (A) was then determined and graphed as proportion (B) and absolute number (C) during a strain ANKA infection in C57BL/6 and BALB/c mice. (D) TCRβ and CD3ε expression was also measured on brain-sequestered neutrophils of susceptible C57BL/6 mice on days 0, 3, and 6 postinfection and resistant BALB/c mice on day 6 postinfection. Findings are presented as proportion (E) and absolute number (F). A fluorescence-minus-one control for TCRβ was used for gating purposes. n = 5 (spleen) and n = 4 (brain) for each time point for each strain of mouse, and results presented are representative of three independent experiments.

    Techniques Used: Expressing, Mouse Assay, Infection, Fluorescence

    Comparison of TCRβ expression on neutrophils in C57BL/6 wild-type versus nude and rag1 knockout mice. Mice were infected with 10 6 Plasmodium berghei ANKA ( Pb-A ) parasites, and TCRβ expression was compared in gated CD11b + Ly6G + neutrophils isolated from wild-type (A and D) versus nude (B and E) and rag1 knockout (C and F) spleen tissue. The proportion of neutrophils that express TCRβ and the absolute number of TCRβ-expressing neutrophils was compared in naive mice (G and H) and in strain ANKA-infected mice on day 6 postinfection (I and J). Absence of peripheral T cells in nude and Rag1 knockout mice did not reduce TCRβ expression by neutrophils. A fluorescence-minus-one control was used to select the gate for TCRβ. n = 5 for each time point for each group of mice, and results presented are representative of two independent experiments. ns, not significant; *, P
    Figure Legend Snippet: Comparison of TCRβ expression on neutrophils in C57BL/6 wild-type versus nude and rag1 knockout mice. Mice were infected with 10 6 Plasmodium berghei ANKA ( Pb-A ) parasites, and TCRβ expression was compared in gated CD11b + Ly6G + neutrophils isolated from wild-type (A and D) versus nude (B and E) and rag1 knockout (C and F) spleen tissue. The proportion of neutrophils that express TCRβ and the absolute number of TCRβ-expressing neutrophils was compared in naive mice (G and H) and in strain ANKA-infected mice on day 6 postinfection (I and J). Absence of peripheral T cells in nude and Rag1 knockout mice did not reduce TCRβ expression by neutrophils. A fluorescence-minus-one control was used to select the gate for TCRβ. n = 5 for each time point for each group of mice, and results presented are representative of two independent experiments. ns, not significant; *, P

    Techniques Used: Expressing, Knock-Out, Mouse Assay, Infection, Isolation, Fluorescence

    TCRβ + neutrophils display enhanced phagocytosis of pRBC compared to TCRβ − neutrophils. (A to D) The ability of CD11b + Ly6G + neutrophils (A) that are TCRβ + versus TCRβ − (B) to phagocytose pRBC (C and D) after 90 min was analyzed in an in vitro phagocytosis assay consisting of a 1:1 ratio of pRBC (labeled with CellTrace Far Red), and splenocytes (stained with neutrophil and T cell markers) isolated from C57BL/6 mice on day 3 postinfection with strain ANKA. (E) The percentage of neutrophils that phagocytosed pRBC was compared in TCRβ + versus TCRβ − neutrophils. (F) In addition, the pRBC MFI was compared in TCRβ + versus TCRβ − neutrophils that had undergone phagocytosis to determine if TCRβ expression influenced the quantity of pRBC phagocytosed by a single neutrophil. A fluorescence-minus-one control was used to select the gate for TCRβ. n = 3 for each phagocytosis assay, and results presented are a replicate from three independent experiments.
    Figure Legend Snippet: TCRβ + neutrophils display enhanced phagocytosis of pRBC compared to TCRβ − neutrophils. (A to D) The ability of CD11b + Ly6G + neutrophils (A) that are TCRβ + versus TCRβ − (B) to phagocytose pRBC (C and D) after 90 min was analyzed in an in vitro phagocytosis assay consisting of a 1:1 ratio of pRBC (labeled with CellTrace Far Red), and splenocytes (stained with neutrophil and T cell markers) isolated from C57BL/6 mice on day 3 postinfection with strain ANKA. (E) The percentage of neutrophils that phagocytosed pRBC was compared in TCRβ + versus TCRβ − neutrophils. (F) In addition, the pRBC MFI was compared in TCRβ + versus TCRβ − neutrophils that had undergone phagocytosis to determine if TCRβ expression influenced the quantity of pRBC phagocytosed by a single neutrophil. A fluorescence-minus-one control was used to select the gate for TCRβ. n = 3 for each phagocytosis assay, and results presented are a replicate from three independent experiments.

    Techniques Used: In Vitro, Phagocytosis Assay, Labeling, Staining, Isolation, Mouse Assay, Expressing, Fluorescence

    Measurement of neutrophils during a Plasmodium berghei ANKA infection in ECM-susceptible C57BL/6 and -resistant BALB/c mice. Mice were infected with 10 6 Plasmodium berghei ANKA ( Pb-A ) parasites. (A to D) Parasitemia was enumerated in the two strains of mice (A), and neutrophils were quantitated by measuring the expression of CD11b and Ly6G on live lymphocyte singlets in spleen tissue (B) and plotted as proportion (C) and absolute number (D) over the course of a strain ANKA infection. (E to G) Neutrophils were also quantitated in perfused brain tissue (E), and the percentage (F) and absolute number (G) of brain-sequestered leukocytes that were CD11b + Ly6G + neutrophils was also determined in perfused brain tissue of susceptible C57BL/6 mice on days 0, 3, and 6 postinfection and resistant BALB/c mice on day 6 postinfection. n = 5 (spleen) and n = 4 (brain) for each time point for each strain of mouse, and results presented are representative of three independent experiments.
    Figure Legend Snippet: Measurement of neutrophils during a Plasmodium berghei ANKA infection in ECM-susceptible C57BL/6 and -resistant BALB/c mice. Mice were infected with 10 6 Plasmodium berghei ANKA ( Pb-A ) parasites. (A to D) Parasitemia was enumerated in the two strains of mice (A), and neutrophils were quantitated by measuring the expression of CD11b and Ly6G on live lymphocyte singlets in spleen tissue (B) and plotted as proportion (C) and absolute number (D) over the course of a strain ANKA infection. (E to G) Neutrophils were also quantitated in perfused brain tissue (E), and the percentage (F) and absolute number (G) of brain-sequestered leukocytes that were CD11b + Ly6G + neutrophils was also determined in perfused brain tissue of susceptible C57BL/6 mice on days 0, 3, and 6 postinfection and resistant BALB/c mice on day 6 postinfection. n = 5 (spleen) and n = 4 (brain) for each time point for each strain of mouse, and results presented are representative of three independent experiments.

    Techniques Used: Infection, Mouse Assay, Expressing

    TCRβ expression by the neutrophil correlates with parasite burden on day 3 postinfection with Plasmodium berghei ANKA. On day 3 postinfection, the percentage of live singlet CD11b + Ly6G + neutrophils in the spleen that are TCRβ + CD3ε − was correlated with peripheral parasitemia (parasitized erythrocytes/total erythrocytes × 100) in five individual mice. Results presented are representative of four independent experiments. P ≤ 0.01; Pearson r correlation R 2 value of 0.92.
    Figure Legend Snippet: TCRβ expression by the neutrophil correlates with parasite burden on day 3 postinfection with Plasmodium berghei ANKA. On day 3 postinfection, the percentage of live singlet CD11b + Ly6G + neutrophils in the spleen that are TCRβ + CD3ε − was correlated with peripheral parasitemia (parasitized erythrocytes/total erythrocytes × 100) in five individual mice. Results presented are representative of four independent experiments. P ≤ 0.01; Pearson r correlation R 2 value of 0.92.

    Techniques Used: Expressing, Mouse Assay

    13) Product Images from "Hhex induces promyelocyte self-renewal and cooperates with growth factor independence to cause myeloid leukemia in mice"

    Article Title: Hhex induces promyelocyte self-renewal and cooperates with growth factor independence to cause myeloid leukemia in mice

    Journal: Blood Advances

    doi: 10.1182/bloodadvances.2017013243

    Hhex-induced promyelocyte transformation is independent of p16 Ink4a and p19 Arf . (A) Growth curves showing expansion of wild-type (WT), Cdkn2a -knockout (p16/19KO), or p19-knockout (p19 KO) Lin − myeloid progenitors, infected with either control (MIG) or Hhex-overexpressing (Hhex) retroviruses and cultured in vitro in the presence of IL-3. (B) FACS analysis of GFP and Mac-1 expression in myeloid cultures as in panel A at day 28 postinfection.
    Figure Legend Snippet: Hhex-induced promyelocyte transformation is independent of p16 Ink4a and p19 Arf . (A) Growth curves showing expansion of wild-type (WT), Cdkn2a -knockout (p16/19KO), or p19-knockout (p19 KO) Lin − myeloid progenitors, infected with either control (MIG) or Hhex-overexpressing (Hhex) retroviruses and cultured in vitro in the presence of IL-3. (B) FACS analysis of GFP and Mac-1 expression in myeloid cultures as in panel A at day 28 postinfection.

    Techniques Used: Transformation Assay, Knock-Out, Infection, Cell Culture, In Vitro, FACS, Expressing

    RNA sequencing analysis of Hhex overexpression in LSK cells. (A) RNA Seq trace showing expression of Hhex in LSK cells 2 days postinfection with control (MIG) or Hhex-expressing (MIG-Hhex) retroviruses. Units are reads per million mapped reads (RPM). (B) Waterfall plots showing RNA Seq analysis of the top 20 downregulated genes (left panel) and upregulated genes (right panel) in LSK cells 2 days postinfection with control or Hhex-expressing retroviruses (n = 3). (C-D) Inverse correlation between Hhex-overexpressing and -knockout LSK cells. Genes that are significantly upregulated (C) and downregulated (D) following Hhex deletion in LSK cells in vivo were compared in control (MIG) and Hhex-overexpressing (MIG-Hhex) LSK cells using gene set enrichment analysis. In panel C, the enrichment plot (left) demonstrates that genes upregulated in Hhex-knockout LSK cells are repressed in Hhex-overexpressing (MIG-Hhex) LSK cells, whereas the heat map (right) shows the relative expression of the top 30 genes that are both upregulated following Hhex deletion and downregulated following Hhex overexpression. In panel D, the enrichment plot (right) demonstrates that genes downregulated in Hhex-knockout LSK cells are upregulated in Hhex-overexpressing LSK cells, whereas the heat map (right) shows the relative expression of the top 30 genes that are both downregulated following Hhex deletion and upregulated following Hhex overexpression. FDR, false detection rate; NES, normalized enrichment score.
    Figure Legend Snippet: RNA sequencing analysis of Hhex overexpression in LSK cells. (A) RNA Seq trace showing expression of Hhex in LSK cells 2 days postinfection with control (MIG) or Hhex-expressing (MIG-Hhex) retroviruses. Units are reads per million mapped reads (RPM). (B) Waterfall plots showing RNA Seq analysis of the top 20 downregulated genes (left panel) and upregulated genes (right panel) in LSK cells 2 days postinfection with control or Hhex-expressing retroviruses (n = 3). (C-D) Inverse correlation between Hhex-overexpressing and -knockout LSK cells. Genes that are significantly upregulated (C) and downregulated (D) following Hhex deletion in LSK cells in vivo were compared in control (MIG) and Hhex-overexpressing (MIG-Hhex) LSK cells using gene set enrichment analysis. In panel C, the enrichment plot (left) demonstrates that genes upregulated in Hhex-knockout LSK cells are repressed in Hhex-overexpressing (MIG-Hhex) LSK cells, whereas the heat map (right) shows the relative expression of the top 30 genes that are both upregulated following Hhex deletion and downregulated following Hhex overexpression. In panel D, the enrichment plot (right) demonstrates that genes downregulated in Hhex-knockout LSK cells are upregulated in Hhex-overexpressing LSK cells, whereas the heat map (right) shows the relative expression of the top 30 genes that are both downregulated following Hhex deletion and upregulated following Hhex overexpression. FDR, false detection rate; NES, normalized enrichment score.

    Techniques Used: RNA Sequencing Assay, Over Expression, Expressing, Knock-Out, In Vivo

    14) Product Images from "Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells"

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells

    Journal: Journal of Virology

    doi:

    Time course of accumulation of spliced and unspliced α-globin RNA. HeLa cells were infected with KOS or 5dl1.2 in the presence of PAA. Total RNA harvested at the indicated times postinfection was treated with RNase H in the presence of oligo(dT) to remove the poly(A) tails and then analyzed by Northern blot hybridization using 32 P-labeled oligonucleotide probes specific for intron 1 (A) or exon 1 (B). Lane C, control blood RNA; lane M, RNA size markers (in kilobases). Signals representing the fully processed (C) and unprocessed (D) α-globin transcripts detected in panel B were quantified by phosphorimager analysis, and normalized data were plotted.
    Figure Legend Snippet: Time course of accumulation of spliced and unspliced α-globin RNA. HeLa cells were infected with KOS or 5dl1.2 in the presence of PAA. Total RNA harvested at the indicated times postinfection was treated with RNase H in the presence of oligo(dT) to remove the poly(A) tails and then analyzed by Northern blot hybridization using 32 P-labeled oligonucleotide probes specific for intron 1 (A) or exon 1 (B). Lane C, control blood RNA; lane M, RNA size markers (in kilobases). Signals representing the fully processed (C) and unprocessed (D) α-globin transcripts detected in panel B were quantified by phosphorimager analysis, and normalized data were plotted.

    Techniques Used: Infection, Northern Blot, Hybridization, Labeling

    Unspliced α-globin RNA accumulates in the cytoplasm. Duplicate dishes of HeLa cells were infected with HSV-1 strain KOS1.1 or d 27-1 in the presence of PAA. At 6 h postinfection, total RNA (T) was harvested from one dish and cytoplasmic (C) and nuclear (N) RNA fractions were isolated from the second dish. Cell equivalents of each RNA sample (10 μg of total RNA) were treated with RNase H and oligo(dT) and then analyzed by Northern blot hybridization for the presence of α-globin transcripts (A). As a cell fractionation control, the same samples were analyzed for their content of U3 snoRNA by hybridization to an oligonucleotide probe specific for U3 (B).
    Figure Legend Snippet: Unspliced α-globin RNA accumulates in the cytoplasm. Duplicate dishes of HeLa cells were infected with HSV-1 strain KOS1.1 or d 27-1 in the presence of PAA. At 6 h postinfection, total RNA (T) was harvested from one dish and cytoplasmic (C) and nuclear (N) RNA fractions were isolated from the second dish. Cell equivalents of each RNA sample (10 μg of total RNA) were treated with RNase H and oligo(dT) and then analyzed by Northern blot hybridization for the presence of α-globin transcripts (A). As a cell fractionation control, the same samples were analyzed for their content of U3 snoRNA by hybridization to an oligonucleotide probe specific for U3 (B).

    Techniques Used: Infection, Isolation, Northern Blot, Hybridization, Cell Fractionation

    15) Product Images from "Tumor Suppressor Cylindromatosis (CYLD) Controls HIV Transcription in an NF-κB-Dependent Manner"

    Article Title: Tumor Suppressor Cylindromatosis (CYLD) Controls HIV Transcription in an NF-κB-Dependent Manner

    Journal: Journal of Virology

    doi: 10.1128/JVI.00239-14

    Identification of the viral steps affected by CYLD silencing. (A) HEK 293T cells transiently transfected with CYLD siRNA or nontargeting (NT) siRNA were infected with VSV-G HIV NL4.3 luciferase reporter virus. DNA was extracted at 24 h postinfection, and total HIV DA was quantified by qPCR. The NT siRNA is set at 1, and values represent fold induction over NT siRNA. (B) HEK 293T cells were treated as for panel A, and integrated provirus was quantified by qPCR. The NT siRNA was set to 1, and the plotted values represent the fold induction over NT siRNA. (C) HEK 293T cells transiently transfected with CYLD-targeting siRNA (CYLD siRNA) or nontargeting siRNA (NT siRNA) as a control were infected with VSV-G HIV NL4.3. HIV mRNA expression was analyzed by qPCR using the ΔΔ C T method at 24 h postinfection; data were plotted as fold change compared to control cells (NT siRNA). Values represent means plus SEM for three independent experiments. The NT shRNA was set to 1, and values represent fold changes over NT shRNA expressing cells. Expression of HIV mRNA relative to the housekeeping gene rsp11 is 0.09. **, P
    Figure Legend Snippet: Identification of the viral steps affected by CYLD silencing. (A) HEK 293T cells transiently transfected with CYLD siRNA or nontargeting (NT) siRNA were infected with VSV-G HIV NL4.3 luciferase reporter virus. DNA was extracted at 24 h postinfection, and total HIV DA was quantified by qPCR. The NT siRNA is set at 1, and values represent fold induction over NT siRNA. (B) HEK 293T cells were treated as for panel A, and integrated provirus was quantified by qPCR. The NT siRNA was set to 1, and the plotted values represent the fold induction over NT siRNA. (C) HEK 293T cells transiently transfected with CYLD-targeting siRNA (CYLD siRNA) or nontargeting siRNA (NT siRNA) as a control were infected with VSV-G HIV NL4.3. HIV mRNA expression was analyzed by qPCR using the ΔΔ C T method at 24 h postinfection; data were plotted as fold change compared to control cells (NT siRNA). Values represent means plus SEM for three independent experiments. The NT shRNA was set to 1, and values represent fold changes over NT shRNA expressing cells. Expression of HIV mRNA relative to the housekeeping gene rsp11 is 0.09. **, P

    Techniques Used: Transfection, Infection, Luciferase, Real-time Polymerase Chain Reaction, Expressing, shRNA

    The increase in HIV transcription in CYLD knockdown cells is NF-κB/NFAT dependent. (A) Schematic representation of the different viruses used for panel B. (B) HEK 293T cells transiently transfected with CYLD siRNA (CYLD siRNA) or nontargeting siRNA (NT siRNA) were infected with the indicated viruses. HIV mRNA expression was analyzed by qPCR using the ΔΔ C T method at 24 h postinfection; data were plotted as fold change compared to nontargeting siRNA-transfected cells. Values are means plus SEM for two independent experiments. The values for the NT siRNA were set to 1, and values represent fold change over NT siRNA-expressing cells. Expression of HIV WT mRNA relative to the housekeeping gene rsp11 is 0.091, that of HIV ΔUSF is 0.046, that of HIV ΔNF-IL-6 is 0.04, and that of HIV ΔNF-κB I,II is 0.09. (C) Schematic representation of the different LTR reporter plasmids used for panel D. (D) HEK 293T cells stably expressing CYLD shRNA or NT shRNA were transfected with luciferase reporter plasmid under the control of HIV LTR, HIV-ΔNF-κB I,II LTR, MLV LTR, or an MLV (HIV U3) LTR chimera (HIV U3 promoter region inserted into MLV) and TK- Renilla as a control. Luciferase and Renilla expression was measured 48 h later. Luciferase values were normalized to the Renilla values and then plotted as fold change over the NT shRNA control. Values are means plus SEM for two independent experiments. The values for the NT shRNA were set to 1, and values represent fold change over NT shRNA-expressing cells. Average raw RLU values for the HIV-LTR WT NT control were 121,155 ± 1,270, those for the HIV-ΔNF-κBI,II LTR NT control were 306,691 ± 36168, those for the MLV-LTR NT control were 83,520 ± 10,650, and those for the MLV (HIV U3) LTR NT control were 131,173 ± 2,352. The average of Renilla control values was 2,180 ± 768.
    Figure Legend Snippet: The increase in HIV transcription in CYLD knockdown cells is NF-κB/NFAT dependent. (A) Schematic representation of the different viruses used for panel B. (B) HEK 293T cells transiently transfected with CYLD siRNA (CYLD siRNA) or nontargeting siRNA (NT siRNA) were infected with the indicated viruses. HIV mRNA expression was analyzed by qPCR using the ΔΔ C T method at 24 h postinfection; data were plotted as fold change compared to nontargeting siRNA-transfected cells. Values are means plus SEM for two independent experiments. The values for the NT siRNA were set to 1, and values represent fold change over NT siRNA-expressing cells. Expression of HIV WT mRNA relative to the housekeeping gene rsp11 is 0.091, that of HIV ΔUSF is 0.046, that of HIV ΔNF-IL-6 is 0.04, and that of HIV ΔNF-κB I,II is 0.09. (C) Schematic representation of the different LTR reporter plasmids used for panel D. (D) HEK 293T cells stably expressing CYLD shRNA or NT shRNA were transfected with luciferase reporter plasmid under the control of HIV LTR, HIV-ΔNF-κB I,II LTR, MLV LTR, or an MLV (HIV U3) LTR chimera (HIV U3 promoter region inserted into MLV) and TK- Renilla as a control. Luciferase and Renilla expression was measured 48 h later. Luciferase values were normalized to the Renilla values and then plotted as fold change over the NT shRNA control. Values are means plus SEM for two independent experiments. The values for the NT shRNA were set to 1, and values represent fold change over NT shRNA-expressing cells. Average raw RLU values for the HIV-LTR WT NT control were 121,155 ± 1,270, those for the HIV-ΔNF-κBI,II LTR NT control were 306,691 ± 36168, those for the MLV-LTR NT control were 83,520 ± 10,650, and those for the MLV (HIV U3) LTR NT control were 131,173 ± 2,352. The average of Renilla control values was 2,180 ± 768.

    Techniques Used: Transfection, Infection, Expressing, Real-time Polymerase Chain Reaction, Stable Transfection, shRNA, Luciferase, Plasmid Preparation

    HIV transcription increases upon CYLD knockdown in immortalized and primary CD4 + T lymphocytes. (A) Efficiency of CYLD silencing. A3R5 T cell CYLD shRNA and NT shRNA were determined by Western blot analysis (upper panel) and quantified by densitometric analysis (lower panel). (B) A3R5 T cell CYLD shRNA and NT shRNA were infected with the indicated viruses. Clarified supernatants were collected every 2 days, and infectivity was determined by a TZM-bl infectivity assay. (C) Primary CD4 + T cells from two healthy donors were stimulated for 48 h with IL-2/PHA and transfected with CYLD siRNA and nontargeting siRNA (NT siRNA, control). At 48 h posttransfection, CD4 + T cells were infected with VSV-G-pseudotyped NL4.3/Env − HIV, and expression of HIV mRNA was measured at 24 h postinfection by qPCR. The HIV mRNA expression in NT siRNA is set at 1, and values represent fold induction over NT shRNA. Error bars represent standard deviations for duplicate qPCR analysis. Expression of HIV mRNA relative to the housekeeping gene rsp11 was 0.016 for donor 1 and 0.8 for donor 2. CYLD silencing efficiency was around 60% for both donors as determined by qPCR analysis.
    Figure Legend Snippet: HIV transcription increases upon CYLD knockdown in immortalized and primary CD4 + T lymphocytes. (A) Efficiency of CYLD silencing. A3R5 T cell CYLD shRNA and NT shRNA were determined by Western blot analysis (upper panel) and quantified by densitometric analysis (lower panel). (B) A3R5 T cell CYLD shRNA and NT shRNA were infected with the indicated viruses. Clarified supernatants were collected every 2 days, and infectivity was determined by a TZM-bl infectivity assay. (C) Primary CD4 + T cells from two healthy donors were stimulated for 48 h with IL-2/PHA and transfected with CYLD siRNA and nontargeting siRNA (NT siRNA, control). At 48 h posttransfection, CD4 + T cells were infected with VSV-G-pseudotyped NL4.3/Env − HIV, and expression of HIV mRNA was measured at 24 h postinfection by qPCR. The HIV mRNA expression in NT siRNA is set at 1, and values represent fold induction over NT shRNA. Error bars represent standard deviations for duplicate qPCR analysis. Expression of HIV mRNA relative to the housekeeping gene rsp11 was 0.016 for donor 1 and 0.8 for donor 2. CYLD silencing efficiency was around 60% for both donors as determined by qPCR analysis.

    Techniques Used: shRNA, Western Blot, Infection, Transfection, Expressing, Real-time Polymerase Chain Reaction

    16) Product Images from "Intestinal microbial dysbiosis aggravates the progression of Alzheimer’s disease in Drosophila"

    Article Title: Intestinal microbial dysbiosis aggravates the progression of Alzheimer’s disease in Drosophila

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00040-6

    Enteric dysbiosis aggravates neurodegeneration in a Drosophila Alzheimer’s disease (AD) model. a Histology analysis of degenerated brain tissues (brain section; 14 days postinfection, dpi; n = 10) and immunohistochemistry staining of apoptosis markers (whole brain; 10 dpi; n = 15). b , c Negative geotaxis assay of locomotion behavior ( n = 120 in each group) b and lifespan analysis ( n = 100 in each group) c . elav > Aβ42 transgenic or control ( elav alone) flies intestinally infected with or without Ecc15 . Error bars represent the SD. The definition of neurodegeneration index is shown in figure legend of Supplementary Fig. 1 . H E, haematoxylin and eosin. ** P
    Figure Legend Snippet: Enteric dysbiosis aggravates neurodegeneration in a Drosophila Alzheimer’s disease (AD) model. a Histology analysis of degenerated brain tissues (brain section; 14 days postinfection, dpi; n = 10) and immunohistochemistry staining of apoptosis markers (whole brain; 10 dpi; n = 15). b , c Negative geotaxis assay of locomotion behavior ( n = 120 in each group) b and lifespan analysis ( n = 100 in each group) c . elav > Aβ42 transgenic or control ( elav alone) flies intestinally infected with or without Ecc15 . Error bars represent the SD. The definition of neurodegeneration index is shown in figure legend of Supplementary Fig. 1 . H E, haematoxylin and eosin. ** P

    Techniques Used: Immunohistochemistry, Staining, Transgenic Assay, Infection

    17) Product Images from "Toxoplasma gondii AP2IX-4 Regulates Gene Expression during Bradyzoite Development"

    Article Title: Toxoplasma gondii AP2IX-4 Regulates Gene Expression during Bradyzoite Development

    Journal: mSphere

    doi: 10.1128/mSphere.00054-17

    Generation of PruQΔ ap2IX-4 parasites. (A) Schematic illustrating the generation of the AP2IX-4 knockout by allelic replacement with a DHFR*-TS minigene. (B) Genomic PCRs were performed with the indicated primers (A to G) to verify replacement of the AP2IX-4 genomic locus with the DHFR*-TS minigene. RT-PCR performed with primers B and E confirmed the absence of AP2IX-4 transcripts in PruQ Δap2IX-4 parasites. Primers for GAPDH were used as a positive control for the RNA preparation. (C) Representative doubling assay showing the number of parasites/vacuole at 24- and 36-h time points postinfection for parental PruQ versus PruQ Δap2IX-4 parasites. Three independent assays were performed with similar results. P > 0.05 (unpaired two-tailed Student’s t test). (D) Plaque assays were performed to compare the in vitro viability of PruQ parasites to that of PruQ Δap2IX-4 parasites. Three independent assays were performed with similar results. P = 0.98 (unpaired two-tailed Student’s t test).
    Figure Legend Snippet: Generation of PruQΔ ap2IX-4 parasites. (A) Schematic illustrating the generation of the AP2IX-4 knockout by allelic replacement with a DHFR*-TS minigene. (B) Genomic PCRs were performed with the indicated primers (A to G) to verify replacement of the AP2IX-4 genomic locus with the DHFR*-TS minigene. RT-PCR performed with primers B and E confirmed the absence of AP2IX-4 transcripts in PruQ Δap2IX-4 parasites. Primers for GAPDH were used as a positive control for the RNA preparation. (C) Representative doubling assay showing the number of parasites/vacuole at 24- and 36-h time points postinfection for parental PruQ versus PruQ Δap2IX-4 parasites. Three independent assays were performed with similar results. P > 0.05 (unpaired two-tailed Student’s t test). (D) Plaque assays were performed to compare the in vitro viability of PruQ parasites to that of PruQ Δap2IX-4 parasites. Three independent assays were performed with similar results. P = 0.98 (unpaired two-tailed Student’s t test).

    Techniques Used: Knock-Out, Reverse Transcription Polymerase Chain Reaction, Positive Control, Two Tailed Test, In Vitro

    18) Product Images from "Amino Acids 1055 to 1192 in the S2 Region of Severe Acute Respiratory Syndrome Coronavirus S Protein Induce Neutralizing Antibodies: Implications for the Development of Vaccines and Antiviral Agents"

    Article Title: Amino Acids 1055 to 1192 in the S2 Region of Severe Acute Respiratory Syndrome Coronavirus S Protein Induce Neutralizing Antibodies: Implications for the Development of Vaccines and Antiviral Agents

    Journal: Journal of Virology

    doi: 10.1128/JVI.79.6.3289-3296.2005

    (a) Immunoprecipitation of the S protein in cell lysate and medium of virus-infected Vero E6 cells. Vero E6 cells in 60-mm dishes were infected (lanes 2, 4, 6, 8, 10, and 12) with SARS-CoV at a MOI of 5 or mock infected (lanes 1, 3, 5, 7, 9, and 11). Cells were radiolabeled 5 h postinfection with [ 35 S]Met-Cys for 1 h. Cells were chased with medium containing 4 mM Met-Cys for 3 h. Cells (lanes 1, 2, 5, 6, 9, and 10) and media (lanes 3, 4, 7, 8, 11, and 12) were harvested with 1× or 1/5 volume of 5× lysis buffer, respectively. Samples were immunoprecipitated with antisera and preimmune serum as indicated and then separated in SDS-7.5% PAGE gels. The S-specific bands are indicated on the right. High-range Rainbow molecular weight markers (left; Amersham) were used. Rb, rabbit; α, anti. (b) Time-course of S protein maturation. Cos7 cells transfected with pKT-S were radiolabeled and chased for 0, 0.5, 1, 2, 4, and 6 h (lanes 1, 2, 3, 4, 5, 6, and 7). Cos7 cells transfected with a plasmid without an insert were harvested at 6 h as a negative control (lane 8). All the cell lysates were immunoprecipitated with rabbit anti-SΔ10 antibodies and then separated in SDS-7.5% PAGE gels. In a separate experiment, the immunoprecipitated proteins (6 h posttransfection) were treated (+) with EndoH (lane 10) or untreated (−) as a control (lane 9). The S-specific bands and their molecular masses (in kilodaltons) are indicated on the right. High-range Rainbow molecular weight markers (left; Amersham) were used.
    Figure Legend Snippet: (a) Immunoprecipitation of the S protein in cell lysate and medium of virus-infected Vero E6 cells. Vero E6 cells in 60-mm dishes were infected (lanes 2, 4, 6, 8, 10, and 12) with SARS-CoV at a MOI of 5 or mock infected (lanes 1, 3, 5, 7, 9, and 11). Cells were radiolabeled 5 h postinfection with [ 35 S]Met-Cys for 1 h. Cells were chased with medium containing 4 mM Met-Cys for 3 h. Cells (lanes 1, 2, 5, 6, 9, and 10) and media (lanes 3, 4, 7, 8, 11, and 12) were harvested with 1× or 1/5 volume of 5× lysis buffer, respectively. Samples were immunoprecipitated with antisera and preimmune serum as indicated and then separated in SDS-7.5% PAGE gels. The S-specific bands are indicated on the right. High-range Rainbow molecular weight markers (left; Amersham) were used. Rb, rabbit; α, anti. (b) Time-course of S protein maturation. Cos7 cells transfected with pKT-S were radiolabeled and chased for 0, 0.5, 1, 2, 4, and 6 h (lanes 1, 2, 3, 4, 5, 6, and 7). Cos7 cells transfected with a plasmid without an insert were harvested at 6 h as a negative control (lane 8). All the cell lysates were immunoprecipitated with rabbit anti-SΔ10 antibodies and then separated in SDS-7.5% PAGE gels. In a separate experiment, the immunoprecipitated proteins (6 h posttransfection) were treated (+) with EndoH (lane 10) or untreated (−) as a control (lane 9). The S-specific bands and their molecular masses (in kilodaltons) are indicated on the right. High-range Rainbow molecular weight markers (left; Amersham) were used.

    Techniques Used: Immunoprecipitation, Infection, Lysis, Polyacrylamide Gel Electrophoresis, Molecular Weight, Transfection, Plasmid Preparation, Negative Control

    19) Product Images from "Nuclear Factor 90 Negatively Regulates Influenza Virus Replication by Interacting with Viral Nucleoprotein ▿"

    Article Title: Nuclear Factor 90 Negatively Regulates Influenza Virus Replication by Interacting with Viral Nucleoprotein ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.00735-09

    Intracellular localization of NP and NF90 during influenza A virus infection. A549 cells were infected with VNM1194 at an MOI of 5. Infected cells were processed for microscopy at 4 and 10 h postinfection (h.p.i.). After fixation, the cells were stained
    Figure Legend Snippet: Intracellular localization of NP and NF90 during influenza A virus infection. A549 cells were infected with VNM1194 at an MOI of 5. Infected cells were processed for microscopy at 4 and 10 h postinfection (h.p.i.). After fixation, the cells were stained

    Techniques Used: Infection, Microscopy, Staining

    20) Product Images from "Vaccinia Virus Activation of CCR5 Invokes Tyrosine Phosphorylation Signaling Events That Support Virus Replication"

    Article Title: Vaccinia Virus Activation of CCR5 Invokes Tyrosine Phosphorylation Signaling Events That Support Virus Replication

    Journal: Journal of Virology

    doi: 10.1128/JVI.00463-06

    Introduction of CCR5 into NIH 3T3.CD4.neo cells renders cells permissive for vaccinia virus infection. CCR5 cDNA, CCR5.Y307F mutant cDNA, CCR5.Y339F mutant cDNA, or vector alone was introduced by transfection into NIH 3T3.CD4.neo cells. (a) Cell surface CCR5 or mutant CCR5 expression was determined by flow cytometry using anti-CCR5-specific antibodies that do not distinguish between intact or mutant CCR5 (gray solid line). Filled (negative) cytograms correspond to IgG reagents alone. (b) Cells were infected with VACV at an MOI of 10. Cells were fixed, and X-Gal staining was performed. (c) LacZ activity was measured 16 h postinfection by using a β-galactosidase colorimetric assay. Neg, negative. The means ± standard errors from quadruplicate assays are shown, representative of two independent experiments.
    Figure Legend Snippet: Introduction of CCR5 into NIH 3T3.CD4.neo cells renders cells permissive for vaccinia virus infection. CCR5 cDNA, CCR5.Y307F mutant cDNA, CCR5.Y339F mutant cDNA, or vector alone was introduced by transfection into NIH 3T3.CD4.neo cells. (a) Cell surface CCR5 or mutant CCR5 expression was determined by flow cytometry using anti-CCR5-specific antibodies that do not distinguish between intact or mutant CCR5 (gray solid line). Filled (negative) cytograms correspond to IgG reagents alone. (b) Cells were infected with VACV at an MOI of 10. Cells were fixed, and X-Gal staining was performed. (c) LacZ activity was measured 16 h postinfection by using a β-galactosidase colorimetric assay. Neg, negative. The means ± standard errors from quadruplicate assays are shown, representative of two independent experiments.

    Techniques Used: Infection, Mutagenesis, Plasmid Preparation, Transfection, Expressing, Flow Cytometry, Cytometry, Staining, Activity Assay, Colorimetric Assay

    Knockdown of CCR5 in NIH 3T3.CD4.CCR5 cells reduces vaccinia virus infection. (a) NIH 3T3.CD4.CCR5 cells were left untreated or transfected with either CCR5-specific siRNA or the control, scrambled siRNA. At 24 (gray solid line) and 48 (dotted line) h posttransfection, cell surface CCR5 expression was determined by flow cytometric analysis using anti-CCR5-specific antibodies. Filled (negative) cytograms correspond to IgG reagents alone. (b) NIH 3T3.CD4.CCR5 cells were either left untreated (i) or infected with VACV at an MOI of 1 (ii and iv) or 10 (iii). Twenty-four (i, ii, and iii) or 48 (iv) h postinfection, the monolayers were fixed and stained with X-Gal to determine LacZ expression. (c) NIH 3T3.CD4.CCR5 cells were transfected with either CCR5-specific siRNA (v) or the control, scrambled siRNA (vi). Forty-eight hours posttransfection, monolayer cultures were infected with VACV at an MOI of 10. Twenty-four hours postinfection, the monolayers were fixed and stained with X-Gal to determine LacZ expression. (d) The NIH 3T3.CD4.CCR5 infected cells shown in panel B were also analyzed for β-galactosidase activity of cell lysates by means of a colorimetric assay (see Materials and Methods). Black column, NIH 3T3.CD4.CCR5 cells infected with VACV; white column, NIH 3T3.CD4.CCR5 cells transfected with the control, scrambled siRNA, and then VACV infected; gray column, NIH 3T3.CD4.CCR5 cells transfected with CCR5-specific siRNA and then VACV infected; striped column, uninfected NIH 3T3.CD4.CCR5 cells. The means ± standard errors from quadruplicate assays, representative of two independent experiments, are shown.
    Figure Legend Snippet: Knockdown of CCR5 in NIH 3T3.CD4.CCR5 cells reduces vaccinia virus infection. (a) NIH 3T3.CD4.CCR5 cells were left untreated or transfected with either CCR5-specific siRNA or the control, scrambled siRNA. At 24 (gray solid line) and 48 (dotted line) h posttransfection, cell surface CCR5 expression was determined by flow cytometric analysis using anti-CCR5-specific antibodies. Filled (negative) cytograms correspond to IgG reagents alone. (b) NIH 3T3.CD4.CCR5 cells were either left untreated (i) or infected with VACV at an MOI of 1 (ii and iv) or 10 (iii). Twenty-four (i, ii, and iii) or 48 (iv) h postinfection, the monolayers were fixed and stained with X-Gal to determine LacZ expression. (c) NIH 3T3.CD4.CCR5 cells were transfected with either CCR5-specific siRNA (v) or the control, scrambled siRNA (vi). Forty-eight hours posttransfection, monolayer cultures were infected with VACV at an MOI of 10. Twenty-four hours postinfection, the monolayers were fixed and stained with X-Gal to determine LacZ expression. (d) The NIH 3T3.CD4.CCR5 infected cells shown in panel B were also analyzed for β-galactosidase activity of cell lysates by means of a colorimetric assay (see Materials and Methods). Black column, NIH 3T3.CD4.CCR5 cells infected with VACV; white column, NIH 3T3.CD4.CCR5 cells transfected with the control, scrambled siRNA, and then VACV infected; gray column, NIH 3T3.CD4.CCR5 cells transfected with CCR5-specific siRNA and then VACV infected; striped column, uninfected NIH 3T3.CD4.CCR5 cells. The means ± standard errors from quadruplicate assays, representative of two independent experiments, are shown.

    Techniques Used: Infection, Transfection, Expressing, Flow Cytometry, Staining, Activity Assay, Colorimetric Assay

    Pharmacological inhibition of vaccinia virus infection in PM1.CCR5 cells. PM1.CCR5 cells were either left untreated (U) or treated for 1 h with various doses of TAK 799 (a), pertussis toxin (b), or herbimycin A (c) or for 16 h with AG490 (e) prior to VACV adsorption. Cells were infected at an MOI of 10, and LacZ activity was measured 16 h postinfection by using a β-galactosidase colorimetric assay. (d) PM1.CCR5 cells were left untreated (U), infected with VACV at an MOI of 10 for 1 min, or treated with AG490 at 100 μM concentration for 16 h prior to infection with vaccinia at an MOI of 10 for 1 min. Cell lysates were immunoprecipitated with anti-Jak2 antibodies. Lysates were resolved by SDS-PAGE and immunoblotted (WB) with antiphosphotyrosine (4G10) antibodies. The blot was stripped and reprobed for Jak2. The data are representative of two independent experiments.
    Figure Legend Snippet: Pharmacological inhibition of vaccinia virus infection in PM1.CCR5 cells. PM1.CCR5 cells were either left untreated (U) or treated for 1 h with various doses of TAK 799 (a), pertussis toxin (b), or herbimycin A (c) or for 16 h with AG490 (e) prior to VACV adsorption. Cells were infected at an MOI of 10, and LacZ activity was measured 16 h postinfection by using a β-galactosidase colorimetric assay. (d) PM1.CCR5 cells were left untreated (U), infected with VACV at an MOI of 10 for 1 min, or treated with AG490 at 100 μM concentration for 16 h prior to infection with vaccinia at an MOI of 10 for 1 min. Cell lysates were immunoprecipitated with anti-Jak2 antibodies. Lysates were resolved by SDS-PAGE and immunoblotted (WB) with antiphosphotyrosine (4G10) antibodies. The blot was stripped and reprobed for Jak2. The data are representative of two independent experiments.

    Techniques Used: Inhibition, Infection, Adsorption, Activity Assay, Colorimetric Assay, Concentration Assay, Immunoprecipitation, SDS Page, Western Blot

    21) Product Images from "Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients"

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients

    Journal: Journal of Virology

    doi: 10.1128/JVI.02516-15

    Characterization of the LyE1E2-HCVcc lymphotropism. (A) Quantification of cell-associated viral RNA following Raji cell infection with HCVcc harboring the different E1E2 proteins (H77, L1a, and L3k) or no E1E2 (ΔE1E2). Four days postinfection,
    Figure Legend Snippet: Characterization of the LyE1E2-HCVcc lymphotropism. (A) Quantification of cell-associated viral RNA following Raji cell infection with HCVcc harboring the different E1E2 proteins (H77, L1a, and L3k) or no E1E2 (ΔE1E2). Four days postinfection,

    Techniques Used: Infection

    22) Product Images from "The Cellular Protein Daxx Interacts with Avian Sarcoma Virus Integrase and Viral DNA To Repress Viral Transcription"

    Article Title: The Cellular Protein Daxx Interacts with Avian Sarcoma Virus Integrase and Viral DNA To Repress Viral Transcription

    Journal: Journal of Virology

    doi: 10.1128/JVI.79.8.4610-4618.2005

    Daxx-mediated recruitment of HDAC1 and HDAC2 to ASV DNA. (A) Daxx-null or wild-type (+WT)-complemented cell lines were infected with ASVA-LTRNEO and subjected to ChIP analysis 24 h postinfection with indicated antibodies by using purified mouse IgG1 as antibody control. A representative blot is shown. (B) Quantitations from four ChIP experiments performed as described for panel A (with standard deviations [error bars]) are shown as the percentages of total DNA immunoprecipitated from infection of Daxx-null (open bars) or Daxx-complemented (filled bars) cells.
    Figure Legend Snippet: Daxx-mediated recruitment of HDAC1 and HDAC2 to ASV DNA. (A) Daxx-null or wild-type (+WT)-complemented cell lines were infected with ASVA-LTRNEO and subjected to ChIP analysis 24 h postinfection with indicated antibodies by using purified mouse IgG1 as antibody control. A representative blot is shown. (B) Quantitations from four ChIP experiments performed as described for panel A (with standard deviations [error bars]) are shown as the percentages of total DNA immunoprecipitated from infection of Daxx-null (open bars) or Daxx-complemented (filled bars) cells.

    Techniques Used: Infection, Chromatin Immunoprecipitation, Purification, Immunoprecipitation

    Association of Daxx with ASV IN and ASV DNA after infection. (A) IN was immunoprecipitated with rabbit α-IN antibody from ASVA-CMVEGFP-infected or mock-infected HeLa cell lysates 7 h postinfection. Coimmunoprecipitated Daxx was detected in two independent experiments (IP1 and IP2) by immunoblotting with rat α-Daxx antibody. The arrow indicates the expected position of Daxx. (B) IN was immunoprecipitated at the indicated times after infection with ASVA-CMVEGFP by using a murine α-IN antibody. Coimmunoprecipitated Daxx was detected by immunoblotting with rabbit α-Daxx antibody. For quantitation, the amount of Daxx in the total cell lysates pooled from all time points was measured on the same gel. Arrows indicate the expected molecular weights mass in kilodaltons of different forms of Daxx. Lines mark the positions of molecular mass standards in. kilodaltons. (C) Chromatin immunoprecipitation analysis after infection. HeLa (human) or DF-1 (avian) cells were cross-linked 6.5 h postinfection with ASVA-CMVEGFP. Lysates were treated with the indicated antibodies. Viral DNA was detected in the immunoprecipitant by nested PCR with pol nested primers. (D) ChIP analysis was performed on samples collected after indicated times postinfection with ASVA-CMVEGFP. Immunoprecipitated DNA was quantitated by Southern blotting with a labeled LTR fragment. The combined results from two experiments are shown (with standard deviations) as percentages of total DNA immunoprecipitated by rabbit α-IN antibody (triangles), rat α-Daxx antibody (diamonds), or purified rat IgG (circles) or percentages of total viral DNA in the lysates (squares). (E) HeLa cells were infected with an ASVA-LTRNEO vector containing wild-type IN or with IN that includes an inactivating substitution (D64E IN) and were then subjected to ChIP analysis 8 h postinfection. Immunoprecipitated viral DNA was quantitated by Southern blotting with a labeled LTR fragment. (F) Quantitation from four ChIP experiments after infection with a vector containing WT IN (filled bars) or D64E IN (open bars), expressed as percentages of total viral DNA in the lysate, with standard deviations (error bars).
    Figure Legend Snippet: Association of Daxx with ASV IN and ASV DNA after infection. (A) IN was immunoprecipitated with rabbit α-IN antibody from ASVA-CMVEGFP-infected or mock-infected HeLa cell lysates 7 h postinfection. Coimmunoprecipitated Daxx was detected in two independent experiments (IP1 and IP2) by immunoblotting with rat α-Daxx antibody. The arrow indicates the expected position of Daxx. (B) IN was immunoprecipitated at the indicated times after infection with ASVA-CMVEGFP by using a murine α-IN antibody. Coimmunoprecipitated Daxx was detected by immunoblotting with rabbit α-Daxx antibody. For quantitation, the amount of Daxx in the total cell lysates pooled from all time points was measured on the same gel. Arrows indicate the expected molecular weights mass in kilodaltons of different forms of Daxx. Lines mark the positions of molecular mass standards in. kilodaltons. (C) Chromatin immunoprecipitation analysis after infection. HeLa (human) or DF-1 (avian) cells were cross-linked 6.5 h postinfection with ASVA-CMVEGFP. Lysates were treated with the indicated antibodies. Viral DNA was detected in the immunoprecipitant by nested PCR with pol nested primers. (D) ChIP analysis was performed on samples collected after indicated times postinfection with ASVA-CMVEGFP. Immunoprecipitated DNA was quantitated by Southern blotting with a labeled LTR fragment. The combined results from two experiments are shown (with standard deviations) as percentages of total DNA immunoprecipitated by rabbit α-IN antibody (triangles), rat α-Daxx antibody (diamonds), or purified rat IgG (circles) or percentages of total viral DNA in the lysates (squares). (E) HeLa cells were infected with an ASVA-LTRNEO vector containing wild-type IN or with IN that includes an inactivating substitution (D64E IN) and were then subjected to ChIP analysis 8 h postinfection. Immunoprecipitated viral DNA was quantitated by Southern blotting with a labeled LTR fragment. (F) Quantitation from four ChIP experiments after infection with a vector containing WT IN (filled bars) or D64E IN (open bars), expressed as percentages of total viral DNA in the lysate, with standard deviations (error bars).

    Techniques Used: Infection, Immunoprecipitation, Quantitation Assay, Chromatin Immunoprecipitation, Nested PCR, Southern Blot, Labeling, Purification, Plasmid Preparation

    Daxx is not required for ASV integration. (A) Daxx-null and -complemented cells were infected with ASVA-CMVEGFP at an MOI of 0.1. Percentages of transduced cells (GFP positive) from three samples are shown with standard deviations (error bars). Filled bars and open bars represent the percentage of GFP-positive cells 48 h and 6 days, respectively, postinfection. (B) Daxx-null and -complemented cell lines were infected in the same way as described for panel A; DNA was isolated and subjected to B2 PCR using different amounts of input DNA as described in Materials and Methods. A representative Southern blot of PCR samples is shown. (C) Integration in Daxx cells lines. Percentages of integrated DNA detected by B2 PCR compared to those of the Daxx-null cells are shown with standard deviations (error bars). The control is mock infected. “No B2” refers to PCR performed without the B2 primer.
    Figure Legend Snippet: Daxx is not required for ASV integration. (A) Daxx-null and -complemented cells were infected with ASVA-CMVEGFP at an MOI of 0.1. Percentages of transduced cells (GFP positive) from three samples are shown with standard deviations (error bars). Filled bars and open bars represent the percentage of GFP-positive cells 48 h and 6 days, respectively, postinfection. (B) Daxx-null and -complemented cell lines were infected in the same way as described for panel A; DNA was isolated and subjected to B2 PCR using different amounts of input DNA as described in Materials and Methods. A representative Southern blot of PCR samples is shown. (C) Integration in Daxx cells lines. Percentages of integrated DNA detected by B2 PCR compared to those of the Daxx-null cells are shown with standard deviations (error bars). The control is mock infected. “No B2” refers to PCR performed without the B2 primer.

    Techniques Used: Infection, Isolation, Polymerase Chain Reaction, Southern Blot

    23) Product Images from "Virion-Associated Vpr Alleviates a Postintegration Block to HIV-1 Infection of Dendritic Cells"

    Article Title: Virion-Associated Vpr Alleviates a Postintegration Block to HIV-1 Infection of Dendritic Cells

    Journal: Journal of Virology

    doi: 10.1128/JVI.00051-17

    Vpr does not regulate Env expression in infected MDDCs or incorporation of Env into MDDC-derived virions. (A) Western blot analysis of mock-infected, Lai-YU2 (WT)-infected, or Lai-YU2/ΔVpr-infected MDDCs (MOI = 3) for p55 Gag and gp120 expression at day 6 postinfection. (B) Quantification of Western blots for p55 Gag and gp120 in infected MDDCs, as described above for panel A, from four independent experiments. The gp120 band intensity was quantified and normalized to the p55 Gag values from experiments with infected MDDCs derived from 4 donors. Data shown are means (± standard errors of the means). (C) Western blot analysis of p24 Gag and gp120 expression in mock-infected, Lai-YU2 (WT)-infected, or Lai-YU2/ΔVpr-infected MDDCs (MOI = 5). MDDC culture supernatants were harvested at days 3, 6, and 9 postinfection; pooled; and concentrated over a 20% sucrose cushion, and virus pellets were lysed for Western blot analysis. (D) Quantification of data from Western blot analysis of MDDC-derived virions from three independent donors. The band intensity for gp120 was quantified and normalized to the p24 Gag band intensity. Data shown are means ± (standard errors of the means). Significance was calculated by using a one-sample t test (N.S., not significant [ P > 0.05]).
    Figure Legend Snippet: Vpr does not regulate Env expression in infected MDDCs or incorporation of Env into MDDC-derived virions. (A) Western blot analysis of mock-infected, Lai-YU2 (WT)-infected, or Lai-YU2/ΔVpr-infected MDDCs (MOI = 3) for p55 Gag and gp120 expression at day 6 postinfection. (B) Quantification of Western blots for p55 Gag and gp120 in infected MDDCs, as described above for panel A, from four independent experiments. The gp120 band intensity was quantified and normalized to the p55 Gag values from experiments with infected MDDCs derived from 4 donors. Data shown are means (± standard errors of the means). (C) Western blot analysis of p24 Gag and gp120 expression in mock-infected, Lai-YU2 (WT)-infected, or Lai-YU2/ΔVpr-infected MDDCs (MOI = 5). MDDC culture supernatants were harvested at days 3, 6, and 9 postinfection; pooled; and concentrated over a 20% sucrose cushion, and virus pellets were lysed for Western blot analysis. (D) Quantification of data from Western blot analysis of MDDC-derived virions from three independent donors. The band intensity for gp120 was quantified and normalized to the p24 Gag band intensity. Data shown are means ± (standard errors of the means). Significance was calculated by using a one-sample t test (N.S., not significant [ P > 0.05]).

    Techniques Used: Expressing, Infection, Derivative Assay, Western Blot

    Vpr deficiency does not result in enhanced type I IFN production in productively infected MDDCs. (A and B) qRT-PCR for IFN-β (A) and IP-10 (B) transcript levels in infected MDDCs at 48 h postinfection. MDDCs were mock infected or infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 2) in the presence or absence of AZT (10 μM). The amount of IFN-β or IP-10 transcripts in infected MDDCs was normalized to the number of cells by using a GAPDH control and is reported relative to that in mock-infected MDDCs (set at a value of 1) from four independent donors. LPS treatment for 4 h was used as a positive control for IFN-β and IP-10 production. Data are the log-transformed means (±standard errors of the means) of results for seven donors. (C) The secreted level of IP-10 in MDDC culture supernatants infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1) at day 3 postinfection was measured by an ELISA. The data shown are the log-transformed means (± standard errors of the means) of results from independent experiments with MDDCs derived from four donors for panels A and B and from six donors for panel C. Significance was calculated by using paired Student's t test or a one-value t test (comparing normalized data) (NS, not significant [ P > 0.05]; *, P
    Figure Legend Snippet: Vpr deficiency does not result in enhanced type I IFN production in productively infected MDDCs. (A and B) qRT-PCR for IFN-β (A) and IP-10 (B) transcript levels in infected MDDCs at 48 h postinfection. MDDCs were mock infected or infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 2) in the presence or absence of AZT (10 μM). The amount of IFN-β or IP-10 transcripts in infected MDDCs was normalized to the number of cells by using a GAPDH control and is reported relative to that in mock-infected MDDCs (set at a value of 1) from four independent donors. LPS treatment for 4 h was used as a positive control for IFN-β and IP-10 production. Data are the log-transformed means (±standard errors of the means) of results for seven donors. (C) The secreted level of IP-10 in MDDC culture supernatants infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1) at day 3 postinfection was measured by an ELISA. The data shown are the log-transformed means (± standard errors of the means) of results from independent experiments with MDDCs derived from four donors for panels A and B and from six donors for panel C. Significance was calculated by using paired Student's t test or a one-value t test (comparing normalized data) (NS, not significant [ P > 0.05]; *, P

    Techniques Used: Infection, Quantitative RT-PCR, Positive Control, Transformation Assay, Enzyme-linked Immunosorbent Assay, Derivative Assay

    Vpr mutants deficient for interaction with the DCAF1/DDB1/E3 ubiquitin ligase and inducing G 2 cell cycle arrest are attenuated in a single cycle of replication in MDDCs. (A) Representative Western blot analysis of HEK293T-derived Lai-YU2 (WT) and the indicated Vpr mutant viruses used for MDDC infections. Blots were probed with anti-p24 Gag , anti-Vpr, and anti-gp120 antibodies. (B) Infectivity of Lai-YU2 and the corresponding Vpr mutants in TZM-bl cells, reported as the number of infectious units (blue cells) per nanogram of p24 Gag equivalent, and results are the means (± standard errors of the means) of data from three independent viral preparations. (C) Viral growth curves for four independent infections of MDDCs with Lai-YU2 and the indicated Vpr mutants in DCs. Viral growth was determined by analyzing p24 Gag release into cell culture supernatants at days 3, 6, 9, and 12 postinfection by an ELISA. (D) Areas under the curve compiled for four independent MDDC infections represented in panel C, normalized to the value for WT virus infection, which was set to 1 (means ± standard errors of the means). (E) Percentage of p24 Gag -positive MDDCs at day 3 postinfection as measured by intracellular p24 Gag staining and FACS analysis. Cells were treated with indinavir (1 μM) post-virus exposure to prevent viral spread. The data were normalized to the value for WT virus infection, which was set to 1, and depict the means (± standard errors of the means) of results from three independent infections of MDDCs from three donors. (F) MDDCs infected with 40 ng p24 Gag equivalents of Lai-luc Δenv/G (WT or Vpr mutants) were lysed at 3 days postinfection, and viral replication was quantified by measuring luciferase activity in cell lysates. The luciferase activity in Vpr mutant infections was normalized to that of WT virus infections, which was set to 1, and the data shown are the means (± standard errors of the means) for three independent experiments. (G) Western blot analysis of HEK293T-derived Lai-GFP Δenv/G (WT) virus particles or the indicated Vpr mutant virus particles. (H) MDDCs infected with Lai-GFP Δenv/G (WT) or the indicated Vpr mutants (MOI = 3) were harvested at day 3 postinfection and processed for FACS analysis. The data shown are the mean percentages of GFP-positive cells (± standard errors of the means) from five independent experiments with cells derived from five independent donors. Significance was calculated by using paired Student's t test or a one-value t test (comparing normalized data) (*, P
    Figure Legend Snippet: Vpr mutants deficient for interaction with the DCAF1/DDB1/E3 ubiquitin ligase and inducing G 2 cell cycle arrest are attenuated in a single cycle of replication in MDDCs. (A) Representative Western blot analysis of HEK293T-derived Lai-YU2 (WT) and the indicated Vpr mutant viruses used for MDDC infections. Blots were probed with anti-p24 Gag , anti-Vpr, and anti-gp120 antibodies. (B) Infectivity of Lai-YU2 and the corresponding Vpr mutants in TZM-bl cells, reported as the number of infectious units (blue cells) per nanogram of p24 Gag equivalent, and results are the means (± standard errors of the means) of data from three independent viral preparations. (C) Viral growth curves for four independent infections of MDDCs with Lai-YU2 and the indicated Vpr mutants in DCs. Viral growth was determined by analyzing p24 Gag release into cell culture supernatants at days 3, 6, 9, and 12 postinfection by an ELISA. (D) Areas under the curve compiled for four independent MDDC infections represented in panel C, normalized to the value for WT virus infection, which was set to 1 (means ± standard errors of the means). (E) Percentage of p24 Gag -positive MDDCs at day 3 postinfection as measured by intracellular p24 Gag staining and FACS analysis. Cells were treated with indinavir (1 μM) post-virus exposure to prevent viral spread. The data were normalized to the value for WT virus infection, which was set to 1, and depict the means (± standard errors of the means) of results from three independent infections of MDDCs from three donors. (F) MDDCs infected with 40 ng p24 Gag equivalents of Lai-luc Δenv/G (WT or Vpr mutants) were lysed at 3 days postinfection, and viral replication was quantified by measuring luciferase activity in cell lysates. The luciferase activity in Vpr mutant infections was normalized to that of WT virus infections, which was set to 1, and the data shown are the means (± standard errors of the means) for three independent experiments. (G) Western blot analysis of HEK293T-derived Lai-GFP Δenv/G (WT) virus particles or the indicated Vpr mutant virus particles. (H) MDDCs infected with Lai-GFP Δenv/G (WT) or the indicated Vpr mutants (MOI = 3) were harvested at day 3 postinfection and processed for FACS analysis. The data shown are the mean percentages of GFP-positive cells (± standard errors of the means) from five independent experiments with cells derived from five independent donors. Significance was calculated by using paired Student's t test or a one-value t test (comparing normalized data) (*, P

    Techniques Used: Western Blot, Derivative Assay, Mutagenesis, Infection, Cell Culture, Enzyme-linked Immunosorbent Assay, Staining, FACS, Luciferase, Activity Assay

    Infection of MDDCs with Vpr-deficient viruses results in a block to HIV-1 replication in single-round-infection analyses. (A) MDDCs infected with 40 ng p24 Gag equivalents of VSV-G-pseudotyped Lai-luc Δenv (WT or ΔVpr) were lysed at 3 days postinfection, and viral replication was quantified by measuring luciferase activity in cell lysates. The luciferase activity in ΔVpr-infected cell lysates was normalized to that of WT virus-infected MDDC lysates and is reported as the mean (± standard error of the mean) of data from four independent experiments with MDDCs derived from four independent donors. (B) Western blot analysis of Vpr incorporation into virus particles (Lai-luc Δenv/G, Lai-luc Δenv/G ΔVpr, or Lai-luc Δenv/G Vpr- trans ) derived from transient transfection of HEK293T cells. (C) MDDCs were infected with 40 ng p24 Gag equivalents of viruses (Lai-luc Δenv, Lai-luc Δenv ΔVpr, or Lai-luc Δenv ΔVpr plus HA-Vpr) and lysed at 3 days postinfection. Cell lysates were analyzed for luciferase activity, and the data shown are normalized to values for WT virus infection and are means (±standard errors of the means) from 4 independent experiments. Significance was calculated by using paired Student's t test or a one-value t test (comparing normalized data) (**, P
    Figure Legend Snippet: Infection of MDDCs with Vpr-deficient viruses results in a block to HIV-1 replication in single-round-infection analyses. (A) MDDCs infected with 40 ng p24 Gag equivalents of VSV-G-pseudotyped Lai-luc Δenv (WT or ΔVpr) were lysed at 3 days postinfection, and viral replication was quantified by measuring luciferase activity in cell lysates. The luciferase activity in ΔVpr-infected cell lysates was normalized to that of WT virus-infected MDDC lysates and is reported as the mean (± standard error of the mean) of data from four independent experiments with MDDCs derived from four independent donors. (B) Western blot analysis of Vpr incorporation into virus particles (Lai-luc Δenv/G, Lai-luc Δenv/G ΔVpr, or Lai-luc Δenv/G Vpr- trans ) derived from transient transfection of HEK293T cells. (C) MDDCs were infected with 40 ng p24 Gag equivalents of viruses (Lai-luc Δenv, Lai-luc Δenv ΔVpr, or Lai-luc Δenv ΔVpr plus HA-Vpr) and lysed at 3 days postinfection. Cell lysates were analyzed for luciferase activity, and the data shown are normalized to values for WT virus infection and are means (±standard errors of the means) from 4 independent experiments. Significance was calculated by using paired Student's t test or a one-value t test (comparing normalized data) (**, P

    Techniques Used: Infection, Blocking Assay, Luciferase, Activity Assay, Derivative Assay, Western Blot, Transfection

    Infection with Vpr-deficient HIV-1 results in attenuated virus replication in MDDCs and MDDC-T cell cocultures. (A) FACS profiles of mock-infected MDDCs or MDDCs infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1) at day 3 postinfection. Cells were stained for CD11c, DC-SIGN, and p24 Gag . From left to right, the plots shown depict the gating strategy for the flow cytometry analysis and include plots of forward scatter (FSC)/side scatter (SSC) to exclude cellular debris, anti-CD11c/anti-DCSIGN staining to identify the MDDC population, and DC-SIGN/p24 Gag staining to identify productively infected MDDCs in mock-infected or WT (Lai-YU2)- and ΔVpr-infected DCs. (B) Mean percentages (± standard errors of the means) of DC-SIGN + intracellular p24 Gag -positive MDDCs determined from infections of cells derived from three donors as described above for panel A. (C) Replication kinetics of Lai-YU2 and Lai-YU2/ΔVpr in MDDCs infected at an MOI of 1. MDDC supernatants were harvested every 3 days and analyzed for p24 Gag content by an ELISA. Data shown are the means (± standard errors of the means) for three independent experiments with MDDCs derived from three independent donors. (D) Schematic of the DC-T cell coculture setup. MDDCs were infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1). At 2 days postinfection, autologous CD4 + T cells (PHA/IL-2 treated) were added at a 2:1 ratio to MDDCs or infected with cell-free virus in parallel (MOI = 1). Supernatants were harvested on day 6 and day 9 postinfection (day 3 or 6 for cell-free CD4 + T cell infection), and the p24 Gag content in the culture supernatants was determined by an ELISA. (E) Kinetics of p24 Gag production in cell culture supernatants from a representative infection of MDDCs only, CD4 + T cells only, or MDDC-CD4 + T cell cocultures. (F) Mean p24 Gag contents (± standard errors of the means) present in the supernatants from infections of CD4 + T cells only or MDDC-CD4 + T cell cocultures at day 6 postinfection (day 3 postinfection for cell-free CD4 + T cell infections). Data are representative of infections of five independent donors. Significance was calculated by using paired Student's t tests (*, P
    Figure Legend Snippet: Infection with Vpr-deficient HIV-1 results in attenuated virus replication in MDDCs and MDDC-T cell cocultures. (A) FACS profiles of mock-infected MDDCs or MDDCs infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1) at day 3 postinfection. Cells were stained for CD11c, DC-SIGN, and p24 Gag . From left to right, the plots shown depict the gating strategy for the flow cytometry analysis and include plots of forward scatter (FSC)/side scatter (SSC) to exclude cellular debris, anti-CD11c/anti-DCSIGN staining to identify the MDDC population, and DC-SIGN/p24 Gag staining to identify productively infected MDDCs in mock-infected or WT (Lai-YU2)- and ΔVpr-infected DCs. (B) Mean percentages (± standard errors of the means) of DC-SIGN + intracellular p24 Gag -positive MDDCs determined from infections of cells derived from three donors as described above for panel A. (C) Replication kinetics of Lai-YU2 and Lai-YU2/ΔVpr in MDDCs infected at an MOI of 1. MDDC supernatants were harvested every 3 days and analyzed for p24 Gag content by an ELISA. Data shown are the means (± standard errors of the means) for three independent experiments with MDDCs derived from three independent donors. (D) Schematic of the DC-T cell coculture setup. MDDCs were infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1). At 2 days postinfection, autologous CD4 + T cells (PHA/IL-2 treated) were added at a 2:1 ratio to MDDCs or infected with cell-free virus in parallel (MOI = 1). Supernatants were harvested on day 6 and day 9 postinfection (day 3 or 6 for cell-free CD4 + T cell infection), and the p24 Gag content in the culture supernatants was determined by an ELISA. (E) Kinetics of p24 Gag production in cell culture supernatants from a representative infection of MDDCs only, CD4 + T cells only, or MDDC-CD4 + T cell cocultures. (F) Mean p24 Gag contents (± standard errors of the means) present in the supernatants from infections of CD4 + T cells only or MDDC-CD4 + T cell cocultures at day 6 postinfection (day 3 postinfection for cell-free CD4 + T cell infections). Data are representative of infections of five independent donors. Significance was calculated by using paired Student's t tests (*, P

    Techniques Used: Infection, FACS, Staining, Flow Cytometry, Cytometry, Derivative Assay, Enzyme-linked Immunosorbent Assay, Cell Culture

    Viral transcription is attenuated in ΔVpr virus-infected MDDCs. (A to C) MDDCs infected with WT or ΔVpr viruses (MOI = 2) in the presence or absence of AZT (10 μM) were lysed at 72 h postinfection and processed for DNA isolation. Note that infected cells were cultured in the presence of indinavir (1 μM) to prevent viral spread. qPCR was used to detect early RT products (A) and integrated proviruses (B) by using the R-U5 and Alu-PCR primer sets, and the number of integrated proviruses was normalized to early RT products for each infection (C). The data reported are the means (± standard errors of the means) of results from three independent experiments. (D) The number of multiply spliced viral transcripts ( tat-rev-nef ) in MDDCs infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1) was determined at 48 h postinfection by qRT-PCR. Viral transcripts were measured by using primers specific for tat-rev-nef multiply spliced transcripts. Data shown are means (± standard errors of the means) of results from four independent experiments with MDDCs derived from four donors. (E) Quantification of the 4-kb class of splice variants for MDDCs infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 2) for 72 h. The data were normalized, log 10 transformed, and then graphed according to slice acceptor usage. (E to G) Histograms show fold changes in splicing from D1 to each of the 5 viral splice acceptor sites A1 through A5 relative to a WT control. Splicing was quantified by using a Primer ID splicing assay for MDDCs from two independent infections (E) and productively infected CD4 + T cells (F) and HeLa cells (G), and data are from a single deep-sequencing experiment. Significance was calculated by using unpaired Student's t test (*, P
    Figure Legend Snippet: Viral transcription is attenuated in ΔVpr virus-infected MDDCs. (A to C) MDDCs infected with WT or ΔVpr viruses (MOI = 2) in the presence or absence of AZT (10 μM) were lysed at 72 h postinfection and processed for DNA isolation. Note that infected cells were cultured in the presence of indinavir (1 μM) to prevent viral spread. qPCR was used to detect early RT products (A) and integrated proviruses (B) by using the R-U5 and Alu-PCR primer sets, and the number of integrated proviruses was normalized to early RT products for each infection (C). The data reported are the means (± standard errors of the means) of results from three independent experiments. (D) The number of multiply spliced viral transcripts ( tat-rev-nef ) in MDDCs infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 1) was determined at 48 h postinfection by qRT-PCR. Viral transcripts were measured by using primers specific for tat-rev-nef multiply spliced transcripts. Data shown are means (± standard errors of the means) of results from four independent experiments with MDDCs derived from four donors. (E) Quantification of the 4-kb class of splice variants for MDDCs infected with Lai-YU2 or Lai-YU2/ΔVpr (MOI = 2) for 72 h. The data were normalized, log 10 transformed, and then graphed according to slice acceptor usage. (E to G) Histograms show fold changes in splicing from D1 to each of the 5 viral splice acceptor sites A1 through A5 relative to a WT control. Splicing was quantified by using a Primer ID splicing assay for MDDCs from two independent infections (E) and productively infected CD4 + T cells (F) and HeLa cells (G), and data are from a single deep-sequencing experiment. Significance was calculated by using unpaired Student's t test (*, P

    Techniques Used: Infection, DNA Extraction, Cell Culture, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Quantitative RT-PCR, Derivative Assay, Transformation Assay, Splicing Assay, Sequencing

    24) Product Images from "The impact of α-toxin on host cell plasma membrane permeability and cytokine expression during human blood infection by CA-MRSA USA300"

    Article Title: The impact of α-toxin on host cell plasma membrane permeability and cytokine expression during human blood infection by CA-MRSA USA300

    Journal: Journal of Leukocyte Biology

    doi: 10.1189/jlb.0213080

    The influence of Hla on cytokine expression following infection of human blood with USA300. (A) Concentrations of IL-1β and IL-8, as determined by ELISA at 5 h postinfection of human blood with 1 × 10 5 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), DPBS control, or USA300 incubated at ≥98°C for 20 min prior to infection (Heat tx). (B) CBA analysis of IL-6, IL-10, TNF-α, IFN-γ, IL-17A, IL-12p70, IL-2, and IL-4 expression in human blood at 5 h postinfection with 1 × 10 5 CFU/mL USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent at least four separate experiments using at least three different blood donors, with * P ≤ 0.05, ** P ≤ 0.01, and *** P ≤ 0.001, as determined by one-way repeated-measures ANOVA with Tukey's post-test relative to samples infected with USA300.
    Figure Legend Snippet: The influence of Hla on cytokine expression following infection of human blood with USA300. (A) Concentrations of IL-1β and IL-8, as determined by ELISA at 5 h postinfection of human blood with 1 × 10 5 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), DPBS control, or USA300 incubated at ≥98°C for 20 min prior to infection (Heat tx). (B) CBA analysis of IL-6, IL-10, TNF-α, IFN-γ, IL-17A, IL-12p70, IL-2, and IL-4 expression in human blood at 5 h postinfection with 1 × 10 5 CFU/mL USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent at least four separate experiments using at least three different blood donors, with * P ≤ 0.05, ** P ≤ 0.01, and *** P ≤ 0.001, as determined by one-way repeated-measures ANOVA with Tukey's post-test relative to samples infected with USA300.

    Techniques Used: Expressing, Infection, Enzyme-linked Immunosorbent Assay, Incubation, Crocin Bleaching Assay

    Flow cytometry analysis of PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood with USA300, USA300Δhla, USA300Δhla Comp, or DPBS control. (A) Representative flow cytometry histograms for PI-stained human PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection with USA300 (dark, solid lines) relative to the uninfected DPBS control (shaded gray areas) at 3 h postinfection with 1 × 10 6 CFU/mL human blood. (B) Geometric mean PI + signal of PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection of human blood with 1 × 10 6 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), or uninfected DPBS control. Data represent four separate experiments using at least three different blood donors, with * P ≤ 0.05, as determined by paired two-tailed t -test relative to samples infected with USA300.
    Figure Legend Snippet: Flow cytometry analysis of PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood with USA300, USA300Δhla, USA300Δhla Comp, or DPBS control. (A) Representative flow cytometry histograms for PI-stained human PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection with USA300 (dark, solid lines) relative to the uninfected DPBS control (shaded gray areas) at 3 h postinfection with 1 × 10 6 CFU/mL human blood. (B) Geometric mean PI + signal of PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection of human blood with 1 × 10 6 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), or uninfected DPBS control. Data represent four separate experiments using at least three different blood donors, with * P ≤ 0.05, as determined by paired two-tailed t -test relative to samples infected with USA300.

    Techniques Used: Flow Cytometry, Cytometry, Infection, Staining, Two Tailed Test

    The association of USA300 with PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood. (A) Representative flow cytometry histograms of PMNs, CD3 + lymphocyte, and CD14 + monocyte cells at 3 h postinfection with FITC-labeled USA300 (solid lines) relative to a DPBS control (shaded areas), with the percentage of FITC + human cells indicated. (B) Compiled results illustrating the percentage of FITC + PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection with 1 × 10 6 CFU/mL FITC-labeled USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent five separate experiments using at least three different blood donors, with ** P ≤ 0.01, and *** P ≤ 0.001, as determined by paired two-tailed t -test relative to samples infected with USA300.
    Figure Legend Snippet: The association of USA300 with PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood. (A) Representative flow cytometry histograms of PMNs, CD3 + lymphocyte, and CD14 + monocyte cells at 3 h postinfection with FITC-labeled USA300 (solid lines) relative to a DPBS control (shaded areas), with the percentage of FITC + human cells indicated. (B) Compiled results illustrating the percentage of FITC + PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection with 1 × 10 6 CFU/mL FITC-labeled USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent five separate experiments using at least three different blood donors, with ** P ≤ 0.01, and *** P ≤ 0.001, as determined by paired two-tailed t -test relative to samples infected with USA300.

    Techniques Used: Infection, Flow Cytometry, Cytometry, Labeling, Two Tailed Test

    Hla expression modulates proinflammatory cytokine transcript abundance during USA300 infection of human blood. Cytokine transcription profiles at 3 h postinfection of human blood with 1 × 10 5 CFU/mL USA300 or USA300Δ hla relative to DPBS mock-infected blood. Only genes that exhibited at least a twofold change in transcript abundance and a P value
    Figure Legend Snippet: Hla expression modulates proinflammatory cytokine transcript abundance during USA300 infection of human blood. Cytokine transcription profiles at 3 h postinfection of human blood with 1 × 10 5 CFU/mL USA300 or USA300Δ hla relative to DPBS mock-infected blood. Only genes that exhibited at least a twofold change in transcript abundance and a P value

    Techniques Used: Expressing, Infection

    25) Product Images from "Generation of Bovine Respiratory Syncytial Virus (BRSV) from cDNA: BRSV NS2 Is Not Essential for Virus Replication in Tissue Culture, and the Human RSV Leader Region Acts as a Functional BRSV Genome Promoter"

    Article Title: Generation of Bovine Respiratory Syncytial Virus (BRSV) from cDNA: BRSV NS2 Is Not Essential for Virus Replication in Tissue Culture, and the Human RSV Leader Region Acts as a Functional BRSV Genome Promoter

    Journal: Journal of Virology

    doi:

    CPE of recombinant BRSVs in BSR T7/5 cells (A) and MDBK cells (B). (A) In BSR T7/5 cultures, all recombinants induced syncytia of cells detaching from the monolayer, which were indistinguishable from those of standard ATue51908, at 56 h postinfection at an MOI of 0.01. (B) In MDBK cells, both full-length recombinant viruses rBRSV and rH/BRSV and standard ATue51908 virus produced similar foci of enlarged cells at 5 days postinfection, whereas the NS2 deletion mutants produced only small foci of degenerating cells.
    Figure Legend Snippet: CPE of recombinant BRSVs in BSR T7/5 cells (A) and MDBK cells (B). (A) In BSR T7/5 cultures, all recombinants induced syncytia of cells detaching from the monolayer, which were indistinguishable from those of standard ATue51908, at 56 h postinfection at an MOI of 0.01. (B) In MDBK cells, both full-length recombinant viruses rBRSV and rH/BRSV and standard ATue51908 virus produced similar foci of enlarged cells at 5 days postinfection, whereas the NS2 deletion mutants produced only small foci of degenerating cells.

    Techniques Used: Recombinant, Produced

    26) Product Images from "Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development"

    Article Title: Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01879-18

    EC 50 and CC 50 determination of compound 7, compound 135, and compound 201. (A) EC 50 determination. CD36 + EPCs were infected with B19V. Each compound was added at different concentrations, as shown. At 2 days postinfection, the cells were collected for flow cytometry to detect the capsid-expressing cells. DMSO was used as a vehicle control. The final EC 50 was calculated with GraphPad Prism software. (B) CC 50 determination. EPCs in 96-well plates were treated with each compound at various concentrations, as shown. At 2 days postinfection, the percentages of viable cells were determined, and the CC 50 was calculated using GraphPad Prism software.
    Figure Legend Snippet: EC 50 and CC 50 determination of compound 7, compound 135, and compound 201. (A) EC 50 determination. CD36 + EPCs were infected with B19V. Each compound was added at different concentrations, as shown. At 2 days postinfection, the cells were collected for flow cytometry to detect the capsid-expressing cells. DMSO was used as a vehicle control. The final EC 50 was calculated with GraphPad Prism software. (B) CC 50 determination. EPCs in 96-well plates were treated with each compound at various concentrations, as shown. At 2 days postinfection, the percentages of viable cells were determined, and the CC 50 was calculated using GraphPad Prism software.

    Techniques Used: Infection, Flow Cytometry, Cytometry, Expressing, Software

    Compounds 7, 135, and 201 inhibit B19V replication in CD36 + EPCs. CD36 + EPCs were infected with B19V, followed by addition of each compound, compound 7 (A), compound 135 (B), and compound 201 (C), at various concentrations, as shown. At 2 days postinfection, Hirt DNA samples were prepared from infected cells and were subjected to Southern blotting using the M20 probe. DMSO was used as a vehicle control. CD36 + ). *, monomer replicative-form DNA; **, ssDNA, single-stranded DNA.
    Figure Legend Snippet: Compounds 7, 135, and 201 inhibit B19V replication in CD36 + EPCs. CD36 + EPCs were infected with B19V, followed by addition of each compound, compound 7 (A), compound 135 (B), and compound 201 (C), at various concentrations, as shown. At 2 days postinfection, Hirt DNA samples were prepared from infected cells and were subjected to Southern blotting using the M20 probe. DMSO was used as a vehicle control. CD36 + ). *, monomer replicative-form DNA; **, ssDNA, single-stranded DNA.

    Techniques Used: Infection, Southern Blot

    Compounds 7, 135, and 201 inhibit B19V DNA replication in CD36 + EPCs at 18 h, 30 h, and 48 h postinfection. CD36 + EPCs were infected with B19V, followed by addition of compound 7 (A), compound 135 (B), and compound 201 (C) at various concentrations, as shown. At 18 h, 30 h, and 48 h postinfection, total DNA was extracted from each sample and subjected to multiplex qPCR for detection of viral DNA and cellular (mt) DNA. DMSO was used as a vehicle control. The ratios of B19V DNA/mt DNA were calculated and are shown in relation to the ratio for the vehicle control (which is set equal to 1). EC 50 was calculated using GraphPad Prism software.
    Figure Legend Snippet: Compounds 7, 135, and 201 inhibit B19V DNA replication in CD36 + EPCs at 18 h, 30 h, and 48 h postinfection. CD36 + EPCs were infected with B19V, followed by addition of compound 7 (A), compound 135 (B), and compound 201 (C) at various concentrations, as shown. At 18 h, 30 h, and 48 h postinfection, total DNA was extracted from each sample and subjected to multiplex qPCR for detection of viral DNA and cellular (mt) DNA. DMSO was used as a vehicle control. The ratios of B19V DNA/mt DNA were calculated and are shown in relation to the ratio for the vehicle control (which is set equal to 1). EC 50 was calculated using GraphPad Prism software.

    Techniques Used: Infection, Multiplex Assay, Real-time Polymerase Chain Reaction, Software

    27) Product Images from "A Cell-Based Strategy To Assess Intrinsic Inhibition Efficiencies of HIV-1 Reverse Transcriptase Inhibitors"

    Article Title: A Cell-Based Strategy To Assess Intrinsic Inhibition Efficiencies of HIV-1 Reverse Transcriptase Inhibitors

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.04163-14

    Kinetics of reverse transcription during a single cycle of infection. MT-2 cells were pretreated (−24 h) with 10-fold-adjusted (10×) EC 50 levels of TFV (▽), FTC (□), or EFV (○) prior to infection, along with a no-drug control (⧫). At indicated time points postinfection, cells were lysed, and vDNA product copy numbers quantified in replicate by qPCR were expressed as a percentage of the response in the no-drug control-treated cells measured at 10 h postinfection and set to 100%. The impact of RT inhibitors was assessed for early reverse transcription of short vDNA products by monitoring for minus-strand strong stop (RU5) (A) and late reverse transcription of long vDNA products by monitoring for second-strand transfer (PBS) (B). Data represent the means ± standard errors of the means of two independent experiments.
    Figure Legend Snippet: Kinetics of reverse transcription during a single cycle of infection. MT-2 cells were pretreated (−24 h) with 10-fold-adjusted (10×) EC 50 levels of TFV (▽), FTC (□), or EFV (○) prior to infection, along with a no-drug control (⧫). At indicated time points postinfection, cells were lysed, and vDNA product copy numbers quantified in replicate by qPCR were expressed as a percentage of the response in the no-drug control-treated cells measured at 10 h postinfection and set to 100%. The impact of RT inhibitors was assessed for early reverse transcription of short vDNA products by monitoring for minus-strand strong stop (RU5) (A) and late reverse transcription of long vDNA products by monitoring for second-strand transfer (PBS) (B). Data represent the means ± standard errors of the means of two independent experiments.

    Techniques Used: Infection, Real-time Polymerase Chain Reaction

    28) Product Images from "Deletion of gpUL132, a Structural Component of Human Cytomegalovirus, Results in Impaired Virus Replication in Fibroblasts"

    Article Title: Deletion of gpUL132, a Structural Component of Human Cytomegalovirus, Results in Impaired Virus Replication in Fibroblasts

    Journal:

    doi: 10.1128/JVI.79.18.11837-11847.2005

    Replication of UL132 mutant viruses. (A) Fibroblasts were seeded in six-well dishes and infected with the indicated virus strains (multiplicity of infection, 0.1). At the indicated days postinfection, supernatants from the infected cultures were harvested
    Figure Legend Snippet: Replication of UL132 mutant viruses. (A) Fibroblasts were seeded in six-well dishes and infected with the indicated virus strains (multiplicity of infection, 0.1). At the indicated days postinfection, supernatants from the infected cultures were harvested

    Techniques Used: Mutagenesis, Infection

    29) Product Images from "TRIM19/PML Restricts HIV Infection in a Cell Type-Dependent Manner"

    Article Title: TRIM19/PML Restricts HIV Infection in a Cell Type-Dependent Manner

    Journal: Viruses

    doi: 10.3390/v8010002

    The knockdown of PML but not of Daxx or Sp100 affects HIV infectivity. ( A ) Lysates from HFFs expressing shRNA directed against, Daxx (shDaxx), Sp100 (shSp100), or control shRNA (shC) were analyzed via immunoblot. Membranes were probed with antibodies directed against Daxx, Sp100 or the loading control GAPDH; ( B ) Cellular localization of Daxx and Sp100 in HFF cells. Cells were seeded onto coverslips, washed and probed with antibodies against Daxx or Sp100; ( C ) HFF shPML, shDaxx, shSp100, and shC cells were infected in triplicates with VSV-G pseudotyped HIV-GFP at a MOI of 1 or medium (mock). Infectivity was determined 72 h postinfection by flow cytometry; ( D ) HFF shPML, shDaxx, shSp100, and shC cells were infected in quadruplicates with increasing amounts of HIV-luc (cps). Infectivity was determined 72 h postinfection by a luciferase assay and is depicted as 10 3 cps. One of three independent experiments is shown. Error bars indicate the standard deviation of triplicate infections.
    Figure Legend Snippet: The knockdown of PML but not of Daxx or Sp100 affects HIV infectivity. ( A ) Lysates from HFFs expressing shRNA directed against, Daxx (shDaxx), Sp100 (shSp100), or control shRNA (shC) were analyzed via immunoblot. Membranes were probed with antibodies directed against Daxx, Sp100 or the loading control GAPDH; ( B ) Cellular localization of Daxx and Sp100 in HFF cells. Cells were seeded onto coverslips, washed and probed with antibodies against Daxx or Sp100; ( C ) HFF shPML, shDaxx, shSp100, and shC cells were infected in triplicates with VSV-G pseudotyped HIV-GFP at a MOI of 1 or medium (mock). Infectivity was determined 72 h postinfection by flow cytometry; ( D ) HFF shPML, shDaxx, shSp100, and shC cells were infected in quadruplicates with increasing amounts of HIV-luc (cps). Infectivity was determined 72 h postinfection by a luciferase assay and is depicted as 10 3 cps. One of three independent experiments is shown. Error bars indicate the standard deviation of triplicate infections.

    Techniques Used: Infection, Expressing, shRNA, Flow Cytometry, Cytometry, Luciferase, Standard Deviation

    The separate overexpression of different PML isoforms reduces HIV-1 infectivity in HFF. ( A ) Lysates from HFF cells stably overexpressing the PML isoforms I to VI or control cells (ctrl) were analyzed by immunoblot probed with anti-PML antibodies or anti-GAPDH MAb. White triangles mark the predicted size of the PML isoforms; ( B ) PML isoform I to VI expressing HFF cells or control cells (ctrl) were either not infected (mock) or transduced with VSV-G pseudotyped HIV-GFP reporter viruses at a MOI of 0.3. HIV infectivity was determined 72 h postinfection by flow cytometry. The data are presented as the average of triplicates, with error bars indicating the standard deviation. The results shown are representative of four independent experiments. Mock: not infected.
    Figure Legend Snippet: The separate overexpression of different PML isoforms reduces HIV-1 infectivity in HFF. ( A ) Lysates from HFF cells stably overexpressing the PML isoforms I to VI or control cells (ctrl) were analyzed by immunoblot probed with anti-PML antibodies or anti-GAPDH MAb. White triangles mark the predicted size of the PML isoforms; ( B ) PML isoform I to VI expressing HFF cells or control cells (ctrl) were either not infected (mock) or transduced with VSV-G pseudotyped HIV-GFP reporter viruses at a MOI of 0.3. HIV infectivity was determined 72 h postinfection by flow cytometry. The data are presented as the average of triplicates, with error bars indicating the standard deviation. The results shown are representative of four independent experiments. Mock: not infected.

    Techniques Used: Over Expression, Infection, Stable Transfection, Expressing, Transduction, Flow Cytometry, Cytometry, Standard Deviation

    PML restricts HIV at the level of reverse transcription in HFF cells. ( A ) HFF shC or shPML cells were infected with increasing amounts of NL4-3 BlaM-Vpr. After 5 h, virus was removed, and the cells were loaded with the BlaM substrate CC2F for 18 h at 25 °C. Subsequently, cells were washed, fixed and analyzed by flow cytometry. The frequency of substrate cleavage following virus entry is depicted as percent lactamase positive cells; ( B ) HFF shC or shPML cells were infected with control supernatant (mock) or with HIV-GFP reporter virus. Total cellular DNA of the infected cells was isolated 12 h, 24 h, and 48 h postinfection (hpi) and used as a template in qPCR to amplify late reverse transcriptase products or ( C ) 2-LTR circles. AZT was added to one well prior to infection to control for contaminating proviral plasmid. The data are presented as the average of triplicates with error bars indicating the standard deviation. One out of three independent experiments is shown.
    Figure Legend Snippet: PML restricts HIV at the level of reverse transcription in HFF cells. ( A ) HFF shC or shPML cells were infected with increasing amounts of NL4-3 BlaM-Vpr. After 5 h, virus was removed, and the cells were loaded with the BlaM substrate CC2F for 18 h at 25 °C. Subsequently, cells were washed, fixed and analyzed by flow cytometry. The frequency of substrate cleavage following virus entry is depicted as percent lactamase positive cells; ( B ) HFF shC or shPML cells were infected with control supernatant (mock) or with HIV-GFP reporter virus. Total cellular DNA of the infected cells was isolated 12 h, 24 h, and 48 h postinfection (hpi) and used as a template in qPCR to amplify late reverse transcriptase products or ( C ) 2-LTR circles. AZT was added to one well prior to infection to control for contaminating proviral plasmid. The data are presented as the average of triplicates with error bars indicating the standard deviation. One out of three independent experiments is shown.

    Techniques Used: Infection, Flow Cytometry, Cytometry, Isolation, Real-time Polymerase Chain Reaction, Plasmid Preparation, Standard Deviation

    PML restricts HIV reverse transcription in MEFs. ( A ) Lysates from wild-type (WT) or PML knockout (KO) MEFs were immunoblotted and probed with anti-PML polyclonal antibodies or anti-HSP90 MAb; ( B ) WT or KO MEFs were infected with increasing MOI of VSV-G/HIV-GFP reporter virus. Infectivity was determined 72 h postinfection by flow cytometry; ( C ) WT or KO MEFs were infected with control supernatant (mock) or with HIV-GFP reporter virus at a MOI of 1. Total cellular DNA of the infected cells was isolated 12 h, 24 h, and 48 h postinfection (hpi) and used as template in qPCR to amplify late reverse transcriptase products or ( D ) 2-LTR circles. AZT was added to one well prior to infection to control for contaminating proviral plasmid. The data are presented as the average of triplicates with error bars indicating the standard deviation. One out of three independent experiments is shown.
    Figure Legend Snippet: PML restricts HIV reverse transcription in MEFs. ( A ) Lysates from wild-type (WT) or PML knockout (KO) MEFs were immunoblotted and probed with anti-PML polyclonal antibodies or anti-HSP90 MAb; ( B ) WT or KO MEFs were infected with increasing MOI of VSV-G/HIV-GFP reporter virus. Infectivity was determined 72 h postinfection by flow cytometry; ( C ) WT or KO MEFs were infected with control supernatant (mock) or with HIV-GFP reporter virus at a MOI of 1. Total cellular DNA of the infected cells was isolated 12 h, 24 h, and 48 h postinfection (hpi) and used as template in qPCR to amplify late reverse transcriptase products or ( D ) 2-LTR circles. AZT was added to one well prior to infection to control for contaminating proviral plasmid. The data are presented as the average of triplicates with error bars indicating the standard deviation. One out of three independent experiments is shown.

    Techniques Used: Knock-Out, Infection, Flow Cytometry, Cytometry, Isolation, Real-time Polymerase Chain Reaction, Plasmid Preparation, Standard Deviation

    PML does not affect HIV-1 infectivity in T cells. ( A ) Jurkat shC or shPML cells were probed for immunofluorescence analysis using an anti-PML antibody mix and DAPI for nuclear staining; ( B ) Jurkat shC and shPML cells were infected with increasing amounts of VSV-G/HIV-luc reporter virus or medium (mock). Luciferase activity was determined 72 h postinfection and is depicted as counts per second (cps); ( C ) Jurkat, Molt4, CEM, and HuT78 T cell lines harboring shRNA targeting PML or control shRNA were infected with HIV-GFP at the MOIs 0.03 and 0.3. HIV-GFP infectivity was quantified after 72 h by flow cytometry. Error bars indicate the standard deviation of triplicate infections; ( D ) Cell lysates of the different shC and shPML T cell lines were analyzed by immunoblot and probed with anti-PML and anti-GAPDH antibodies. Numbers indicate the PML expression levels in shPML cells relative to shC cells. PML protein levels were quantified using the AIDA imaging software (Raytest) and were normalized to GAPDH expression.
    Figure Legend Snippet: PML does not affect HIV-1 infectivity in T cells. ( A ) Jurkat shC or shPML cells were probed for immunofluorescence analysis using an anti-PML antibody mix and DAPI for nuclear staining; ( B ) Jurkat shC and shPML cells were infected with increasing amounts of VSV-G/HIV-luc reporter virus or medium (mock). Luciferase activity was determined 72 h postinfection and is depicted as counts per second (cps); ( C ) Jurkat, Molt4, CEM, and HuT78 T cell lines harboring shRNA targeting PML or control shRNA were infected with HIV-GFP at the MOIs 0.03 and 0.3. HIV-GFP infectivity was quantified after 72 h by flow cytometry. Error bars indicate the standard deviation of triplicate infections; ( D ) Cell lysates of the different shC and shPML T cell lines were analyzed by immunoblot and probed with anti-PML and anti-GAPDH antibodies. Numbers indicate the PML expression levels in shPML cells relative to shC cells. PML protein levels were quantified using the AIDA imaging software (Raytest) and were normalized to GAPDH expression.

    Techniques Used: Infection, Immunofluorescence, Staining, Luciferase, Activity Assay, shRNA, Flow Cytometry, Cytometry, Standard Deviation, Expressing, Imaging, Software

    HIV infection induces a temporary relocalization of ND10 structures to the cytoplasm. ( A ) WT HFF cells were seeded on coverslips and infected with Matrix-GFP-containing HIV reporter virus at a MOI of 3 (HIV-MAGFP), or left untreated (mock). At 0.5 h, 1 h, 2 h, 4 h, 6 h, 10 h, and 24 h postinfection, the cells were extensively washed and probed for immunofluorescence analysis using anti-PML antibodies and DAPI for nuclear staining. The presence of HIV-MAGFP particles (green), the PML localization (red), and DAPI staining (blue) was analyzed at the different time points postinfection by confocal microscopy. Exemplary analysis of uninfected cells (mock) and HIV-GFP infected cells at 0.5 h, 4 h, and 24 h postinfection are depicted; ( B ) Statistical analysis of the PML localization in HIV-GFP-positive cells. For each indicated time point, the cellular localization of PML/ND10 structures in HIV-positive cells or uninfected cells (mock) was determined and is blotted as percentage of total PML-positive cells ( n = 100 cells/time point).
    Figure Legend Snippet: HIV infection induces a temporary relocalization of ND10 structures to the cytoplasm. ( A ) WT HFF cells were seeded on coverslips and infected with Matrix-GFP-containing HIV reporter virus at a MOI of 3 (HIV-MAGFP), or left untreated (mock). At 0.5 h, 1 h, 2 h, 4 h, 6 h, 10 h, and 24 h postinfection, the cells were extensively washed and probed for immunofluorescence analysis using anti-PML antibodies and DAPI for nuclear staining. The presence of HIV-MAGFP particles (green), the PML localization (red), and DAPI staining (blue) was analyzed at the different time points postinfection by confocal microscopy. Exemplary analysis of uninfected cells (mock) and HIV-GFP infected cells at 0.5 h, 4 h, and 24 h postinfection are depicted; ( B ) Statistical analysis of the PML localization in HIV-GFP-positive cells. For each indicated time point, the cellular localization of PML/ND10 structures in HIV-positive cells or uninfected cells (mock) was determined and is blotted as percentage of total PML-positive cells ( n = 100 cells/time point).

    Techniques Used: Infection, Immunofluorescence, Staining, Confocal Microscopy

    PML blocks the infection of diverse retroviruses. HFF shPML and shC cells were infected in triplicates with increasing amounts of VSV-G pseudotyped reporter viruses or medium (mock). Cells were inoculated with increasing amounts (counts per second; cps) of HIV luciferase-encoding (HIV-luc) or SIV luciferase encoding (SIVluc) reporter virus. Infectivity was determined 72 h postinfection by a luciferase assay and is depicted as counts per second (cps). For MPMV-GFP and MLV-GFP infections, HFF shPML and shC cells were infected with increasing MOI (multiplicity of infection) of VSV-G pseudotyped GFP reporter viruses. Infectivity was determined 72 h postinfection by flow cytometry. Error bars indicate the standard deviation of triplicate infections. The results shown are representative of three independent experiments.
    Figure Legend Snippet: PML blocks the infection of diverse retroviruses. HFF shPML and shC cells were infected in triplicates with increasing amounts of VSV-G pseudotyped reporter viruses or medium (mock). Cells were inoculated with increasing amounts (counts per second; cps) of HIV luciferase-encoding (HIV-luc) or SIV luciferase encoding (SIVluc) reporter virus. Infectivity was determined 72 h postinfection by a luciferase assay and is depicted as counts per second (cps). For MPMV-GFP and MLV-GFP infections, HFF shPML and shC cells were infected with increasing MOI (multiplicity of infection) of VSV-G pseudotyped GFP reporter viruses. Infectivity was determined 72 h postinfection by flow cytometry. Error bars indicate the standard deviation of triplicate infections. The results shown are representative of three independent experiments.

    Techniques Used: Infection, Luciferase, Flow Cytometry, Cytometry, Standard Deviation

    The knockdown of PML does not enhance HIV-1 infectivity in myeloid cells. ( A ) THP-1 shC, shPML, shDaxx, or shSp100 cells lysates were separated by SDS-PAGE, blotted, and probed with antibodies direct against PML, Daxx, Sp100, or the loading control Actin; ( B ) THP-1 shC, shPML, shDaxx, or shSp100 cells were infected with HIV-GFP at an MOI of 0.3 or ( C ) with increasing amounts of HIV-luciferase reporter virus. Luciferase or GFP expressing cells were quantified 72 h postinfection by a luciferase assay (counts per second, cps) or flow cytometry (percent GFP-positive cells); ( D ) U937 shC or shPML cells were probed for immunofluorescence analysis using an anti-PML antibody mix and DAPI for nuclear staining; ( E ) U937 shC or shPML cells were infected with increasing MOIs of HIV-GFP. Infectivity was quantified 72 h postinfection by flow cytometry. Each result is representative of at least three independent experiments. Error bars indicate the standard deviation of triplicate infections.
    Figure Legend Snippet: The knockdown of PML does not enhance HIV-1 infectivity in myeloid cells. ( A ) THP-1 shC, shPML, shDaxx, or shSp100 cells lysates were separated by SDS-PAGE, blotted, and probed with antibodies direct against PML, Daxx, Sp100, or the loading control Actin; ( B ) THP-1 shC, shPML, shDaxx, or shSp100 cells were infected with HIV-GFP at an MOI of 0.3 or ( C ) with increasing amounts of HIV-luciferase reporter virus. Luciferase or GFP expressing cells were quantified 72 h postinfection by a luciferase assay (counts per second, cps) or flow cytometry (percent GFP-positive cells); ( D ) U937 shC or shPML cells were probed for immunofluorescence analysis using an anti-PML antibody mix and DAPI for nuclear staining; ( E ) U937 shC or shPML cells were infected with increasing MOIs of HIV-GFP. Infectivity was quantified 72 h postinfection by flow cytometry. Each result is representative of at least three independent experiments. Error bars indicate the standard deviation of triplicate infections.

    Techniques Used: Infection, SDS Page, Luciferase, Expressing, Flow Cytometry, Cytometry, Immunofluorescence, Staining, Standard Deviation

    The knockdown of PML correlates with enhanced HIV-1 infectivity in HFF. ( A ) Lysates from HFF cells stably expressing shRNA directed against PML (shPML) or control shRNA (shC) were analyzed on an immunoblot probed with anti-PML antibodies or anti-GAPDH MAb; ( B ) Cellular localization of PML in HFF shC and shPML cells. HFFs were seeded onto coverslips, washed, and probed with antibodies against PML; ( C ) HFF shPML and shC cells were infected in triplicates with increasing MOI (multiplicity of infection) of VSV-G pseudotyped HIV-GFP reporter viruses or medium (mock); ( D ) HFF shPML and shC cells were infected with HIV-GFP reporter virus coding for all viral accessory proteins but nef (HIV-GFP) or with virus lacking all accessory protein (HIVGFP Δacc); ( E ) HFF shPML and shC cells were treated with increasing concentrations of sodium arsenite (NaAsO 2 ) for 36 h and infected with HIV-GFP reporter virus at a MOI of 0.3. HIV infectivity was determined 72 h postinfection by flow cytometry. The data are presented as the average of triplicates with error bars indicating the standard deviation. The results shown are representative of three independent experiments. Mock: not infected.
    Figure Legend Snippet: The knockdown of PML correlates with enhanced HIV-1 infectivity in HFF. ( A ) Lysates from HFF cells stably expressing shRNA directed against PML (shPML) or control shRNA (shC) were analyzed on an immunoblot probed with anti-PML antibodies or anti-GAPDH MAb; ( B ) Cellular localization of PML in HFF shC and shPML cells. HFFs were seeded onto coverslips, washed, and probed with antibodies against PML; ( C ) HFF shPML and shC cells were infected in triplicates with increasing MOI (multiplicity of infection) of VSV-G pseudotyped HIV-GFP reporter viruses or medium (mock); ( D ) HFF shPML and shC cells were infected with HIV-GFP reporter virus coding for all viral accessory proteins but nef (HIV-GFP) or with virus lacking all accessory protein (HIVGFP Δacc); ( E ) HFF shPML and shC cells were treated with increasing concentrations of sodium arsenite (NaAsO 2 ) for 36 h and infected with HIV-GFP reporter virus at a MOI of 0.3. HIV infectivity was determined 72 h postinfection by flow cytometry. The data are presented as the average of triplicates with error bars indicating the standard deviation. The results shown are representative of three independent experiments. Mock: not infected.

    Techniques Used: Infection, Stable Transfection, Expressing, shRNA, Flow Cytometry, Cytometry, Standard Deviation

    The PML-mediated block to HIV infection acts independently of the LTR promoter. ( A ) HFF shPML and shC cells were transduced with the indicated HIV-GFP virus expressing the reporter gene under the control of the HIV LTR promoter (LTR-GFP), the herpesviral CMV promoter (CMV-GFP), or the cellular EF1α promoter (EF1α-GFP) at a MOI of 0.3. Infectivity was determined 72 h postinfection by flow cytometry. Error bars indicate the standard deviation of triplicate infections. ( B ) Same as in ( A ) but blotted as enhancement of HIV infectivity in shPML cells over shC cells.
    Figure Legend Snippet: The PML-mediated block to HIV infection acts independently of the LTR promoter. ( A ) HFF shPML and shC cells were transduced with the indicated HIV-GFP virus expressing the reporter gene under the control of the HIV LTR promoter (LTR-GFP), the herpesviral CMV promoter (CMV-GFP), or the cellular EF1α promoter (EF1α-GFP) at a MOI of 0.3. Infectivity was determined 72 h postinfection by flow cytometry. Error bars indicate the standard deviation of triplicate infections. ( B ) Same as in ( A ) but blotted as enhancement of HIV infectivity in shPML cells over shC cells.

    Techniques Used: Blocking Assay, Infection, Transduction, Expressing, Flow Cytometry, Cytometry, Standard Deviation

    30) Product Images from "Modulation of Translation Initiation Efficiency in Classical Swine Fever Virus"

    Article Title: Modulation of Translation Initiation Efficiency in Classical Swine Fever Virus

    Journal: Journal of Virology

    doi: 10.1128/JVI.00346-12

    Growth characteristics of wt and mutant CSFVs in cells. (A) wt Pader10- and PaderS2m5_IIId 1 4-infected PK15 cells stained with NS3-specific antibody (green) and DAPI (blue) 72 h postinfection. Pictures were taken at ×10 magnification. (B) The growth of the rescued viruses wt Pader10, PaderS2m5, PaderS2m6, and PaderS2m7 in PK15 cells was evaluated using one-step growth curves. Virus titers were determined from harvests prepared at 3, 12, 24, 48, and 72 h postinfection. (C) Viral RNA accumulation from PK15 extracts infected with the rescued viruses wt Pader10, PaderS2m5, PaderS2m6 and paderS2m7 was determined by quantitative RT-PCR at 3, 12, 24, 48, and 72 h postinfection. Data in panels B and C are represented as means + SD ( n = 3).
    Figure Legend Snippet: Growth characteristics of wt and mutant CSFVs in cells. (A) wt Pader10- and PaderS2m5_IIId 1 4-infected PK15 cells stained with NS3-specific antibody (green) and DAPI (blue) 72 h postinfection. Pictures were taken at ×10 magnification. (B) The growth of the rescued viruses wt Pader10, PaderS2m5, PaderS2m6, and PaderS2m7 in PK15 cells was evaluated using one-step growth curves. Virus titers were determined from harvests prepared at 3, 12, 24, 48, and 72 h postinfection. (C) Viral RNA accumulation from PK15 extracts infected with the rescued viruses wt Pader10, PaderS2m5, PaderS2m6 and paderS2m7 was determined by quantitative RT-PCR at 3, 12, 24, 48, and 72 h postinfection. Data in panels B and C are represented as means + SD ( n = 3).

    Techniques Used: Mutagenesis, Infection, Staining, Quantitative RT-PCR

    31) Product Images from "Tropism and Innate Host Responses of the 2009 Pandemic H1N1 Influenza Virus in ex Vivo and in Vitro Cultures of Human Conjunctiva and Respiratory Tract"

    Article Title: Tropism and Innate Host Responses of the 2009 Pandemic H1N1 Influenza Virus in ex Vivo and in Vitro Cultures of Human Conjunctiva and Respiratory Tract

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2010.091087

    Ex vivo organ cultures of conjunctiva infected with ( A ) VN04/H5N1, ( B ) NL03/H7N7, and ( C ) HK09/H1N1pdm at 24 hours postinfection showing positive staining for influenza A nucleoprotein (reddish brown with arrow ). Negative staining for influenza A nucleoprotein
    Figure Legend Snippet: Ex vivo organ cultures of conjunctiva infected with ( A ) VN04/H5N1, ( B ) NL03/H7N7, and ( C ) HK09/H1N1pdm at 24 hours postinfection showing positive staining for influenza A nucleoprotein (reddish brown with arrow ). Negative staining for influenza A nucleoprotein

    Techniques Used: Ex Vivo, Infection, Staining, Negative Staining

    32) Product Images from "ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity"

    Article Title: ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity

    Journal:

    doi: 10.1128/JVI.79.9.5557-5567.2005

    ATPγS and GTPγS inhibit MLV virion infectivity. VSV-G-pseudotyped MLV NCA/IRES-GFP GFP reporter virions were treated with ATPγS or GTPγS and used to infect 293T cells. Two days postinfection, cells were analyzed for GFP
    Figure Legend Snippet: ATPγS and GTPγS inhibit MLV virion infectivity. VSV-G-pseudotyped MLV NCA/IRES-GFP GFP reporter virions were treated with ATPγS or GTPγS and used to infect 293T cells. Two days postinfection, cells were analyzed for GFP

    Techniques Used: Infection

    ATPγS inhibits HIV-1 virion infectivity. Virions treated with ATP or ATPγS for 6 h at 37°C were used to infect cells bearing a long terminal repeat-GFP reporter. GFP expression was analyzed by flow cytometry 2 days postinfection.
    Figure Legend Snippet: ATPγS inhibits HIV-1 virion infectivity. Virions treated with ATP or ATPγS for 6 h at 37°C were used to infect cells bearing a long terminal repeat-GFP reporter. GFP expression was analyzed by flow cytometry 2 days postinfection.

    Techniques Used: Infection, Expressing, Flow Cytometry, Cytometry

    33) Product Images from "The Latency-Associated Nuclear Antigen of Rhesus Monkey Rhadinovirus Inhibits Viral Replication through Repression of Orf50/Rta Transcriptional Activation"

    Article Title: The Latency-Associated Nuclear Antigen of Rhesus Monkey Rhadinovirus Inhibits Viral Replication through Repression of Orf50/Rta Transcriptional Activation

    Journal:

    doi: 10.1128/JVI.79.5.3127-3138.2005

    R-LANA inhibits RRV lytic replication. RhFs were transfected with either pEF or pEF-R-LANA FLAG . Twenty-four hours posttransfection, the cells were subsequently infected with RRV-GFP at an MOI of ≥1. Seventy-two hours postinfection, cell-free supernatants
    Figure Legend Snippet: R-LANA inhibits RRV lytic replication. RhFs were transfected with either pEF or pEF-R-LANA FLAG . Twenty-four hours posttransfection, the cells were subsequently infected with RRV-GFP at an MOI of ≥1. Seventy-two hours postinfection, cell-free supernatants

    Techniques Used: Transfection, Infection

    34) Product Images from "Impact of Sequence Variation in the UL128 Locus on Production of Human Cytomegalovirus in Fibroblast and Epithelial Cells"

    Article Title: Impact of Sequence Variation in the UL128 Locus on Production of Human Cytomegalovirus in Fibroblast and Epithelial Cells

    Journal: Journal of Virology

    doi: 10.1128/JVI.01546-13

    UL128 gene map and transcripts. (A) The position of the unique A residue identified in TB40-BAC4 UL128 intron 1, in place of the C residue present in all other strains, is indicated. Protein-coding exons are shaded. (B) HFFF cells were infected with the indicated virus, and total RNA was extracted at 72 h postinfection. RT-PCR was performed using primers binding in the first and third exons of UL128. The bands correspond to transcripts that are (i) unspliced, (ii) lacking intron 2, or (iii) lacking both intron 1 and intron 2.
    Figure Legend Snippet: UL128 gene map and transcripts. (A) The position of the unique A residue identified in TB40-BAC4 UL128 intron 1, in place of the C residue present in all other strains, is indicated. Protein-coding exons are shaded. (B) HFFF cells were infected with the indicated virus, and total RNA was extracted at 72 h postinfection. RT-PCR was performed using primers binding in the first and third exons of UL128. The bands correspond to transcripts that are (i) unspliced, (ii) lacking intron 2, or (iii) lacking both intron 1 and intron 2.

    Techniques Used: Infection, Reverse Transcription Polymerase Chain Reaction, Binding Assay

    35) Product Images from "Arming a Replicating Adenovirus with Osteoprotegerin Reduces the Tumor Burden in a Murine Model of Osteolytic Bone Metastases of Breast Cancer"

    Article Title: Arming a Replicating Adenovirus with Osteoprotegerin Reduces the Tumor Burden in a Murine Model of Osteolytic Bone Metastases of Breast Cancer

    Journal: Cancer gene therapy

    doi: 10.1038/cgt.2010.47

    Characterization of armed CRAds. A, B, MDA-MB-231 cells were infected with Ad5-Δ24-sOPG-Fc, Ad5-Δ24-sOPG-Fc-RGD or Adwt300. At the indicated times, cellular RNA was subjected to QRT-PCR to detect expression of: A, the sOPG-Fc gene (cells infected with Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD) or the 14.7k gene (cells infected with Adwt300); and B, the ADP gene. The copy number was normalized to total cellular RNA. C, Secretion of sOPG-Fc. MDA-MB-231 cells were infected with Ad5-Δ24, Ad5-Δ24RGD, Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD. At the indicated times, medium was harvested, diluted 1:300 and expression of sOPG-Fc was detected in an ELISA. D , sOPG-Fc binds RANKL. Medium from MDA-MB-231 cells 48 h postinfection was incubated in the presence (+) or absence (−) of sRANKL and pulled down with protein G-agarose. Proteins were released and subjected to immunoblot using anti-RANKL primary antibody. C: sRANKL.
    Figure Legend Snippet: Characterization of armed CRAds. A, B, MDA-MB-231 cells were infected with Ad5-Δ24-sOPG-Fc, Ad5-Δ24-sOPG-Fc-RGD or Adwt300. At the indicated times, cellular RNA was subjected to QRT-PCR to detect expression of: A, the sOPG-Fc gene (cells infected with Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD) or the 14.7k gene (cells infected with Adwt300); and B, the ADP gene. The copy number was normalized to total cellular RNA. C, Secretion of sOPG-Fc. MDA-MB-231 cells were infected with Ad5-Δ24, Ad5-Δ24RGD, Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD. At the indicated times, medium was harvested, diluted 1:300 and expression of sOPG-Fc was detected in an ELISA. D , sOPG-Fc binds RANKL. Medium from MDA-MB-231 cells 48 h postinfection was incubated in the presence (+) or absence (−) of sRANKL and pulled down with protein G-agarose. Proteins were released and subjected to immunoblot using anti-RANKL primary antibody. C: sRANKL.

    Techniques Used: Multiple Displacement Amplification, Infection, Quantitative RT-PCR, Expressing, Enzyme-linked Immunosorbent Assay, Incubation

    Oncolytic potency of armed CRAds. MDA-MB-231 ( A ) and MDA-MB-435 ( B ) cells were infected. DNA was extracted from medium 2 and 4 days postinfection and subjected to Q-PCR to detect the E4 gene. Results are means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of breast cancer cell lines was infected at the indicated MOIs. Eight days postinfection, cells were stained with crystal violet. Representative results of 3 separate experiments are shown.
    Figure Legend Snippet: Oncolytic potency of armed CRAds. MDA-MB-231 ( A ) and MDA-MB-435 ( B ) cells were infected. DNA was extracted from medium 2 and 4 days postinfection and subjected to Q-PCR to detect the E4 gene. Results are means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of breast cancer cell lines was infected at the indicated MOIs. Eight days postinfection, cells were stained with crystal violet. Representative results of 3 separate experiments are shown.

    Techniques Used: Multiple Displacement Amplification, Infection, Polymerase Chain Reaction, Staining

    Selectivity of the armed CRAds. Viral replication. Human liver slices ( A ) and MCF-10A normal breast epithelial cells ( B ) were infected with the indicated viruses. The conditioned culture medium was harvested at 2 and 4 days postinfection. DNA was extracted and subjected to Q-PCR to detect the E4 gene as a measure of viral DNA replication. Results are the means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of non-neoplastic cells was infected at the indicated MOIs. Eight days postinfection, viable cells were fixed and stained with crystal violet. Representative results of 3 separate experiments are shown.
    Figure Legend Snippet: Selectivity of the armed CRAds. Viral replication. Human liver slices ( A ) and MCF-10A normal breast epithelial cells ( B ) were infected with the indicated viruses. The conditioned culture medium was harvested at 2 and 4 days postinfection. DNA was extracted and subjected to Q-PCR to detect the E4 gene as a measure of viral DNA replication. Results are the means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of non-neoplastic cells was infected at the indicated MOIs. Eight days postinfection, viable cells were fixed and stained with crystal violet. Representative results of 3 separate experiments are shown.

    Techniques Used: Infection, Polymerase Chain Reaction, Staining

    36) Product Images from "Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses"

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.00397-19

    Compound 10 prevention of disease caused by DENV-2 infection in infected mice. A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0. Disease and inflammatory parameters were measured on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (starting on day 0) or therapeutically (starting on day 2 postinfection). (A) Numbers of platelets. (B) Changes in body weight, analyzed daily. Results are expressed as a percentage of initial weight loss after DENV-2 inoculation. (C) Total and differential cell counts in blood, represented as the numbers of different cell types (leukocytes, mononuclear cells, and neutrophils) normalized to the total cell counts. (D) Neutrophil influx into the spleen. (E) Neutrophil influx into the brain. (F) Concentrations of IL-6 in mouse serum. (G) Concentrations of CCL5 in mouse serum. (H) Semiquantitative analysis (histopathological score) and representative pictures for each group after hematoxylin and eosin staining of liver sections from control and DENV-2-infected mice, treated with compound 10 or not, 6 days after infection. ND, not determined. Original magnification, ×200. Scale bar, 100 μm. (I) Compound 10 induction of elevated IFN-γ levels upon DENV-2 infection. Results are expressed as means ± SEMs and are representative of two experiments. *, P  
    Figure Legend Snippet: Compound 10 prevention of disease caused by DENV-2 infection in infected mice. A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0. Disease and inflammatory parameters were measured on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (starting on day 0) or therapeutically (starting on day 2 postinfection). (A) Numbers of platelets. (B) Changes in body weight, analyzed daily. Results are expressed as a percentage of initial weight loss after DENV-2 inoculation. (C) Total and differential cell counts in blood, represented as the numbers of different cell types (leukocytes, mononuclear cells, and neutrophils) normalized to the total cell counts. (D) Neutrophil influx into the spleen. (E) Neutrophil influx into the brain. (F) Concentrations of IL-6 in mouse serum. (G) Concentrations of CCL5 in mouse serum. (H) Semiquantitative analysis (histopathological score) and representative pictures for each group after hematoxylin and eosin staining of liver sections from control and DENV-2-infected mice, treated with compound 10 or not, 6 days after infection. ND, not determined. Original magnification, ×200. Scale bar, 100 μm. (I) Compound 10 induction of elevated IFN-γ levels upon DENV-2 infection. Results are expressed as means ± SEMs and are representative of two experiments. *, P  

    Techniques Used: Infection, Mouse Assay, Staining

    Antiviral effects of compound 10 against DENV-2 in vivo . A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0, and viral loads were quantified with a plaque assay on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (from day 0 to day 6) or therapeutically (from day 2 to day 6). Viral loads recovered from serum (A), spleen (B), liver (C), and brain (D) were determined. The median values for viral loads are represented as lines. #, P  
    Figure Legend Snippet: Antiviral effects of compound 10 against DENV-2 in vivo . A129 mice (5 to 8 mice per group) were infected with DENV-2 (1 × 10 3 PFU) on day 0, and viral loads were quantified with a plaque assay on day 6 postinfection. Compound 10 was administered daily (10 mg/kg), via the i.p. route, as a pretreatment (from day 0 to day 6) or therapeutically (from day 2 to day 6). Viral loads recovered from serum (A), spleen (B), liver (C), and brain (D) were determined. The median values for viral loads are represented as lines. #, P  

    Techniques Used: In Vivo, Mouse Assay, Infection, Plaque Assay

    37) Product Images from "Inhibition of Severe Acute Respiratory Syndrome Coronavirus Replication by Niclosamide"

    Article Title: Inhibition of Severe Acute Respiratory Syndrome Coronavirus Replication by Niclosamide

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.48.7.2693-2696.2004

    Inhibition of viral antigen synthesis in SARS-CoV-infected Vero E6 cells as revealed by an IFA. Vero E6 cells were treated with the various concentrations of niclosamide indicated, and an IFA was performed at 48 h postinfection. Vero E6 cells were fixed and stained with the same primary antiserum directed against SARS-CoV as that used in the immunoblot analysis. Fluorescein isothiocyanate-conjugated goat anti-human immunoglobulin (Jackson ImmunoResearch Laboratoeies, Inc.) was used as the secondary antibody. The positive panel shows cells infected by SARS-CoV but without drug treatment, while the negative panel shows cells without virus infection.
    Figure Legend Snippet: Inhibition of viral antigen synthesis in SARS-CoV-infected Vero E6 cells as revealed by an IFA. Vero E6 cells were treated with the various concentrations of niclosamide indicated, and an IFA was performed at 48 h postinfection. Vero E6 cells were fixed and stained with the same primary antiserum directed against SARS-CoV as that used in the immunoblot analysis. Fluorescein isothiocyanate-conjugated goat anti-human immunoglobulin (Jackson ImmunoResearch Laboratoeies, Inc.) was used as the secondary antibody. The positive panel shows cells infected by SARS-CoV but without drug treatment, while the negative panel shows cells without virus infection.

    Techniques Used: Inhibition, Infection, Immunofluorescence, Staining

    38) Product Images from "Attenuated Infectious Hematopoietic Necrosis Virus with Rearranged Gene Order as Potential Vaccine"

    Article Title: Attenuated Infectious Hematopoietic Necrosis Virus with Rearranged Gene Order as Potential Vaccine

    Journal: Journal of Virology

    doi: 10.1128/JVI.01024-16

    Relative level of expression of each viral mRNA expressed at 8 h postinfection in EPC cells. The level of expression of each viral mRNA was compared to that of the first gene (N or P). No significant difference could be measured between each virus compared
    Figure Legend Snippet: Relative level of expression of each viral mRNA expressed at 8 h postinfection in EPC cells. The level of expression of each viral mRNA was compared to that of the first gene (N or P). No significant difference could be measured between each virus compared

    Techniques Used: Expressing

    39) Product Images from "A Cyclin-Binding Motif in Human SAMHD1 Is Required for Its HIV-1 Restriction, dNTPase Activity, Tetramer Formation, and Efficient Phosphorylation"

    Article Title: A Cyclin-Binding Motif in Human SAMHD1 Is Required for Its HIV-1 Restriction, dNTPase Activity, Tetramer Formation, and Efficient Phosphorylation

    Journal: Journal of Virology

    doi: 10.1128/JVI.01787-17

    The RXL motif in SAMHD1 is required for HIV-1 restriction and dNTPase activity. (A) U937 cells stably expressing vector (V) or WT or mutant (F/W or RL/AA) SAMHD1 were differentiated with PMA for 24 h and then cultured for a further 24 h prior to detection of protein expression. GAPDH was used as a loading control. Relative Phos-T592 was calculated by normalizing densitometry values for total SAMHD1 (HA) signals to GAPDH. The relative ratio of Phos-T592 to total SAMHD1 is shown; the value for the WT was set as 1. (B) PMA-differentiated U937 cells were infected with single-cycle HIV-1-Luc/VSV-G (multiplicity of infection of 0.5). Lysates were collected 48 h postinfection, and infection was quantified by luciferase assay. All samples were normalized by protein content. Data were calculated relative to the value for the vector cells, which was set as 1. Data represent results from one experiment from four independent repeats. (C) HIV-1 late reverse transcription (RT) products from infected cells were quantified via qPCR of total genomic DNA. GAPDH levels were used as a normalization control. Data were calculated relative to the value for vector cells, which was set as 1. Data represent results from one experiment with four biological replicates. (D and E) The mRNA levels of HIV-1 gag and the reporter firefly luciferase gene ( FFluc ) were measured in infected cells by RT-qPCR. GAPDH mRNA levels were used as a control. Data were calculated relative to the value for the vector cells, which was set as 1 using the 2 −ΔΔ CT method. Data represent the averages of 3 independent experiments. (F) PMA-differentiated U937 cells were infected with single-cycle HIV-1-ΔEnv-GFP/VSV-G as described for panel B. Viral infection was quantified as GFP-positive cells using flow cytometry. Data were calculated relative to the value for the vector cells, which was set as 1. Data represent the averages of two independent experiments, each with triplicate samples. Error bars represent SDs. (G) dNTP analysis of PMA-differentiated U937 cell lines. Data represent the averages of two experiments. To better compare lower dCTP levels among the samples, the dCTP levels are also presented in a different scale (right graph). The data are means ± SDs. Statistical analysis was performed by one-way ANOVA with Dunnett's multiple-comparison test. ***, P
    Figure Legend Snippet: The RXL motif in SAMHD1 is required for HIV-1 restriction and dNTPase activity. (A) U937 cells stably expressing vector (V) or WT or mutant (F/W or RL/AA) SAMHD1 were differentiated with PMA for 24 h and then cultured for a further 24 h prior to detection of protein expression. GAPDH was used as a loading control. Relative Phos-T592 was calculated by normalizing densitometry values for total SAMHD1 (HA) signals to GAPDH. The relative ratio of Phos-T592 to total SAMHD1 is shown; the value for the WT was set as 1. (B) PMA-differentiated U937 cells were infected with single-cycle HIV-1-Luc/VSV-G (multiplicity of infection of 0.5). Lysates were collected 48 h postinfection, and infection was quantified by luciferase assay. All samples were normalized by protein content. Data were calculated relative to the value for the vector cells, which was set as 1. Data represent results from one experiment from four independent repeats. (C) HIV-1 late reverse transcription (RT) products from infected cells were quantified via qPCR of total genomic DNA. GAPDH levels were used as a normalization control. Data were calculated relative to the value for vector cells, which was set as 1. Data represent results from one experiment with four biological replicates. (D and E) The mRNA levels of HIV-1 gag and the reporter firefly luciferase gene ( FFluc ) were measured in infected cells by RT-qPCR. GAPDH mRNA levels were used as a control. Data were calculated relative to the value for the vector cells, which was set as 1 using the 2 −ΔΔ CT method. Data represent the averages of 3 independent experiments. (F) PMA-differentiated U937 cells were infected with single-cycle HIV-1-ΔEnv-GFP/VSV-G as described for panel B. Viral infection was quantified as GFP-positive cells using flow cytometry. Data were calculated relative to the value for the vector cells, which was set as 1. Data represent the averages of two independent experiments, each with triplicate samples. Error bars represent SDs. (G) dNTP analysis of PMA-differentiated U937 cell lines. Data represent the averages of two experiments. To better compare lower dCTP levels among the samples, the dCTP levels are also presented in a different scale (right graph). The data are means ± SDs. Statistical analysis was performed by one-way ANOVA with Dunnett's multiple-comparison test. ***, P

    Techniques Used: Activity Assay, Stable Transfection, Expressing, Plasmid Preparation, Mutagenesis, Cell Culture, Infection, Luciferase, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Flow Cytometry, Cytometry

    40) Product Images from "A Point Mutation, E95D, in the Mumps Virus V Protein Disengages STAT3 Targeting from STAT1 Targeting ▿"

    Article Title: A Point Mutation, E95D, in the Mumps Virus V Protein Disengages STAT3 Targeting from STAT1 Targeting ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.00596-09

    Increased apoptosis induced by recombinant E95D mutant mumps virus. (A) Vero cells were infected with WT or E95D mutant mumps virus at an MOI of 0.5 PFU/cell for 2 h and overlaid with agarose to restrict virus spreading. Cells were stained with crystal violet at 4 and 6 days postinfection (dpi) to visualize plaques. (B) Vero cells were mock infected or infected with Sendai virus (SeV), WT recombinant mumps virus, or E95D mutant recombinant mumps virus at an MOI of 1 PFU/cell. At 48 h later, cells were fixed, permeabilized, and stained with TUNEL stain according to the manufacturer's protocol (Roche). Antiserum against STAT2 was used to stain all of the cells, irrespective of infection. Images were captured with a Leica confocal microscope at ×40 magnification. (C) TUNEL-positive cells were counted and expressed as a percentage of the total ( n = 200).
    Figure Legend Snippet: Increased apoptosis induced by recombinant E95D mutant mumps virus. (A) Vero cells were infected with WT or E95D mutant mumps virus at an MOI of 0.5 PFU/cell for 2 h and overlaid with agarose to restrict virus spreading. Cells were stained with crystal violet at 4 and 6 days postinfection (dpi) to visualize plaques. (B) Vero cells were mock infected or infected with Sendai virus (SeV), WT recombinant mumps virus, or E95D mutant recombinant mumps virus at an MOI of 1 PFU/cell. At 48 h later, cells were fixed, permeabilized, and stained with TUNEL stain according to the manufacturer's protocol (Roche). Antiserum against STAT2 was used to stain all of the cells, irrespective of infection. Images were captured with a Leica confocal microscope at ×40 magnification. (C) TUNEL-positive cells were counted and expressed as a percentage of the total ( n = 200).

    Techniques Used: Recombinant, Mutagenesis, Infection, Staining, TUNEL Assay, Microscopy

    41) Product Images from "SpxA1 and SpxA2 Act Coordinately To Fine-Tune Stress Responses and Virulence in Streptococcus pyogenes"

    Article Title: SpxA1 and SpxA2 Act Coordinately To Fine-Tune Stress Responses and Virulence in Streptococcus pyogenes

    Journal: mBio

    doi: 10.1128/mBio.00288-17

    SpxA1 − mutants are attenuated, and SpxA2 − mutants are hypervirulent. Hairless SKH1 mice were infected subcutaneously with 10 7 CFU of the strains indicated. The areas of the resulting ulcers at day 3 postinfection are shown (A, D). Each symbol represents an individual animal. A symbol overlaid with a horizontal line indicates a mouse that succumbed to infection prior to day 3. Values in parentheses adjacent to symbols placed off scale indicate actual lesion areas. Tissues were then harvested and processed to determine CFU counts (B, E) and levels of SpeB (C), which were determined by immunoblotting of samples normalized for bacterial burden. On the left, the open and closed arrowheads indicate processed and unprocessed SpeB, respectively, and the migration of several molecular weight standards (in kilodaltons) is shown. The data are pooled from at least two independent experiments, and the mean is indicated by a bar (*, P
    Figure Legend Snippet: SpxA1 − mutants are attenuated, and SpxA2 − mutants are hypervirulent. Hairless SKH1 mice were infected subcutaneously with 10 7 CFU of the strains indicated. The areas of the resulting ulcers at day 3 postinfection are shown (A, D). Each symbol represents an individual animal. A symbol overlaid with a horizontal line indicates a mouse that succumbed to infection prior to day 3. Values in parentheses adjacent to symbols placed off scale indicate actual lesion areas. Tissues were then harvested and processed to determine CFU counts (B, E) and levels of SpeB (C), which were determined by immunoblotting of samples normalized for bacterial burden. On the left, the open and closed arrowheads indicate processed and unprocessed SpeB, respectively, and the migration of several molecular weight standards (in kilodaltons) is shown. The data are pooled from at least two independent experiments, and the mean is indicated by a bar (*, P

    Techniques Used: Mouse Assay, Infection, Migration, Molecular Weight

    42) Product Images from "Complex Interplay between HIV-1 Capsid and MX2-Independent Alpha Interferon-Induced Antiviral Factors"

    Article Title: Complex Interplay between HIV-1 Capsid and MX2-Independent Alpha Interferon-Induced Antiviral Factors

    Journal: Journal of Virology

    doi: 10.1128/JVI.00458-16

    Hypersensitivity of the HIV-1 CA mutant N74D to IFN-α occurs at the stages of reverse transcription and nuclear import. Parental THP-1 or MX2g2-4 CRISPR/Cas9 cells were infected with VSV-G-pseudotyped NL4.3GFP wild-type or N74D CA mutant virus. (A) At 24 h after infection, the percentages of GFP-positive cells were determined by flow cytometry. (B to D) In two parallel samples, total DNA was extracted 4 h (B) or 24 h (C) postinfection and subjected to TaqMan quantitative PCR using a primer/probe set specific for GFP or 2-LTR circles (D). As a control for plasmid contamination, boiled virus was used. The averages of two independent experiments are shown.
    Figure Legend Snippet: Hypersensitivity of the HIV-1 CA mutant N74D to IFN-α occurs at the stages of reverse transcription and nuclear import. Parental THP-1 or MX2g2-4 CRISPR/Cas9 cells were infected with VSV-G-pseudotyped NL4.3GFP wild-type or N74D CA mutant virus. (A) At 24 h after infection, the percentages of GFP-positive cells were determined by flow cytometry. (B to D) In two parallel samples, total DNA was extracted 4 h (B) or 24 h (C) postinfection and subjected to TaqMan quantitative PCR using a primer/probe set specific for GFP or 2-LTR circles (D). As a control for plasmid contamination, boiled virus was used. The averages of two independent experiments are shown.

    Techniques Used: Mutagenesis, CRISPR, Infection, Flow Cytometry, Cytometry, Real-time Polymerase Chain Reaction, Plasmid Preparation

    43) Product Images from "Reovirus-Induced Alterations in Gene Expression Related to Cell Cycle Regulation"

    Article Title: Reovirus-Induced Alterations in Gene Expression Related to Cell Cycle Regulation

    Journal: Journal of Virology

    doi: 10.1128/JVI.76.6.2585-2594.2002

    wee1, chk1, and GADD45 transcripts are increased following reovirus infection. (a) HEK293 cells were either mock infected or infected with T3A, T1L, or UV-inactivated T3A at an MOI of 100 PFU per cell. mRNA was collected at 24 h postinfection and analyzed for chk1, wee1, and GADD45 transcripts by RT-PCR to confirm microarray analyses and also to assess the importance of replication competence for the observed changes in gene expression. β-Actin was used as a control in each RT-PCR to ensure matched total mRNA and equivalent amplication conditions for each experimental sample. (b) Quantitative densitometric analysis of specific mRNA abundance in each sample.
    Figure Legend Snippet: wee1, chk1, and GADD45 transcripts are increased following reovirus infection. (a) HEK293 cells were either mock infected or infected with T3A, T1L, or UV-inactivated T3A at an MOI of 100 PFU per cell. mRNA was collected at 24 h postinfection and analyzed for chk1, wee1, and GADD45 transcripts by RT-PCR to confirm microarray analyses and also to assess the importance of replication competence for the observed changes in gene expression. β-Actin was used as a control in each RT-PCR to ensure matched total mRNA and equivalent amplication conditions for each experimental sample. (b) Quantitative densitometric analysis of specific mRNA abundance in each sample.

    Techniques Used: Infection, Reverse Transcription Polymerase Chain Reaction, Microarray, Expressing

    44) Product Images from "Inhibition of \documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \pagestyle{empty} \oddsidemargin -1.0in \begin{document} \begin{equation*}{\mathrm{tRNA}}_{3}^{{\mathrm{Lys}}}\end{equation*}\end{document}-Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication ▿"

    Article Title: Inhibition of \documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \pagestyle{empty} \oddsidemargin -1.0in \begin{document} \begin{equation*}{\mathrm{tRNA}}_{3}^{{\mathrm{Lys}}}\end{equation*}\end{document}-Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01038-06

    Real-time PCR quantitation of newly synthesized HIV-1 DNA. DNA was extracted at different times postinfection from SupT1 cells infected with the four viral types: BH10, plus or minus hA3G, and BH10Vif-, plus or minus hA3G. Early (R-U5) and late (U5-gag) minus-strand cDNA production was monitored by real-time PCR, as described in Materials and Methods. (A) Arrows indicate the PCR primers used to detect early (U5a-R) and late (gag-U5b) minus-strand DNA. (B and C) Graphs on the right show the postinfection time course of production of viral early (B) and late (C) DNA in SupT1 cells infected with one of the four viral types. Data on the left were normalized to peak DNA production for BH10 in the absence of hA3G. Bars: a, BH10 and pcDNA3.1; b, BH10Vif- and pcDNA3.1; c, BH10 and hA3G; d, BH10Vif- and hA3G.
    Figure Legend Snippet: Real-time PCR quantitation of newly synthesized HIV-1 DNA. DNA was extracted at different times postinfection from SupT1 cells infected with the four viral types: BH10, plus or minus hA3G, and BH10Vif-, plus or minus hA3G. Early (R-U5) and late (U5-gag) minus-strand cDNA production was monitored by real-time PCR, as described in Materials and Methods. (A) Arrows indicate the PCR primers used to detect early (U5a-R) and late (gag-U5b) minus-strand DNA. (B and C) Graphs on the right show the postinfection time course of production of viral early (B) and late (C) DNA in SupT1 cells infected with one of the four viral types. Data on the left were normalized to peak DNA production for BH10 in the absence of hA3G. Bars: a, BH10 and pcDNA3.1; b, BH10Vif- and pcDNA3.1; c, BH10 and hA3G; d, BH10Vif- and hA3G.

    Techniques Used: Real-time Polymerase Chain Reaction, Quantitation Assay, Synthesized, Infection, Polymerase Chain Reaction

    45) Product Images from "Deletion of Nonstructural Proteins NS1 and NS2 from Pneumonia Virus of Mice Attenuates Viral Replication and Reduces Pulmonary Cytokine Expression and Disease ▿"

    Article Title: Deletion of Nonstructural Proteins NS1 and NS2 from Pneumonia Virus of Mice Attenuates Viral Replication and Reduces Pulmonary Cytokine Expression and Disease ▿

    Journal:

    doi: 10.1128/JVI.02041-08

    Immunohistology for PVM antigens. Lungs of mice infected with rPVM, ΔNS1, ΔNS2, or ΔNS12 were harvested on day 6 postinfection and were formalin fixed. Paraffin sections were stained with hematoxylin-eosin and antibody specific
    Figure Legend Snippet: Immunohistology for PVM antigens. Lungs of mice infected with rPVM, ΔNS1, ΔNS2, or ΔNS12 were harvested on day 6 postinfection and were formalin fixed. Paraffin sections were stained with hematoxylin-eosin and antibody specific

    Techniques Used: Mouse Assay, Infection, Staining

    46) Product Images from "Inhibition of Indoleamine-2,3-dioxygenase (IDO) in Glioblastoma Cells by Oncolytic Herpes Simplex Virus"

    Article Title: Inhibition of Indoleamine-2,3-dioxygenase (IDO) in Glioblastoma Cells by Oncolytic Herpes Simplex Virus

    Journal: Advances in Virology

    doi: 10.1155/2012/815465

    JD0G infection of glioblastoma cells results in efficient virus replication and tumor-selective cell death. (a) The replication of JD0G was evaluated in comparison to KOS and MGH2. HEL, U251, and SNB19 cell lines were infected in parallel with KOS, MGH2, or JD0G at an MOI of 0.1 based on U2OS titers. Supernatants were collected at 24 hpi, and the amount of virus produced was assessed by titration on U2OS cells. The data represent the average of three independent infections, and error bars represent the standard deviation. For all three viruses the differences in virus yield observed between HEL cells and either glioma cell line are statistically significant as determined by the student t -test ( P values less than 0.03). (b) Tumor-specific cell death was assessed by counting the number of surviving cells following infection with either JD0G or MGH2 virus. HEL, U251 or SNB19 cells were infected at an MOI of 0.1, and Trypan Blue staining was performed to count the number of viable cells 48 h postinfection. The data represent the average of three independent infections, and error bars represent the standard deviation. All differences are statistically significant ( P values less than 0.01).
    Figure Legend Snippet: JD0G infection of glioblastoma cells results in efficient virus replication and tumor-selective cell death. (a) The replication of JD0G was evaluated in comparison to KOS and MGH2. HEL, U251, and SNB19 cell lines were infected in parallel with KOS, MGH2, or JD0G at an MOI of 0.1 based on U2OS titers. Supernatants were collected at 24 hpi, and the amount of virus produced was assessed by titration on U2OS cells. The data represent the average of three independent infections, and error bars represent the standard deviation. For all three viruses the differences in virus yield observed between HEL cells and either glioma cell line are statistically significant as determined by the student t -test ( P values less than 0.03). (b) Tumor-specific cell death was assessed by counting the number of surviving cells following infection with either JD0G or MGH2 virus. HEL, U251 or SNB19 cells were infected at an MOI of 0.1, and Trypan Blue staining was performed to count the number of viable cells 48 h postinfection. The data represent the average of three independent infections, and error bars represent the standard deviation. All differences are statistically significant ( P values less than 0.01).

    Techniques Used: Infection, Produced, Titration, Standard Deviation, Staining

    47) Product Images from "Vaccination with Adjuvanted Recombinant Neuraminidase Induces Broad Heterologous, but Not Heterosubtypic, Cross-Protection against Influenza Virus Infection in Mice"

    Article Title: Vaccination with Adjuvanted Recombinant Neuraminidase Induces Broad Heterologous, but Not Heterosubtypic, Cross-Protection against Influenza Virus Infection in Mice

    Journal: mBio

    doi: 10.1128/mBio.02556-14

    Vaccination with recombinant N1 protects mice from homologous and heterologous viral challenge. (A to C) Six- to 8-week-old naive BALB/c mice ( n = 5 for PR8 N1 group and N2 control group; n = 10 for negative-control group and positive-control groups) were primed and boosted with 10 µg rNA from PR8 (5 µg delivered i.m. and 5 µg delivered i.n.) adjuvanted with poly(I ⋅ C). Negative-control mice were primed and boosted with 10 µg BSA (5 µg delivered i.m. and 5 µg delivered i.n.) adjuvanted with poly(I ⋅ C). Positive-control mice received a 1-µg i.m. prime and boost of a formalin-inactivated, unadjuvanted virus matching the challenge strain. Additionally, one experimental group was primed and boosted with rN2 in a fashion identical to the method used for the N1-vaccinated mice. Upon challenge, weight loss was monitored for 14 days postinfection as a measure of morbidity. Graphs plot the average amounts of weight loss as percentages of initial weight with standard deviation (SD). (D to F) Survival curves from the challenge experiments whose results are shown in panels A to C. (G to I) Pooled sera from individual mice (PR8 N1 vaccinated, rN2 vaccinated, or naive) in each experimental group were tested in triplicate for reactivity to purified virus via ELISA. (J to L) The same sera used in the experiment whose results are shown in panels G to I were tested in triplicate for NI activity against the respective challenge viruses. *, positive-control data shown in panels C and F were collected from the high-challenge-dose group (10 mLD 50 ). n = 5 mice per group unless otherwise stated.
    Figure Legend Snippet: Vaccination with recombinant N1 protects mice from homologous and heterologous viral challenge. (A to C) Six- to 8-week-old naive BALB/c mice ( n = 5 for PR8 N1 group and N2 control group; n = 10 for negative-control group and positive-control groups) were primed and boosted with 10 µg rNA from PR8 (5 µg delivered i.m. and 5 µg delivered i.n.) adjuvanted with poly(I ⋅ C). Negative-control mice were primed and boosted with 10 µg BSA (5 µg delivered i.m. and 5 µg delivered i.n.) adjuvanted with poly(I ⋅ C). Positive-control mice received a 1-µg i.m. prime and boost of a formalin-inactivated, unadjuvanted virus matching the challenge strain. Additionally, one experimental group was primed and boosted with rN2 in a fashion identical to the method used for the N1-vaccinated mice. Upon challenge, weight loss was monitored for 14 days postinfection as a measure of morbidity. Graphs plot the average amounts of weight loss as percentages of initial weight with standard deviation (SD). (D to F) Survival curves from the challenge experiments whose results are shown in panels A to C. (G to I) Pooled sera from individual mice (PR8 N1 vaccinated, rN2 vaccinated, or naive) in each experimental group were tested in triplicate for reactivity to purified virus via ELISA. (J to L) The same sera used in the experiment whose results are shown in panels G to I were tested in triplicate for NI activity against the respective challenge viruses. *, positive-control data shown in panels C and F were collected from the high-challenge-dose group (10 mLD 50 ). n = 5 mice per group unless otherwise stated.

    Techniques Used: Recombinant, Mouse Assay, Negative Control, Positive Control, Standard Deviation, Purification, Enzyme-linked Immunosorbent Assay, Activity Assay

    48) Product Images from "Enterohemorrhagic Escherichia coli Specific Enterohemolysin Induced IL-1? in Human Macrophages and EHEC-Induced IL-1? Required Activation of NLRP3 Inflammasome"

    Article Title: Enterohemorrhagic Escherichia coli Specific Enterohemolysin Induced IL-1? in Human Macrophages and EHEC-Induced IL-1? Required Activation of NLRP3 Inflammasome

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050288

    Expression of inflammasome components in differentiated THP-1 cells. Differentiated THP-1 cells were left untreated or were infected with EDL933 or Δ ehxA . They were then lysed over 4 h postinfection. mRNA expression of selected genes was analyzed using RT-PCR.
    Figure Legend Snippet: Expression of inflammasome components in differentiated THP-1 cells. Differentiated THP-1 cells were left untreated or were infected with EDL933 or Δ ehxA . They were then lysed over 4 h postinfection. mRNA expression of selected genes was analyzed using RT-PCR.

    Techniques Used: Expressing, Infection, Reverse Transcription Polymerase Chain Reaction

    49) Product Images from "Murine AKAP7 Has a 2′,5′-Phosphodiesterase Domain That Can Complement an Inactive Murine Coronavirus ns2 Gene"

    Article Title: Murine AKAP7 Has a 2′,5′-Phosphodiesterase Domain That Can Complement an Inactive Murine Coronavirus ns2 Gene

    Journal: mBio

    doi: 10.1128/mBio.01312-14

    Expression of the N-terminal truncation or the CD of AKAP7 restores the replication of mutant ns2 in vitro and in vivo . Growth kinetics of chimeric AKAP7 viruses were determined on BMM from B6 mice (A) and Rnasel −/− mice (B). BMM were infected with each virus (as indicated) at an MOI of 1. Samples of the cultured supernatant were taken at the indicated time points, and viral titers were determined by plaque assays. The data are from one representative experiment of at least two, each performed in triplicate. (C) AKAP7 CD and N-terminally truncated proteins inhibit rRNA degradation during viral infection. B6 BMM were infected (MOI of 1) and harvested at 10 h postinfection, and the integrity of total cellular RNA was analyzed on RNA chips (Agilent). (D and E) Four-week-old B6 or Rnasel −/− mice were infected with 2,000 PFU/mouse intrahepatically with A59 and ns2 H126R (D) or ns2 H126R AKAP7 CD and the double mutant ns2 H126R AKAP7 CD H185R (E). At day 5 postinfection, mice were sacrificed, and viral titers in the liver were determined by plaque assays. The dashed line represents the limit of detection, and error bars represent standard errors of means ( n = 5). Asterisks indicate that differences are statistically significant (**, P
    Figure Legend Snippet: Expression of the N-terminal truncation or the CD of AKAP7 restores the replication of mutant ns2 in vitro and in vivo . Growth kinetics of chimeric AKAP7 viruses were determined on BMM from B6 mice (A) and Rnasel −/− mice (B). BMM were infected with each virus (as indicated) at an MOI of 1. Samples of the cultured supernatant were taken at the indicated time points, and viral titers were determined by plaque assays. The data are from one representative experiment of at least two, each performed in triplicate. (C) AKAP7 CD and N-terminally truncated proteins inhibit rRNA degradation during viral infection. B6 BMM were infected (MOI of 1) and harvested at 10 h postinfection, and the integrity of total cellular RNA was analyzed on RNA chips (Agilent). (D and E) Four-week-old B6 or Rnasel −/− mice were infected with 2,000 PFU/mouse intrahepatically with A59 and ns2 H126R (D) or ns2 H126R AKAP7 CD and the double mutant ns2 H126R AKAP7 CD H185R (E). At day 5 postinfection, mice were sacrificed, and viral titers in the liver were determined by plaque assays. The dashed line represents the limit of detection, and error bars represent standard errors of means ( n = 5). Asterisks indicate that differences are statistically significant (**, P

    Techniques Used: Expressing, Mutagenesis, In Vitro, In Vivo, Mouse Assay, Infection, Cell Culture

    50) Product Images from "Histone Deacetylase Inhibitors Induce Reactivation of Herpes Simplex Virus Type 1 in a Latency-Associated Transcript (LAT)-Independent Manner in Neuronal Cells"

    Article Title: Histone Deacetylase Inhibitors Induce Reactivation of Herpes Simplex Virus Type 1 in a Latency-Associated Transcript (LAT)-Independent Manner in Neuronal Cells

    Journal: Journal of neurovirology

    doi: 10.1080/13550280590952817

    Reactivation of dLAT2903 and McKrae from QIF-PC12 cells is similar. Cells were grown in duplicate 12-well plates per treatment group, neuronally differentiated with NGF, and infected with the indicated strain at an MOI of 5. On day 17 postinfection, cultures
    Figure Legend Snippet: Reactivation of dLAT2903 and McKrae from QIF-PC12 cells is similar. Cells were grown in duplicate 12-well plates per treatment group, neuronally differentiated with NGF, and infected with the indicated strain at an MOI of 5. On day 17 postinfection, cultures

    Techniques Used: Infection

    51) Product Images from "The impact of α-toxin on host cell plasma membrane permeability and cytokine expression during human blood infection by CA-MRSA USA300"

    Article Title: The impact of α-toxin on host cell plasma membrane permeability and cytokine expression during human blood infection by CA-MRSA USA300

    Journal: Journal of Leukocyte Biology

    doi: 10.1189/jlb.0213080

    The influence of Hla on cytokine expression following infection of human blood with USA300. (A) Concentrations of IL-1β and IL-8, as determined by ELISA at 5 h postinfection of human blood with 1 × 10 5 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), DPBS control, or USA300 incubated at ≥98°C for 20 min prior to infection (Heat tx). (B) CBA analysis of IL-6, IL-10, TNF-α, IFN-γ, IL-17A, IL-12p70, IL-2, and IL-4 expression in human blood at 5 h postinfection with 1 × 10 5 CFU/mL USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent at least four separate experiments using at least three different blood donors, with * P ≤ 0.05, ** P ≤ 0.01, and *** P ≤ 0.001, as determined by one-way repeated-measures ANOVA with Tukey's post-test relative to samples infected with USA300.
    Figure Legend Snippet: The influence of Hla on cytokine expression following infection of human blood with USA300. (A) Concentrations of IL-1β and IL-8, as determined by ELISA at 5 h postinfection of human blood with 1 × 10 5 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), DPBS control, or USA300 incubated at ≥98°C for 20 min prior to infection (Heat tx). (B) CBA analysis of IL-6, IL-10, TNF-α, IFN-γ, IL-17A, IL-12p70, IL-2, and IL-4 expression in human blood at 5 h postinfection with 1 × 10 5 CFU/mL USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent at least four separate experiments using at least three different blood donors, with * P ≤ 0.05, ** P ≤ 0.01, and *** P ≤ 0.001, as determined by one-way repeated-measures ANOVA with Tukey's post-test relative to samples infected with USA300.

    Techniques Used: Expressing, Infection, Enzyme-linked Immunosorbent Assay, Incubation, Crocin Bleaching Assay

    Flow cytometry analysis of PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood with USA300, USA300Δhla, USA300Δhla Comp, or DPBS control. (A) Representative flow cytometry histograms for PI-stained human PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection with USA300 (dark, solid lines) relative to the uninfected DPBS control (shaded gray areas) at 3 h postinfection with 1 × 10 6 CFU/mL human blood. (B) Geometric mean PI + signal of PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection of human blood with 1 × 10 6 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), or uninfected DPBS control. Data represent four separate experiments using at least three different blood donors, with * P ≤ 0.05, as determined by paired two-tailed t -test relative to samples infected with USA300.
    Figure Legend Snippet: Flow cytometry analysis of PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood with USA300, USA300Δhla, USA300Δhla Comp, or DPBS control. (A) Representative flow cytometry histograms for PI-stained human PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection with USA300 (dark, solid lines) relative to the uninfected DPBS control (shaded gray areas) at 3 h postinfection with 1 × 10 6 CFU/mL human blood. (B) Geometric mean PI + signal of PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection of human blood with 1 × 10 6 CFU/mL USA300, USA300Δ hla (Δ hla ), USA300Δ hla Comp (Comp), or uninfected DPBS control. Data represent four separate experiments using at least three different blood donors, with * P ≤ 0.05, as determined by paired two-tailed t -test relative to samples infected with USA300.

    Techniques Used: Flow Cytometry, Cytometry, Infection, Staining, Two Tailed Test

    The association of USA300 with PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood. (A) Representative flow cytometry histograms of PMNs, CD3 + lymphocyte, and CD14 + monocyte cells at 3 h postinfection with FITC-labeled USA300 (solid lines) relative to a DPBS control (shaded areas), with the percentage of FITC + human cells indicated. (B) Compiled results illustrating the percentage of FITC + PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection with 1 × 10 6 CFU/mL FITC-labeled USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent five separate experiments using at least three different blood donors, with ** P ≤ 0.01, and *** P ≤ 0.001, as determined by paired two-tailed t -test relative to samples infected with USA300.
    Figure Legend Snippet: The association of USA300 with PMN, CD3 + lymphocyte, and CD14 + monocyte cells following infection of human blood. (A) Representative flow cytometry histograms of PMNs, CD3 + lymphocyte, and CD14 + monocyte cells at 3 h postinfection with FITC-labeled USA300 (solid lines) relative to a DPBS control (shaded areas), with the percentage of FITC + human cells indicated. (B) Compiled results illustrating the percentage of FITC + PMN, CD3 + lymphocyte, and CD14 + monocyte cells at 1 h and 3 h postinfection with 1 × 10 6 CFU/mL FITC-labeled USA300, USA300Δ hla , USA300Δ hla Comp, or DPBS control. Data represent five separate experiments using at least three different blood donors, with ** P ≤ 0.01, and *** P ≤ 0.001, as determined by paired two-tailed t -test relative to samples infected with USA300.

    Techniques Used: Infection, Flow Cytometry, Cytometry, Labeling, Two Tailed Test

    Hla expression modulates proinflammatory cytokine transcript abundance during USA300 infection of human blood. Cytokine transcription profiles at 3 h postinfection of human blood with 1 × 10 5 CFU/mL USA300 or USA300Δ hla relative to DPBS mock-infected blood. Only genes that exhibited at least a twofold change in transcript abundance and a P value
    Figure Legend Snippet: Hla expression modulates proinflammatory cytokine transcript abundance during USA300 infection of human blood. Cytokine transcription profiles at 3 h postinfection of human blood with 1 × 10 5 CFU/mL USA300 or USA300Δ hla relative to DPBS mock-infected blood. Only genes that exhibited at least a twofold change in transcript abundance and a P value

    Techniques Used: Expressing, Infection

    52) Product Images from "Expression of Simian Immunodeficiency Virus (SIV) Nef in Astrocytes during Acute and Terminal Infection and Requirement of Nef for Optimal Replication of Neurovirulent SIV In Vitro"

    Article Title: Expression of Simian Immunodeficiency Virus (SIV) Nef in Astrocytes during Acute and Terminal Infection and Requirement of Nef for Optimal Replication of Neurovirulent SIV In Vitro

    Journal: Journal of Virology

    doi: 10.1128/JVI.77.12.6855-6866.2003

    AOP-RANTES blocks SIV infection of primary rhesus astrocytes. Astrocytes were incubated with or without 500 ng of AOP-RANTES per ml for 1 h prior to infection with SIV/17E-Br or SIV/17E-Fr [input virus normalized by TCID 50 (multiplicity of infection = 0.1)], and supernatants were sampled at various times postinfection (PI) and assayed for the presence of SIV p27. Data are representative of several independent experiments.
    Figure Legend Snippet: AOP-RANTES blocks SIV infection of primary rhesus astrocytes. Astrocytes were incubated with or without 500 ng of AOP-RANTES per ml for 1 h prior to infection with SIV/17E-Br or SIV/17E-Fr [input virus normalized by TCID 50 (multiplicity of infection = 0.1)], and supernatants were sampled at various times postinfection (PI) and assayed for the presence of SIV p27. Data are representative of several independent experiments.

    Techniques Used: Infection, Incubation

    SIV infection of primary rhesus astrocytes. Astrocyte cultures were inoculated with SIV/17E-Br, SIV/17E-Fr, and SIV mac 239 normalized by TCID 50 (multiplicity of infection = 0.1) and allowed to incubate for 6 h before the cells were washed extensively, and replication was monitored over time postinfection (PI) for the presence of SIV p27. Results shown are representative of several independent experiments.
    Figure Legend Snippet: SIV infection of primary rhesus astrocytes. Astrocyte cultures were inoculated with SIV/17E-Br, SIV/17E-Fr, and SIV mac 239 normalized by TCID 50 (multiplicity of infection = 0.1) and allowed to incubate for 6 h before the cells were washed extensively, and replication was monitored over time postinfection (PI) for the presence of SIV p27. Results shown are representative of several independent experiments.

    Techniques Used: Infection

    53) Product Images from "Role of the VP16-Binding Domain of vhs in Viral Growth, Host Shutoff Activity, and Pathogenesis"

    Article Title: Role of the VP16-Binding Domain of vhs in Viral Growth, Host Shutoff Activity, and Pathogenesis

    Journal: Journal of Virology

    doi: 10.1128/JVI.78.24.13562-13572.2004

    Western blot of infected-cell lysates and gradient-purified virus particles. (A) Vero cells were infected with KOS, dl41, Δ20, or Δ20R at an MOI of 20 and harvested at 16 h postinfection. Western blots were probed with an antibody to vhs, VP16, or VP5. The asterisk indicates the specific protein in each blot. (B) Viral particles were purified over a 10 to 30% dextran gradient, and peak fractions of infectious virus were run on an SDS-10% polyacrylamide gel. Western blots were probed with antibodies to vhs or VP5.
    Figure Legend Snippet: Western blot of infected-cell lysates and gradient-purified virus particles. (A) Vero cells were infected with KOS, dl41, Δ20, or Δ20R at an MOI of 20 and harvested at 16 h postinfection. Western blots were probed with an antibody to vhs, VP16, or VP5. The asterisk indicates the specific protein in each blot. (B) Viral particles were purified over a 10 to 30% dextran gradient, and peak fractions of infectious virus were run on an SDS-10% polyacrylamide gel. Western blots were probed with antibodies to vhs or VP5.

    Techniques Used: Western Blot, Infection, Purification

    RNA degradation assay by Northern blot analysis. (A) Vero cells were mock infected or infected with KOS, UL41NHB, Δ20, and Δ20R in the presence or absence of actinomycin D (10 mg/ml). Cytoplasmic mRNA was extracted at 4 and 8 h postinfection. Panel A shows a representative Northern blot probed for GAPDH (top) and then stripped and reprobed for 28S rRNA (bottom). (B) A graphical representation of the Northern blot data in the presence and absence of actinomycin D at 4 h postinfection and (C) 12 h postinfection. All data were normalized to the lowest value of the 28S rRNA.
    Figure Legend Snippet: RNA degradation assay by Northern blot analysis. (A) Vero cells were mock infected or infected with KOS, UL41NHB, Δ20, and Δ20R in the presence or absence of actinomycin D (10 mg/ml). Cytoplasmic mRNA was extracted at 4 and 8 h postinfection. Panel A shows a representative Northern blot probed for GAPDH (top) and then stripped and reprobed for 28S rRNA (bottom). (B) A graphical representation of the Northern blot data in the presence and absence of actinomycin D at 4 h postinfection and (C) 12 h postinfection. All data were normalized to the lowest value of the 28S rRNA.

    Techniques Used: Degradation Assay, Northern Blot, Infection

    Acute replication in murine corneas and trigeminal ganglia following corneal inoculation with 2 × 10 6 PFU of virus per eye. (A) Mice were infected with KOS, UL41NHB, Δ20, or Δ20R, and eyeswabs were taken on days 2, 3, 4, and 5 postinfection. (B) Trigeminal ganglia were harvested on days 3 and 5 postinfection. Data represent the logarithmic mean for four to six eyes or trigeminal ganglia per virus per day. (C) Mice were inoculated with 2 × 10 5 PFU of virus intracerebrally (KOS, UL41NHB, Δ20, or Δ20R). Brains were harvested on days 1, 2, 3, 4, and 5 postinfection. All samples were normalized per gram weight of tissue. Data represent the logarithmic mean for two to four brains per virus per day. (D) Survival of mice following intracerebral injection of 10 5 PFU of KOS, UL41NHB, Δ20, or Δ20R.
    Figure Legend Snippet: Acute replication in murine corneas and trigeminal ganglia following corneal inoculation with 2 × 10 6 PFU of virus per eye. (A) Mice were infected with KOS, UL41NHB, Δ20, or Δ20R, and eyeswabs were taken on days 2, 3, 4, and 5 postinfection. (B) Trigeminal ganglia were harvested on days 3 and 5 postinfection. Data represent the logarithmic mean for four to six eyes or trigeminal ganglia per virus per day. (C) Mice were inoculated with 2 × 10 5 PFU of virus intracerebrally (KOS, UL41NHB, Δ20, or Δ20R). Brains were harvested on days 1, 2, 3, 4, and 5 postinfection. All samples were normalized per gram weight of tissue. Data represent the logarithmic mean for two to four brains per virus per day. (D) Survival of mice following intracerebral injection of 10 5 PFU of KOS, UL41NHB, Δ20, or Δ20R.

    Techniques Used: Mouse Assay, Infection, Injection

    Multiple-step growth assay of KOS, UL41NHB, Δ20, and Δ20R in Vero cells at an MOI of 0.01. Time points were 4, 8, 12, 20, 24, and 30 h postinfection. The graph represents the combined data from two independent experiments.
    Figure Legend Snippet: Multiple-step growth assay of KOS, UL41NHB, Δ20, and Δ20R in Vero cells at an MOI of 0.01. Time points were 4, 8, 12, 20, 24, and 30 h postinfection. The graph represents the combined data from two independent experiments.

    Techniques Used: Growth Assay

    54) Product Images from "mRNA Cap Methylation Influences Pathogenesis of Vesicular Stomatitis Virus In Vivo"

    Article Title: mRNA Cap Methylation Influences Pathogenesis of Vesicular Stomatitis Virus In Vivo

    Journal: Journal of Virology

    doi: 10.1128/JVI.03420-13

    Quantification of IFN-β mRNA by real-time RT-PCR. Mice were infected with rVSV, rVSV-G4A, rVSV-K1651A, and rVSV-G1670A at dose of 5 × 10 6 PFU/mouse. At days 3 postinfection, lung and brain tissues were collected. Total RNA was extracted
    Figure Legend Snippet: Quantification of IFN-β mRNA by real-time RT-PCR. Mice were infected with rVSV, rVSV-G4A, rVSV-K1651A, and rVSV-G1670A at dose of 5 × 10 6 PFU/mouse. At days 3 postinfection, lung and brain tissues were collected. Total RNA was extracted

    Techniques Used: Quantitative RT-PCR, Mouse Assay, Infection

    55) Product Images from "Mutations in the Basic Region of the Mason-Pfizer Monkey Virus Nucleocapsid Protein Affect Reverse Transcription, Genomic RNA Packaging, and the Virus Assembly Site"

    Article Title: Mutations in the Basic Region of the Mason-Pfizer Monkey Virus Nucleocapsid Protein Affect Reverse Transcription, Genomic RNA Packaging, and the Virus Assembly Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.00106-18

    Reverse transcription of the mutants in a late phase using a gag -specific primer (A) and comparison of reverse transcriptase activities for all mutants (B). (A) For monitoring of reverse transcription, HEK 293 cells were harvested at 2, 6, 12, 24, and 48 h postinfection. Real-time PCR analysis of isolated DNA was used to detect reverse transcription products. The results were normalized for CA content by using an ELISA and housekeeping genes (only PLA is shown here). The P value corresponding to the F statistic of one-way analysis of variance is
    Figure Legend Snippet: Reverse transcription of the mutants in a late phase using a gag -specific primer (A) and comparison of reverse transcriptase activities for all mutants (B). (A) For monitoring of reverse transcription, HEK 293 cells were harvested at 2, 6, 12, 24, and 48 h postinfection. Real-time PCR analysis of isolated DNA was used to detect reverse transcription products. The results were normalized for CA content by using an ELISA and housekeeping genes (only PLA is shown here). The P value corresponding to the F statistic of one-way analysis of variance is

    Techniques Used: Real-time Polymerase Chain Reaction, Isolation, Enzyme-linked Immunosorbent Assay, Proximity Ligation Assay

    56) Product Images from "Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens"

    Article Title: Functional inhibition of acid sphingomyelinase disrupts infection by intracellular bacterial pathogens

    Journal: Life Science Alliance

    doi: 10.26508/lsa.201800292

    Functional inhibition of ASM halts ApV maturation and expansion. (A, B, D, E) Desipramine was added to RF/6A cells before infection with A. phagocytophilum and treatment was either maintained throughout the time course (A, B, D) or removed at 20 h (B, E). (C, F) Desipramine was added to A. phagocytophilum –infected RF/6A cells beginning at 20 h (C, F). DMSO served as vehicle control. At 20, 24, 28, and 32 h, the cells were fixed and examined by confocal microscopy for ApV maturation (A–C) and expansion (D–F). (A–C) Desipramine reversibly inhibits APH0032 expression and localization to the ApV. A. phagocytophilum –infected RF/6A cells were screened with antibodies targeting vimentin and APH0032 to demarcate and assess maturation of the ApV, respectively. DAPI was used to stain host cell nuclei and bacterial DNA. (A) Representative confocal micrographs of desipramine or DMSO-treated cells at the indicated postinfection time points. (B, C) Percentages of APH0032-positive ApVs determined for 100 cells for each of three biological replicates per condition. (D–F) Desipramine reversibly inhibits ApV expansion. The mean ApV pixel area was determined for 50 ApVs per time point per condition. Error bars indicate SD. t test was used to test for a significant difference among pairs. Statistically significant ( *P
    Figure Legend Snippet: Functional inhibition of ASM halts ApV maturation and expansion. (A, B, D, E) Desipramine was added to RF/6A cells before infection with A. phagocytophilum and treatment was either maintained throughout the time course (A, B, D) or removed at 20 h (B, E). (C, F) Desipramine was added to A. phagocytophilum –infected RF/6A cells beginning at 20 h (C, F). DMSO served as vehicle control. At 20, 24, 28, and 32 h, the cells were fixed and examined by confocal microscopy for ApV maturation (A–C) and expansion (D–F). (A–C) Desipramine reversibly inhibits APH0032 expression and localization to the ApV. A. phagocytophilum –infected RF/6A cells were screened with antibodies targeting vimentin and APH0032 to demarcate and assess maturation of the ApV, respectively. DAPI was used to stain host cell nuclei and bacterial DNA. (A) Representative confocal micrographs of desipramine or DMSO-treated cells at the indicated postinfection time points. (B, C) Percentages of APH0032-positive ApVs determined for 100 cells for each of three biological replicates per condition. (D–F) Desipramine reversibly inhibits ApV expansion. The mean ApV pixel area was determined for 50 ApVs per time point per condition. Error bars indicate SD. t test was used to test for a significant difference among pairs. Statistically significant ( *P

    Techniques Used: Functional Assay, Inhibition, Infection, Confocal Microscopy, Expressing, Staining

    ASM is essential for A. phagocytophilum to productively infect mice. ( A ) A. phagocytophilum fails to productively infect ASM −/− mice. (A) ASMase −/− mice or WT mice were infected with A. phagocytophilum DC organisms. Peripheral blood drawn on days 4, 8, 12, 16, 21, and 28 d postinfection was analyzed by qPCR. Relative levels of the A. phagocytophilum 16S rRNA gene were normalized to those of β -actin using the 2 −ΔΔCT method. (B) Desipramine reduces the A. phagocytophilum DNA load in the peripheral blood when administered to infected mice. A. phagocytophilum –infected WT mice were administered desipramine or PBS on days 7 through 12 postinfection, and the bacterial DNA load in the peripheral blood was determined using qPCR. Error bars indicate SD. t test was used to test for a significant difference among pairs. Statistically significant ( **P
    Figure Legend Snippet: ASM is essential for A. phagocytophilum to productively infect mice. ( A ) A. phagocytophilum fails to productively infect ASM −/− mice. (A) ASMase −/− mice or WT mice were infected with A. phagocytophilum DC organisms. Peripheral blood drawn on days 4, 8, 12, 16, 21, and 28 d postinfection was analyzed by qPCR. Relative levels of the A. phagocytophilum 16S rRNA gene were normalized to those of β -actin using the 2 −ΔΔCT method. (B) Desipramine reduces the A. phagocytophilum DNA load in the peripheral blood when administered to infected mice. A. phagocytophilum –infected WT mice were administered desipramine or PBS on days 7 through 12 postinfection, and the bacterial DNA load in the peripheral blood was determined using qPCR. Error bars indicate SD. t test was used to test for a significant difference among pairs. Statistically significant ( **P

    Techniques Used: Mouse Assay, Infection, Real-time Polymerase Chain Reaction

    Desipramine-induced cholesterol accumulation in the C. burnetii vacuole is bactericidal. (A, B) mCherry- C. burnetii (Cb)–infected THP-1 macrophage-like cells (A) or mCherry- C. burnetii grown in axenic medium (B) were treated with desipramine or not treated with. The bacterial load was measured as relative fluorescent units. (C–E) C. burnetii was added to HeLa cells (C, E) or MH-S cells (D) that had been pretreated with desipramine or DMSO, or C. burnetii –infected cells were treated at the indicated days postinfection (E). Bacterial load was measured using a CFU assay. (F) CCV area was determined for desipramine and DMSO-treated C. burnetii –infected HeLa cells. (G) HeLa cells that had been treated with desipramine and infected with mCherry- C. burnetii were labeled with filipin and CD63 antibody. Error bars indicate SD. t test was used to test for a significant difference among pairs. Statistically significant ( **P
    Figure Legend Snippet: Desipramine-induced cholesterol accumulation in the C. burnetii vacuole is bactericidal. (A, B) mCherry- C. burnetii (Cb)–infected THP-1 macrophage-like cells (A) or mCherry- C. burnetii grown in axenic medium (B) were treated with desipramine or not treated with. The bacterial load was measured as relative fluorescent units. (C–E) C. burnetii was added to HeLa cells (C, E) or MH-S cells (D) that had been pretreated with desipramine or DMSO, or C. burnetii –infected cells were treated at the indicated days postinfection (E). Bacterial load was measured using a CFU assay. (F) CCV area was determined for desipramine and DMSO-treated C. burnetii –infected HeLa cells. (G) HeLa cells that had been treated with desipramine and infected with mCherry- C. burnetii were labeled with filipin and CD63 antibody. Error bars indicate SD. t test was used to test for a significant difference among pairs. Statistically significant ( **P

    Techniques Used: Infection, Colony-forming Unit Assay, Labeling

    57) Product Images from "Trapping the Enemy: Vermamoeba vermiformis Circumvents Faustovirus Mariensis Dissemination by Enclosing Viral Progeny inside Cysts"

    Article Title: Trapping the Enemy: Vermamoeba vermiformis Circumvents Faustovirus Mariensis Dissemination by Enclosing Viral Progeny inside Cysts

    Journal: Journal of Virology

    doi: 10.1128/JVI.00312-19

    Faustovirus mariensis isolation sites, particle images, and cytopathic effects. (A) Pampulha Lagoon map with collection sites highlighted (dots). The yellow dot represents where F. mariensis was collected, in front of the Pampulha Art Museum (top right of photo). Map courtesy of Google Maps. (B to D) F. mariensis viral particles visualized by scanning (B and C) and transmission (D) electron microscopy. (E to G) Plaque-forming unit (PFU) induced by F. mariensis infection in a Vermamoeba vermiformis monolayer. (F) Closeup of a PFU shown in panel E, observed 24 h postinfection. (G) Forty-eight hours postinfection, the PFUs expand and coalesce.
    Figure Legend Snippet: Faustovirus mariensis isolation sites, particle images, and cytopathic effects. (A) Pampulha Lagoon map with collection sites highlighted (dots). The yellow dot represents where F. mariensis was collected, in front of the Pampulha Art Museum (top right of photo). Map courtesy of Google Maps. (B to D) F. mariensis viral particles visualized by scanning (B and C) and transmission (D) electron microscopy. (E to G) Plaque-forming unit (PFU) induced by F. mariensis infection in a Vermamoeba vermiformis monolayer. (F) Closeup of a PFU shown in panel E, observed 24 h postinfection. (G) Forty-eight hours postinfection, the PFUs expand and coalesce.

    Techniques Used: Isolation, Transmission Assay, Electron Microscopy, Infection

    Faustovirus mariensis is not able to circumvent Vermamoeba vermiformis encystment. (A) Scheme highlighting the experimental strategy and results of an experiment testing the ability of F. mariensis and Tupanvirus to circumvent V. vermiformis encystment. In I and III, the encystment solution Neff was added prior to virus inoculation. In II and IV, the viruses were inoculated before Neff addition. (B) F. mariensis and (C) Tupanvirus genome quantification, in supernatant and cysts, for each experimental scenario analyzed (I to IV), by qPCR. The relative quantification was performed with the Δ C T method, and results were presented as arbitrary units (log 10 ). (D) Quantification of the viability of cysts (0.4% trypan blue) produced from infections under different scenarios (I to IV). (E) Relative quantification of the expression of two serine proteinase mRNA isotypes present in V. vermiformis upon infection (MOI of 10) with F. mariensis or Tupanvirus or upon Neff treatment. The quantification was performed 5 h postinfection or after Neff inoculation. Error bars indicate SDs. The statistical significance was calculated using a two-tailed 2-way analysis of variance (ANOVA) test and Tukey’s range test, using GraphPad Prism. ***, P
    Figure Legend Snippet: Faustovirus mariensis is not able to circumvent Vermamoeba vermiformis encystment. (A) Scheme highlighting the experimental strategy and results of an experiment testing the ability of F. mariensis and Tupanvirus to circumvent V. vermiformis encystment. In I and III, the encystment solution Neff was added prior to virus inoculation. In II and IV, the viruses were inoculated before Neff addition. (B) F. mariensis and (C) Tupanvirus genome quantification, in supernatant and cysts, for each experimental scenario analyzed (I to IV), by qPCR. The relative quantification was performed with the Δ C T method, and results were presented as arbitrary units (log 10 ). (D) Quantification of the viability of cysts (0.4% trypan blue) produced from infections under different scenarios (I to IV). (E) Relative quantification of the expression of two serine proteinase mRNA isotypes present in V. vermiformis upon infection (MOI of 10) with F. mariensis or Tupanvirus or upon Neff treatment. The quantification was performed 5 h postinfection or after Neff inoculation. Error bars indicate SDs. The statistical significance was calculated using a two-tailed 2-way analysis of variance (ANOVA) test and Tukey’s range test, using GraphPad Prism. ***, P

    Techniques Used: Real-time Polymerase Chain Reaction, Produced, Expressing, Infection, Two Tailed Test

    58) Product Images from "Elevated Cholesterol in the Coxiella burnetii Intracellular Niche Is Bacteriolytic"

    Article Title: Elevated Cholesterol in the Coxiella burnetii Intracellular Niche Is Bacteriolytic

    Journal: mBio

    doi: 10.1128/mBio.02313-16

    Increasing cellular cholesterol leads to C. burnetii death . (A) Representative live-cell microscopy images of cholesterol-free MEFs and MEFs with cholesterol and infected with mCherry-expressing C. burnetii (mCherry- C. burnetii ). Note the presence of mCherry fluorescence in the PV lumen in MEFs with cholesterol. The white arrows point to the PVs. Bars = 10 µm. (B) Quantitation of lytic PVs containing degraded bacteria under different cholesterol conditions. At different times postinfection, PVs were observed by live-cell microscopy and scored as lytic if visible mCherry fluorescence was present in the lumen. The means ± SEM from three experiments are shown. The means were compared by one-way ANOVA with Tukey’s posthoc test. *, P
    Figure Legend Snippet: Increasing cellular cholesterol leads to C. burnetii death . (A) Representative live-cell microscopy images of cholesterol-free MEFs and MEFs with cholesterol and infected with mCherry-expressing C. burnetii (mCherry- C. burnetii ). Note the presence of mCherry fluorescence in the PV lumen in MEFs with cholesterol. The white arrows point to the PVs. Bars = 10 µm. (B) Quantitation of lytic PVs containing degraded bacteria under different cholesterol conditions. At different times postinfection, PVs were observed by live-cell microscopy and scored as lytic if visible mCherry fluorescence was present in the lumen. The means ± SEM from three experiments are shown. The means were compared by one-way ANOVA with Tukey’s posthoc test. *, P

    Techniques Used: Microscopy, Infection, Expressing, Fluorescence, Quantitation Assay

    Cholesterol accumulation in the PV increases PV acidity. PV pH was determined at 3 days postinfection using a ratiometric fluorescence assay of pH-sensitive Oregon Green dextran and pH-insensitive Alexa 647 dextran. (A) The pH in PVs from MEFs with cholesterol (average pH 4.5) was significantly more acidic than PVs from cholesterol-free MEFs (average pH 5.2). At least 10 PVs were measured in three separate experiments. The means ± SEM (error bars) from three individual experiments are shown. ****, P
    Figure Legend Snippet: Cholesterol accumulation in the PV increases PV acidity. PV pH was determined at 3 days postinfection using a ratiometric fluorescence assay of pH-sensitive Oregon Green dextran and pH-insensitive Alexa 647 dextran. (A) The pH in PVs from MEFs with cholesterol (average pH 4.5) was significantly more acidic than PVs from cholesterol-free MEFs (average pH 5.2). At least 10 PVs were measured in three separate experiments. The means ± SEM (error bars) from three individual experiments are shown. ****, P

    Techniques Used: Fluorescence

    C. burnetii growth is sensitive to cholesterol during early stages of PV biogenesis. (A) Final PV size after adding cholesterol at various times postinfection in MEFs. Cholesterol-free MEFs were infected with C. burnetii and different cholesterol concentrations were added to the cells each day from day 0 to 5. At day 6, cells were fixed and stained for the PV marker LAMP-1 and C. burnetii , and PV size was measured using ImageJ. At least 20 PVs were measured for each condition for three independent experiments. Each circle indicates the value for an individual PV. The means (black bars) ± SEM (error bars) from three individual experiments are shown. Statistical significance was determined by comparing values to the value with no cholesterol by one-way ANOVA with Dunnett’s posthoc test and indicated as follows: **, P
    Figure Legend Snippet: C. burnetii growth is sensitive to cholesterol during early stages of PV biogenesis. (A) Final PV size after adding cholesterol at various times postinfection in MEFs. Cholesterol-free MEFs were infected with C. burnetii and different cholesterol concentrations were added to the cells each day from day 0 to 5. At day 6, cells were fixed and stained for the PV marker LAMP-1 and C. burnetii , and PV size was measured using ImageJ. At least 20 PVs were measured for each condition for three independent experiments. Each circle indicates the value for an individual PV. The means (black bars) ± SEM (error bars) from three individual experiments are shown. Statistical significance was determined by comparing values to the value with no cholesterol by one-way ANOVA with Dunnett’s posthoc test and indicated as follows: **, P

    Techniques Used: Infection, Staining, Marker

    59) Product Images from "Variation in Inflammatory Response during Pneumococcal Infection Is Influenced by Host-Pathogen Interactions but Associated with Animal Survival"

    Article Title: Variation in Inflammatory Response during Pneumococcal Infection Is Influenced by Host-Pathogen Interactions but Associated with Animal Survival

    Journal: Infection and Immunity

    doi: 10.1128/IAI.01057-15

    Pneumococcal burdens in tested tissues. (A) Blood at 24 h postinfection (CFU per milliliter); (B) blood at the time of animal expiration (CFU per milliliter); (C) lung at the time of animal expiration (CFU per milligram). The pneumococcal serotypes are presented in parentheses together with the strain name ( x axis). Each experimental group consisted of 10 animals. The survival rate for each tested infection is presented at the top. For clarity, the presented statistics represent only the differences between mouse strains. *, P
    Figure Legend Snippet: Pneumococcal burdens in tested tissues. (A) Blood at 24 h postinfection (CFU per milliliter); (B) blood at the time of animal expiration (CFU per milliliter); (C) lung at the time of animal expiration (CFU per milligram). The pneumococcal serotypes are presented in parentheses together with the strain name ( x axis). Each experimental group consisted of 10 animals. The survival rate for each tested infection is presented at the top. For clarity, the presented statistics represent only the differences between mouse strains. *, P

    Techniques Used: Infection

    Association of mouse pulmonary inflammation with survival during pneumococcal infection. PCA plots were generated by using the cytokine concentrations measured at a single time point, 6 h (A) or 24 h (B) postinfection, or at both time points (C). The percentage of the variation captured by each PC is presented. Each data point represents one animal.
    Figure Legend Snippet: Association of mouse pulmonary inflammation with survival during pneumococcal infection. PCA plots were generated by using the cytokine concentrations measured at a single time point, 6 h (A) or 24 h (B) postinfection, or at both time points (C). The percentage of the variation captured by each PC is presented. Each data point represents one animal.

    Techniques Used: Infection, Generated

    60) Product Images from "Restriction of Equine Infectious Anemia Virus by Equine APOBEC3 Cytidine Deaminases ▿Restriction of Equine Infectious Anemia Virus by Equine APOBEC3 Cytidine Deaminases ▿ †"

    Article Title: Restriction of Equine Infectious Anemia Virus by Equine APOBEC3 Cytidine Deaminases ▿Restriction of Equine Infectious Anemia Virus by Equine APOBEC3 Cytidine Deaminases ▿ †

    Journal: Journal of Virology

    doi: 10.1128/JVI.00015-09

    Inhibition of EIAV by eqA3s is independent from dUTPase and S2. wt, ΔDU, and ΔS2 EIAV viruses were produced in the presence or absence of the indicated HA-tagged A3 expression vectors. Relative infectivity of equal amounts of the reporter viruses was determined by quantification of luciferase activity in CrFK cells (A) or EML-3C macrophage-like cells (B) at 3 days postinfection. cps, counts per second.
    Figure Legend Snippet: Inhibition of EIAV by eqA3s is independent from dUTPase and S2. wt, ΔDU, and ΔS2 EIAV viruses were produced in the presence or absence of the indicated HA-tagged A3 expression vectors. Relative infectivity of equal amounts of the reporter viruses was determined by quantification of luciferase activity in CrFK cells (A) or EML-3C macrophage-like cells (B) at 3 days postinfection. cps, counts per second.

    Techniques Used: Inhibition, Produced, Expressing, Infection, Luciferase, Activity Assay

    eqA3 triggers G-to-A hypermutation in a subpopulation of the EIAV-luc genomes. (A) EIAV vector sequences (880 nucleotides [nt] of the luciferase gene) amplified by PCR at 10 h postinfection from CrFK cells transduced by EIAV generated in the presence or absence of eqA3Z1b, eqA3Z2a-Z2b, eqA3Z2c-Z2d, eqA3Z2e, eqA3Z3, and eqA3Z3v1. The mutations of 10 individual clones of each group are shown. Each mutation is indicated and coded with respect to the nucleotide mutation. PCR was done at a denaturation temperature ( T d ) of either 95°C or of 88°C. (B) Comparison of the dinucleotide sequence context of G (underlined) →A mutations in the positive-strand DNA of EIAV-luc derived from eqA3-expressing 293T cells.
    Figure Legend Snippet: eqA3 triggers G-to-A hypermutation in a subpopulation of the EIAV-luc genomes. (A) EIAV vector sequences (880 nucleotides [nt] of the luciferase gene) amplified by PCR at 10 h postinfection from CrFK cells transduced by EIAV generated in the presence or absence of eqA3Z1b, eqA3Z2a-Z2b, eqA3Z2c-Z2d, eqA3Z2e, eqA3Z3, and eqA3Z3v1. The mutations of 10 individual clones of each group are shown. Each mutation is indicated and coded with respect to the nucleotide mutation. PCR was done at a denaturation temperature ( T d ) of either 95°C or of 88°C. (B) Comparison of the dinucleotide sequence context of G (underlined) →A mutations in the positive-strand DNA of EIAV-luc derived from eqA3-expressing 293T cells.

    Techniques Used: Plasmid Preparation, Luciferase, Amplification, Polymerase Chain Reaction, Generated, Clone Assay, Mutagenesis, Sequencing, Derivative Assay, Expressing

    Analysis of human A3F and A3G and eqA3Z3 active-site mutants for antiviral activity. (A) Different active-site mutants of human A3F and A3G and eqA3Z3 (A3Z3) were tested for antiviral activity against EIAV-luc produced in 293T cells by cotransfection with wt or mutant A3 expression plasmids. Transfection with pcDNA3.1 (vector) instead of the A3 expression plasmid was included as a control. CrFK target cells were infected with virus-containing supernatants normalized for RT, and luciferase was measured at 3 days postinfection. (B) Virions were generated by cotransfection of 293T cells with EIAV-luc and mutant HA-tagged eqA3 and human A3 expression plasmids or pcDNA3.1 (vector). A3 expression in transfected cells was detected by immunoblotting using anti-HA antibodies. Cell lysates were also analyzed for equal amounts of total proteins by using anti-tubulin antibody. Packaged A3s in virions normalized by RT activity were detected by probing with anti-HA antibody. Immunoblots of virions were also probed with anti-VSV-G antibody as a control for equal particle loading. α, anti.
    Figure Legend Snippet: Analysis of human A3F and A3G and eqA3Z3 active-site mutants for antiviral activity. (A) Different active-site mutants of human A3F and A3G and eqA3Z3 (A3Z3) were tested for antiviral activity against EIAV-luc produced in 293T cells by cotransfection with wt or mutant A3 expression plasmids. Transfection with pcDNA3.1 (vector) instead of the A3 expression plasmid was included as a control. CrFK target cells were infected with virus-containing supernatants normalized for RT, and luciferase was measured at 3 days postinfection. (B) Virions were generated by cotransfection of 293T cells with EIAV-luc and mutant HA-tagged eqA3 and human A3 expression plasmids or pcDNA3.1 (vector). A3 expression in transfected cells was detected by immunoblotting using anti-HA antibodies. Cell lysates were also analyzed for equal amounts of total proteins by using anti-tubulin antibody. Packaged A3s in virions normalized by RT activity were detected by probing with anti-HA antibody. Immunoblots of virions were also probed with anti-VSV-G antibody as a control for equal particle loading. α, anti.

    Techniques Used: Activity Assay, Produced, Cotransfection, Mutagenesis, Expressing, Transfection, Plasmid Preparation, Infection, Luciferase, Generated, Western Blot

    eqA3 proteins inhibit the infectivity of different viruses. (A) EIAV-luc (VSV-G pseudotyped) was produced in 293T cells in the presence or absence of the indicated equine and human A3s. Infectivity of the viruses was determined by quantification of luciferase activity in CrFK cells with equal amounts of viruses at 3 days postinfection. (B) SIV agm Δ vif viruses were produced in the presence or absence of the indicated A3 proteins. Infectivity of normalized amounts of viruses was determined by quantification of luciferase activity at 3 days postinfection. (C) AVV-2 viruses were generated by transfecting 293 cells in the presence or absence of the indicated A3 proteins. Antiviral activity of A3 proteins was determined by quantification of ß-galactosidase expression at 3 days postinfection. (D) Equine and human A3 proteins are packaged in EIAV virions. Virions were generated by cotransfection of 293T cells with EIAV-luc and HA- or V5-tagged equine and human A3 expression plasmids or pcDNA3.1 (vector). A3 expression in transfected cells was detected by immunoblotting using a mixture of anti-HA and anti-V5 antibodies. Cell lysates were also analyzed for equal amounts of total proteins by using anti-tubulin antibody. Packaged A3s in virions (normalized by RT activity) were detected by probing with anti-HA and anti-V5 antibody together on a parallel immunoblot. Immunoblots of virions were also probed with anti-VSV-G antibody as a control for the equal amounts of analyzed virions. cps, counts per second; α, anti.
    Figure Legend Snippet: eqA3 proteins inhibit the infectivity of different viruses. (A) EIAV-luc (VSV-G pseudotyped) was produced in 293T cells in the presence or absence of the indicated equine and human A3s. Infectivity of the viruses was determined by quantification of luciferase activity in CrFK cells with equal amounts of viruses at 3 days postinfection. (B) SIV agm Δ vif viruses were produced in the presence or absence of the indicated A3 proteins. Infectivity of normalized amounts of viruses was determined by quantification of luciferase activity at 3 days postinfection. (C) AVV-2 viruses were generated by transfecting 293 cells in the presence or absence of the indicated A3 proteins. Antiviral activity of A3 proteins was determined by quantification of ß-galactosidase expression at 3 days postinfection. (D) Equine and human A3 proteins are packaged in EIAV virions. Virions were generated by cotransfection of 293T cells with EIAV-luc and HA- or V5-tagged equine and human A3 expression plasmids or pcDNA3.1 (vector). A3 expression in transfected cells was detected by immunoblotting using a mixture of anti-HA and anti-V5 antibodies. Cell lysates were also analyzed for equal amounts of total proteins by using anti-tubulin antibody. Packaged A3s in virions (normalized by RT activity) were detected by probing with anti-HA and anti-V5 antibody together on a parallel immunoblot. Immunoblots of virions were also probed with anti-VSV-G antibody as a control for the equal amounts of analyzed virions. cps, counts per second; α, anti.

    Techniques Used: Infection, Produced, Luciferase, Activity Assay, Generated, Expressing, Cotransfection, Plasmid Preparation, Transfection, Western Blot

    Inhibition of EIAV by nonprimate A3 proteins. EIAV luciferase reporter viruses were produced in 293T cells in the presence or absence of the indicated A3s. Infectivity of the viruses was determined by quantification of luciferase activity in CrFK cells infected with equal amounts of virions at 3 days postinfection. cps, counts per second.
    Figure Legend Snippet: Inhibition of EIAV by nonprimate A3 proteins. EIAV luciferase reporter viruses were produced in 293T cells in the presence or absence of the indicated A3s. Infectivity of the viruses was determined by quantification of luciferase activity in CrFK cells infected with equal amounts of virions at 3 days postinfection. cps, counts per second.

    Techniques Used: Inhibition, Luciferase, Produced, Infection, Activity Assay

    61) Product Images from "High Permissivity of Human HepG2 Hepatoma Cells for Influenza Viruses"

    Article Title: High Permissivity of Human HepG2 Hepatoma Cells for Influenza Viruses

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.42.12.5861-5865.2004

    CPE caused by the replication of H3N2 influenza A virus strain Panama/379/99 and influenza B virus strain Sichuan/379/99 in human HepG2 hepatoma cells. (A) CPEs were photographed on days 2, 5, and 8 postinfection. Infected MDCK and mock-infected cells are shown. (B) Correlation between degrees of CPE and production of H3N2 influenza virus virions in HepG2 cells. (C) Growth curves (means of triplicates) of virion production by HepG2 and MDCK cells (5 × 10 4 ) inoculated with 10 2 PFU. All titrations were performed by a plaque assay.
    Figure Legend Snippet: CPE caused by the replication of H3N2 influenza A virus strain Panama/379/99 and influenza B virus strain Sichuan/379/99 in human HepG2 hepatoma cells. (A) CPEs were photographed on days 2, 5, and 8 postinfection. Infected MDCK and mock-infected cells are shown. (B) Correlation between degrees of CPE and production of H3N2 influenza virus virions in HepG2 cells. (C) Growth curves (means of triplicates) of virion production by HepG2 and MDCK cells (5 × 10 4 ) inoculated with 10 2 PFU. All titrations were performed by a plaque assay.

    Techniques Used: Infection, Plaque Assay

    Quantitative and comparative evaluation of influenza virus production in HepG2 and MDCK cells. Three independent influenza virus productions were evaluated using a real-time RT-PCR method (FRET principle) with 30 ng of total RNAs, carefully measured, from each type of cells infected with 10 3 PFU. (A) Cells infected with H3N2 influenza A virus (strain Panama/379/99). (B) Cells infected with influenza B virus (strain Sichuan/379/99). (C) Inhibitory activity of 1 and 10 mM tranexamic acid on influenza A virus replication in HepG2 cells, evaluated on day 3 postinfection.
    Figure Legend Snippet: Quantitative and comparative evaluation of influenza virus production in HepG2 and MDCK cells. Three independent influenza virus productions were evaluated using a real-time RT-PCR method (FRET principle) with 30 ng of total RNAs, carefully measured, from each type of cells infected with 10 3 PFU. (A) Cells infected with H3N2 influenza A virus (strain Panama/379/99). (B) Cells infected with influenza B virus (strain Sichuan/379/99). (C) Inhibitory activity of 1 and 10 mM tranexamic acid on influenza A virus replication in HepG2 cells, evaluated on day 3 postinfection.

    Techniques Used: Quantitative RT-PCR, Infection, Activity Assay

    62) Product Images from "Severe Acute Respiratory Syndrome Coronavirus Protein 6 Accelerates Murine Coronavirus Infections ▿"

    Article Title: Severe Acute Respiratory Syndrome Coronavirus Protein 6 Accelerates Murine Coronavirus Infections ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01515-06

    Time course analysis of viral RNA accumulations. HeLa-MHVR cells were infected with the indicated recombinant viruses at a multiplicity of infection of 0.01 PFU/cell, and total cellular RNAs were harvested from individual cultures at 4, 6 and 8 h postinfection.
    Figure Legend Snippet: Time course analysis of viral RNA accumulations. HeLa-MHVR cells were infected with the indicated recombinant viruses at a multiplicity of infection of 0.01 PFU/cell, and total cellular RNAs were harvested from individual cultures at 4, 6 and 8 h postinfection.

    Techniques Used: Infection, Recombinant

    Immunofluorescence detection of infected cells at 8 and 10 h postinfection. HeLa-MHVR5 cells were infected with rJ.6-KO or rJ.6 at 0.01 PFU/cell, fixed with paraformaldehyde at the indicated times, and then permabilized with methanol. Cells were immunostained
    Figure Legend Snippet: Immunofluorescence detection of infected cells at 8 and 10 h postinfection. HeLa-MHVR5 cells were infected with rJ.6-KO or rJ.6 at 0.01 PFU/cell, fixed with paraformaldehyde at the indicated times, and then permabilized with methanol. Cells were immunostained

    Techniques Used: Immunofluorescence, Infection

    63) Product Images from "The Cargo-Binding Domain of Transportin 3 Is Required for Lentivirus Nuclear Import ▿The Cargo-Binding Domain of Transportin 3 Is Required for Lentivirus Nuclear Import ▿ †"

    Article Title: The Cargo-Binding Domain of Transportin 3 Is Required for Lentivirus Nuclear Import ▿The Cargo-Binding Domain of Transportin 3 Is Required for Lentivirus Nuclear Import ▿ †

    Journal: Journal of Virology

    doi: 10.1128/JVI.05384-11

    TNPO3 knockdown inhibits HIV-1 and SIVmac239 nuclear import. (A) HeLa cells were transfected with nontarget control (NTC), TNPO3, Nup153, or mock siRNA and then infected with HIV-1 and SIVmac239 reporter virus. (B) HeLa cells were transfected with NTC and two different TNPO3 siRNAs (TNPO3.9 and TNPO3.12) or were mock transfected. The cells were then infected with HIV-1 or SIVmac239 reporter virus. AZT was added to one sample to control for intravirion reverse transcripts. DNA was harvested from infected cells at 2, 10, 24, and 48 h postinfection, and viral late-reverse transcription (RT) products and 2-LTR circles were measured by qRT-PCR. Each point represents the mean of triplicate samples, with the error bars representing the standard deviations.
    Figure Legend Snippet: TNPO3 knockdown inhibits HIV-1 and SIVmac239 nuclear import. (A) HeLa cells were transfected with nontarget control (NTC), TNPO3, Nup153, or mock siRNA and then infected with HIV-1 and SIVmac239 reporter virus. (B) HeLa cells were transfected with NTC and two different TNPO3 siRNAs (TNPO3.9 and TNPO3.12) or were mock transfected. The cells were then infected with HIV-1 or SIVmac239 reporter virus. AZT was added to one sample to control for intravirion reverse transcripts. DNA was harvested from infected cells at 2, 10, 24, and 48 h postinfection, and viral late-reverse transcription (RT) products and 2-LTR circles were measured by qRT-PCR. Each point represents the mean of triplicate samples, with the error bars representing the standard deviations.

    Techniques Used: Transfection, Infection, Quantitative RT-PCR

    64) Product Images from "The Vaccinia Virus K1L Gene Product Inhibits Host NF-?B Activation by Preventing I?B? Degradation"

    Article Title: The Vaccinia Virus K1L Gene Product Inhibits Host NF-?B Activation by Preventing I?B? Degradation

    Journal: Journal of Virology

    doi: 10.1128/JVI.78.7.3553-3560.2004

    Resistance to etoposide-induced cytolysis does not correlate with the ability of MVA/5.2kb virus to inhibit IκBα degradation. Jurkat cells were mock infected (UN) or infected at an MOI of 20 with the indicated viruses. (A and B) At 6 h postinfection, cells were incubated with medium alone or medium containing 50 μM etoposide. At 12 h after treatment, cells were fixed and cytolysis was detected by using a fluorescence-based TUNEL assay. Only results with etoposide treatment are shown in panel B, as cytolysis only occurred in a minority of untreated cells. (C) Eighteen hours postinfection, Jurkat cells were collected by centrifugation and lysed in CE buffer. Equal amounts of protein from each lysate were subjected to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis and subsequent Western immunoblotting with anti-IκBα antibody.
    Figure Legend Snippet: Resistance to etoposide-induced cytolysis does not correlate with the ability of MVA/5.2kb virus to inhibit IκBα degradation. Jurkat cells were mock infected (UN) or infected at an MOI of 20 with the indicated viruses. (A and B) At 6 h postinfection, cells were incubated with medium alone or medium containing 50 μM etoposide. At 12 h after treatment, cells were fixed and cytolysis was detected by using a fluorescence-based TUNEL assay. Only results with etoposide treatment are shown in panel B, as cytolysis only occurred in a minority of untreated cells. (C) Eighteen hours postinfection, Jurkat cells were collected by centrifugation and lysed in CE buffer. Equal amounts of protein from each lysate were subjected to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis and subsequent Western immunoblotting with anti-IκBα antibody.

    Techniques Used: Infection, Incubation, Fluorescence, TUNEL Assay, Centrifugation, Polyacrylamide Gel Electrophoresis, Western Blot

    K1L is necessary for inhibition of NF-κB activation in RK13 cells. (A) RK13 cells were infected with WR or ΔK1L at an MOI of 10. At the times indicated postinfection, cells were collected and lysed in CE buffer. Equal amounts of cytoplasmic extracts were analyzed by using sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis and subsequent Western immunoblotting with an IκBα antibody. In comparable blots, lysates were analyzed for actin levels to ensure equal protein loading and SPI-1 levels to ensure active virus infection. (B) RK13 cells were transfected with pRL-TK and pNF-κB luc , and 24 h posttransfection cells were infected (MOI = 10) with WR or ΔK1L. At 8 h postinfection, cells were lysed. The ratios of firefly to sea pansy activities were determined and normalized to that of uninfected cells. (C) RK13 cells were infected with WR or ΔK1L (MOI = 10). At 6 or 16 h postinfection, total RNA was isolated and mRNA was reverse transcribed into cDNA. TNF and GAPDH cDNAs were amplified by using PCR, and the resultant DNA products were separated by electrophoresis on a 2% agarose gel and visualized with ethidium bromide.
    Figure Legend Snippet: K1L is necessary for inhibition of NF-κB activation in RK13 cells. (A) RK13 cells were infected with WR or ΔK1L at an MOI of 10. At the times indicated postinfection, cells were collected and lysed in CE buffer. Equal amounts of cytoplasmic extracts were analyzed by using sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis and subsequent Western immunoblotting with an IκBα antibody. In comparable blots, lysates were analyzed for actin levels to ensure equal protein loading and SPI-1 levels to ensure active virus infection. (B) RK13 cells were transfected with pRL-TK and pNF-κB luc , and 24 h posttransfection cells were infected (MOI = 10) with WR or ΔK1L. At 8 h postinfection, cells were lysed. The ratios of firefly to sea pansy activities were determined and normalized to that of uninfected cells. (C) RK13 cells were infected with WR or ΔK1L (MOI = 10). At 6 or 16 h postinfection, total RNA was isolated and mRNA was reverse transcribed into cDNA. TNF and GAPDH cDNAs were amplified by using PCR, and the resultant DNA products were separated by electrophoresis on a 2% agarose gel and visualized with ethidium bromide.

    Techniques Used: Inhibition, Activation Assay, Infection, Polyacrylamide Gel Electrophoresis, Western Blot, Transfection, Isolation, Amplification, Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis

    65) Product Images from "Inability of Human Immunodeficiency Virus Type 1 Produced in Murine Cells To Selectively Incorporate Primer \documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[Euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0in \begin{document} \begin{equation*}{\mathrm{tRNA}}_{3}^{{\mathrm{Lys}}}\end{equation*}\end{document} ▿ ▿ †"

    Article Title: Inability of Human Immunodeficiency Virus Type 1 Produced in Murine Cells To Selectively Incorporate Primer \documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[Euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0in \begin{document} \begin{equation*}{\mathrm{tRNA}}_{3}^{{\mathrm{Lys}}}\end{equation*}\end{document} ▿ ▿ †

    Journal: Journal of Virology

    doi: 10.1128/JVI.01744-08

    HIV-1 produced in murine cells show reduced (tRNA Lys3 ) packaging, −SS DNA synthesis, and infectivity. 293T and GM11686-cycT1 cells were spin transfected with HIV-1, and the resulting virions were analyzed. (A) Viral production and packaging. (Left) Extracellular amount of CAp24 per milliliter of culture medium. (Right) Total viral RNA was isolated and analyzed by dot blot hybridization using DNA probes specific for and viral genomic RNA. (B) −SS DNA synthesis. SupT1 cells were infected with equal amounts of HIV-1 produced from either 293T cells or GM11686-cyc-T1 cells. DNA was extracted at different times postinfection. Early (R-U5) minus-strand cDNA production was monitored by real-time PCR as described in Materials and Methods. (Left) Time course of DNA production. Symbols: □, HIV-1 produced in 293T cells; ♦, HIV-1 produced in GM11686-cycT1 cells. (Right) Relative (rel.) production of −SS DNA at 8 h. (C) Viral infectivity. Equal amounts of viral CAp24 were used to challenge TZM-bl indicator cells, and productive infection was measured as the induction of luciferase activity. (Left) Time course of infection. Symbols: □, HIV-1 produced in 293T cells; ♦, HIV-1 produced in GM11686-cycT1 cells. (Right) Relative (rel.) infectivity at 28 h postinfection, normalized to HIV-1 produced in GM11686-cycT1 cells.
    Figure Legend Snippet: HIV-1 produced in murine cells show reduced (tRNA Lys3 ) packaging, −SS DNA synthesis, and infectivity. 293T and GM11686-cycT1 cells were spin transfected with HIV-1, and the resulting virions were analyzed. (A) Viral production and packaging. (Left) Extracellular amount of CAp24 per milliliter of culture medium. (Right) Total viral RNA was isolated and analyzed by dot blot hybridization using DNA probes specific for and viral genomic RNA. (B) −SS DNA synthesis. SupT1 cells were infected with equal amounts of HIV-1 produced from either 293T cells or GM11686-cyc-T1 cells. DNA was extracted at different times postinfection. Early (R-U5) minus-strand cDNA production was monitored by real-time PCR as described in Materials and Methods. (Left) Time course of DNA production. Symbols: □, HIV-1 produced in 293T cells; ♦, HIV-1 produced in GM11686-cycT1 cells. (Right) Relative (rel.) production of −SS DNA at 8 h. (C) Viral infectivity. Equal amounts of viral CAp24 were used to challenge TZM-bl indicator cells, and productive infection was measured as the induction of luciferase activity. (Left) Time course of infection. Symbols: □, HIV-1 produced in 293T cells; ♦, HIV-1 produced in GM11686-cycT1 cells. (Right) Relative (rel.) infectivity at 28 h postinfection, normalized to HIV-1 produced in GM11686-cycT1 cells.

    Techniques Used: Produced, DNA Synthesis, Infection, Transfection, Isolation, Dot Blot, Hybridization, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay

    66) Product Images from "Inclusion Bodies Are a Site of Ebolavirus Replication"

    Article Title: Inclusion Bodies Are a Site of Ebolavirus Replication

    Journal: Journal of Virology

    doi: 10.1128/JVI.01525-12

    Colocalization of inclusion bodies with VP35. Vero E6 cells were infected with rgZEBOV-L-mCherry. At 18 h postinfection, cells were fixed and stained with a mouse anti-VP35 antibody and an anti-mouse Alexa Fluor 488-coupled secondary antibody. Nuclei
    Figure Legend Snippet: Colocalization of inclusion bodies with VP35. Vero E6 cells were infected with rgZEBOV-L-mCherry. At 18 h postinfection, cells were fixed and stained with a mouse anti-VP35 antibody and an anti-mouse Alexa Fluor 488-coupled secondary antibody. Nuclei

    Techniques Used: Infection, Staining

    Time course analysis of inclusion body formation. (A) Onset of inclusion bodies. Cells were infected with rg-ZEBOV-L-mCherry. At 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 h postinfection, cells were fixed, removed from the BSL-4 laboratory, counterstained
    Figure Legend Snippet: Time course analysis of inclusion body formation. (A) Onset of inclusion bodies. Cells were infected with rg-ZEBOV-L-mCherry. At 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 h postinfection, cells were fixed, removed from the BSL-4 laboratory, counterstained

    Techniques Used: Infection

    Colocalization of nascent RNA and inclusion bodies. Vero E6 cells were infected with rg-ZEBOV-L-mCherry. At 17.5 h postinfection, actinomycin (ActD) was added to the cells to inhibit cellular RNA synthesis. At 18 h postinfection, ethynyl-uridine (EU)
    Figure Legend Snippet: Colocalization of nascent RNA and inclusion bodies. Vero E6 cells were infected with rg-ZEBOV-L-mCherry. At 17.5 h postinfection, actinomycin (ActD) was added to the cells to inhibit cellular RNA synthesis. At 18 h postinfection, ethynyl-uridine (EU)

    Techniques Used: Infection

    Analysis of mRNA and vRNA production in infected cells. Vero E6 cells were infected with ZEBOV-L-mCherry. At 0, 1, 2, 4, 6, 8, 10, 12, 16, 20, and 24 h postinfection, cells were lysed and total RNA was purified. mRNA was reverse transcribed using an oligo(dT)
    Figure Legend Snippet: Analysis of mRNA and vRNA production in infected cells. Vero E6 cells were infected with ZEBOV-L-mCherry. At 0, 1, 2, 4, 6, 8, 10, 12, 16, 20, and 24 h postinfection, cells were lysed and total RNA was purified. mRNA was reverse transcribed using an oligo(dT)

    Techniques Used: Infection, Purification

    67) Product Images from "Suppressor of Cytokine Signaling 3 Suppresses Hepatitis C Virus Replication in an mTOR-Dependent Manner ▿"

    Article Title: Suppressor of Cytokine Signaling 3 Suppresses Hepatitis C Virus Replication in an mTOR-Dependent Manner ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02484-09

    SOCS3 downregulates HCV replication in JFH1-infected cells. Twenty-four hours after transfection with the pCDNA3-Myc or pCDNA3-Myc-hSOCS3 plasmid, Huh7.5.1 cells were infected with JFH1. At 72 h postinfection, Western blotting and qPCR were performed
    Figure Legend Snippet: SOCS3 downregulates HCV replication in JFH1-infected cells. Twenty-four hours after transfection with the pCDNA3-Myc or pCDNA3-Myc-hSOCS3 plasmid, Huh7.5.1 cells were infected with JFH1. At 72 h postinfection, Western blotting and qPCR were performed

    Techniques Used: Infection, Transfection, Plasmid Preparation, Western Blot, Real-time Polymerase Chain Reaction

    SOCS3 is degraded in a ubiquitination- and proteasome-dependent manner. Huh7.5.1 cells were infected with JFH1 virus or no-JFH1 virus mock infection medium. At days 1, 2, 3, 5, 7, 14, 21, and 28 postinfection, cells were collected, total RNA was isolated,
    Figure Legend Snippet: SOCS3 is degraded in a ubiquitination- and proteasome-dependent manner. Huh7.5.1 cells were infected with JFH1 virus or no-JFH1 virus mock infection medium. At days 1, 2, 3, 5, 7, 14, 21, and 28 postinfection, cells were collected, total RNA was isolated,

    Techniques Used: Infection, Isolation

    68) Product Images from "Human Immunodeficiency Virus Type 1 (HIV-1) Vpr Enhances Expression from Unintegrated HIV-1 DNA"

    Article Title: Human Immunodeficiency Virus Type 1 (HIV-1) Vpr Enhances Expression from Unintegrated HIV-1 DNA

    Journal: Journal of Virology

    doi: 10.1128/JVI.77.7.3962-3972.2003

    Induction of expression from VprX D64E virus does not require exclusive Vpr nuclear localization or G 2 arrest. (A) HeLa cells (2 × 10 4 ) were coinfected with VprX IN + or VprX D64E virus and HR-Vpr, HR-R80A, or HR-E25K vector. Luciferase activity was analyzed at 2 days postinfection. (B) Cells were coinfected with VprX D64E and HR-Vpr viruses, and cultures were maintained in medium or medium with thymidine (Vpr and Vpr plus thymidine, respectively). Luciferase activity is expressed as the fold induction relative to cells that were infected with VprX D64E and HR-EGFP viruses. In medium alone, cells infected with VprX D64E and HR-EGFP viruses had 62 and 37% of the cells in the G 1 and G 2 /M phases, respectively, and a luciferase activity of 8.5 × 10 3 RLU/μg. In medium with thymidine, infection with VprX D64E and HR-EGFP viruses resulted in 94 and 6% of the cells being in the G 1 and G 2 /M phases, respectively, and a luciferase activity of 2.7 × 10 3 RLU/ug.
    Figure Legend Snippet: Induction of expression from VprX D64E virus does not require exclusive Vpr nuclear localization or G 2 arrest. (A) HeLa cells (2 × 10 4 ) were coinfected with VprX IN + or VprX D64E virus and HR-Vpr, HR-R80A, or HR-E25K vector. Luciferase activity was analyzed at 2 days postinfection. (B) Cells were coinfected with VprX D64E and HR-Vpr viruses, and cultures were maintained in medium or medium with thymidine (Vpr and Vpr plus thymidine, respectively). Luciferase activity is expressed as the fold induction relative to cells that were infected with VprX D64E and HR-EGFP viruses. In medium alone, cells infected with VprX D64E and HR-EGFP viruses had 62 and 37% of the cells in the G 1 and G 2 /M phases, respectively, and a luciferase activity of 8.5 × 10 3 RLU/μg. In medium with thymidine, infection with VprX D64E and HR-EGFP viruses resulted in 94 and 6% of the cells being in the G 1 and G 2 /M phases, respectively, and a luciferase activity of 2.7 × 10 3 RLU/ug.

    Techniques Used: Expressing, Plasmid Preparation, Luciferase, Activity Assay, Infection

    Vpr does not increase integration from integrase-defective HIV-1. HeLa cells (5 × 10 5 ) were coinfected with 800 ng of p24 antigen from virus VprX IN + or VprX D64E and 2.5 μg of p24 antigen from virus with the phenotype RNA − Vpr − or RNA − Vpr + (mock or Vpr, respectively). At day 2 postinfection, cells were harvested and subjected to luciferase analysis (A) or Southern blot analysis (B). The amount of integrated proviral DNA was calculated by subtracting the signals of unintegrated linear and circular viral DNA from the total amount of viral DNA.
    Figure Legend Snippet: Vpr does not increase integration from integrase-defective HIV-1. HeLa cells (5 × 10 5 ) were coinfected with 800 ng of p24 antigen from virus VprX IN + or VprX D64E and 2.5 μg of p24 antigen from virus with the phenotype RNA − Vpr − or RNA − Vpr + (mock or Vpr, respectively). At day 2 postinfection, cells were harvested and subjected to luciferase analysis (A) or Southern blot analysis (B). The amount of integrated proviral DNA was calculated by subtracting the signals of unintegrated linear and circular viral DNA from the total amount of viral DNA.

    Techniques Used: Luciferase, Southern Blot

    Vpr increases expression from integration-defective HIV-1. (A) HeLa cells (2 × 10 4 cells) were infected with virus stocks (25 ng of p24 antigen) of NLlucΔBgl (IN + ), NLlucΔBglD64E (D64E), NLlucΔBglVprX (VprX IN + ), or NLlucΔBglVprXD64E (VprX D64E). (B and C) HeLa cells (2 × 10 4 ) were coinfected with 25 ng of p24 antigen from virus VprX IN + , VprX D64E, or VprX att and 200 ng of p24 antigen from vector HR-EGFP or HR-Vpr. Luciferase activity was analyzed at day 2 postinfection and is expressed as RLU per microgram of total protein. The dashed line indicates the background luciferase activity from an equivalent number of uninfected HeLa cells.
    Figure Legend Snippet: Vpr increases expression from integration-defective HIV-1. (A) HeLa cells (2 × 10 4 cells) were infected with virus stocks (25 ng of p24 antigen) of NLlucΔBgl (IN + ), NLlucΔBglD64E (D64E), NLlucΔBglVprX (VprX IN + ), or NLlucΔBglVprXD64E (VprX D64E). (B and C) HeLa cells (2 × 10 4 ) were coinfected with 25 ng of p24 antigen from virus VprX IN + , VprX D64E, or VprX att and 200 ng of p24 antigen from vector HR-EGFP or HR-Vpr. Luciferase activity was analyzed at day 2 postinfection and is expressed as RLU per microgram of total protein. The dashed line indicates the background luciferase activity from an equivalent number of uninfected HeLa cells.

    Techniques Used: Expressing, Infection, Plasmid Preparation, Luciferase, Activity Assay

    Virion-associated Vpr is sufficient to induce expression from VprX D64E virus. (A) Western blot analysis for the presence of virion Vpr within wild-type or integrase-defective HIV-1 virions defective for de novo Vpr synthesis [VprX IN + (Vpr) or VprX D64E (Vpr)]. The arrow indicates the protein band corresponding to Vpr. (B and C) HeLa cells (B) or CEMx174 cells (C) were infected with 25 ng of p24 antigen from wild-type or integrase-defective HIV-1 lacking (VprX IN + and VprX D64E) or containing [VprX IN + (Vpr) and VprX D64E (Vpr)] Vpr within the virions. (D) HeLa cells were coinfected with VprX IN + or VprX D64E virus and virions lacking a viral genome and lacking or containing Vpr (RNA − Vpr − or RNA − Vpr + ), respectively. For panels B, C, and D, luciferase activity was analyzed at 2 days postinfection.
    Figure Legend Snippet: Virion-associated Vpr is sufficient to induce expression from VprX D64E virus. (A) Western blot analysis for the presence of virion Vpr within wild-type or integrase-defective HIV-1 virions defective for de novo Vpr synthesis [VprX IN + (Vpr) or VprX D64E (Vpr)]. The arrow indicates the protein band corresponding to Vpr. (B and C) HeLa cells (B) or CEMx174 cells (C) were infected with 25 ng of p24 antigen from wild-type or integrase-defective HIV-1 lacking (VprX IN + and VprX D64E) or containing [VprX IN + (Vpr) and VprX D64E (Vpr)] Vpr within the virions. (D) HeLa cells were coinfected with VprX IN + or VprX D64E virus and virions lacking a viral genome and lacking or containing Vpr (RNA − Vpr − or RNA − Vpr + ), respectively. For panels B, C, and D, luciferase activity was analyzed at 2 days postinfection.

    Techniques Used: Expressing, Western Blot, Infection, Luciferase, Activity Assay

    69) Product Images from "Natural Single-Nucleotide Polymorphisms in the 3′ Region of the HIV-1 pol Gene Modulate Viral Replication Ability"

    Article Title: Natural Single-Nucleotide Polymorphisms in the 3′ Region of the HIV-1 pol Gene Modulate Viral Replication Ability

    Journal: Journal of Virology

    doi: 10.1128/JVI.01859-13

    Effect of various amino acid substitutions at the F223 site on the early viral replication phases. (A) Single-cycle viral infectivity. VSV-G-pseudotyped viruses were prepared from transfected 293T cells, and equal amounts were inoculated into M8166 cells. Cells were collected and lysed on day 1 postinfection for luciferase assays. Infectivity is presented as luciferase activity relative to that exhibited by 5R. Mean values ± SD from at least four independent experiments are shown. *, mean values are
    Figure Legend Snippet: Effect of various amino acid substitutions at the F223 site on the early viral replication phases. (A) Single-cycle viral infectivity. VSV-G-pseudotyped viruses were prepared from transfected 293T cells, and equal amounts were inoculated into M8166 cells. Cells were collected and lysed on day 1 postinfection for luciferase assays. Infectivity is presented as luciferase activity relative to that exhibited by 5R. Mean values ± SD from at least four independent experiments are shown. *, mean values are

    Techniques Used: Infection, Transfection, Luciferase, Activity Assay

    70) Product Images from "The Major Phosphorylation Sites of the Respiratory Syncytial Virus Phosphoprotein Are Dispensable for Virus Replication In Vitro"

    Article Title: The Major Phosphorylation Sites of the Respiratory Syncytial Virus Phosphoprotein Are Dispensable for Virus Replication In Vitro

    Journal: Journal of Virology

    doi: 10.1128/JVI.76.21.10776-10784.2002

    Immunoprecipitation of RSV-infected proteins infected with wild-type or phosphorylation mutants. Vero cells were infected with rA2, rA2-PP2, or rA2-PP5 at an MOI of 1.0 and incubated at 35°C. At 18 h of postinfection, proteins were radiolabeled with [ 35 S]Cys and [ 35 S]Met (100 μCi/ml) in DMEM deficient in cysteine and methionine or 33 P i (100 μCi/ml) in DMEM deficient in phosphate for 4 h, immunoprecipitated either by anti-RSV polyclonal or by anti-P protein monoclonal antibodies, separated by SDS-PAGE (15% polyacrylamide), and autoradiographed. P indicates the mature form of the P protein, and P′ represents the immature form of P protein.
    Figure Legend Snippet: Immunoprecipitation of RSV-infected proteins infected with wild-type or phosphorylation mutants. Vero cells were infected with rA2, rA2-PP2, or rA2-PP5 at an MOI of 1.0 and incubated at 35°C. At 18 h of postinfection, proteins were radiolabeled with [ 35 S]Cys and [ 35 S]Met (100 μCi/ml) in DMEM deficient in cysteine and methionine or 33 P i (100 μCi/ml) in DMEM deficient in phosphate for 4 h, immunoprecipitated either by anti-RSV polyclonal or by anti-P protein monoclonal antibodies, separated by SDS-PAGE (15% polyacrylamide), and autoradiographed. P indicates the mature form of the P protein, and P′ represents the immature form of P protein.

    Techniques Used: Immunoprecipitation, Infection, Incubation, SDS Page

    Cell association of rA2-PP5 in HEp-2 cells. HEp-2 or Vero cells were infected with rA2, rA2-PP2, or rA2-PP5 at an MOI of 1.0, and at 24 and 48 h postinfection, the amounts of virus released in the culture media or in the infected cells were determined by plaque assay. The percentages of virus that remained associated with the cells are represented.
    Figure Legend Snippet: Cell association of rA2-PP5 in HEp-2 cells. HEp-2 or Vero cells were infected with rA2, rA2-PP2, or rA2-PP5 at an MOI of 1.0, and at 24 and 48 h postinfection, the amounts of virus released in the culture media or in the infected cells were determined by plaque assay. The percentages of virus that remained associated with the cells are represented.

    Techniques Used: Infection, Plaque Assay

    71) Product Images from "Arming a Replicating Adenovirus with Osteoprotegerin Reduces the Tumor Burden in a Murine Model of Osteolytic Bone Metastases of Breast Cancer"

    Article Title: Arming a Replicating Adenovirus with Osteoprotegerin Reduces the Tumor Burden in a Murine Model of Osteolytic Bone Metastases of Breast Cancer

    Journal: Cancer gene therapy

    doi: 10.1038/cgt.2010.47

    Characterization of armed CRAds. A, B, MDA-MB-231 cells were infected with Ad5-Δ24-sOPG-Fc, Ad5-Δ24-sOPG-Fc-RGD or Adwt300. At the indicated times, cellular RNA was subjected to QRT-PCR to detect expression of: A, the sOPG-Fc gene (cells infected with Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD) or the 14.7k gene (cells infected with Adwt300); and B, the ADP gene. The copy number was normalized to total cellular RNA. C, Secretion of sOPG-Fc. MDA-MB-231 cells were infected with Ad5-Δ24, Ad5-Δ24RGD, Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD. At the indicated times, medium was harvested, diluted 1:300 and expression of sOPG-Fc was detected in an ELISA. D , sOPG-Fc binds RANKL. Medium from MDA-MB-231 cells 48 h postinfection was incubated in the presence (+) or absence (−) of sRANKL and pulled down with protein G-agarose. Proteins were released and subjected to immunoblot using anti-RANKL primary antibody. C: sRANKL.
    Figure Legend Snippet: Characterization of armed CRAds. A, B, MDA-MB-231 cells were infected with Ad5-Δ24-sOPG-Fc, Ad5-Δ24-sOPG-Fc-RGD or Adwt300. At the indicated times, cellular RNA was subjected to QRT-PCR to detect expression of: A, the sOPG-Fc gene (cells infected with Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD) or the 14.7k gene (cells infected with Adwt300); and B, the ADP gene. The copy number was normalized to total cellular RNA. C, Secretion of sOPG-Fc. MDA-MB-231 cells were infected with Ad5-Δ24, Ad5-Δ24RGD, Ad5-Δ24-sOPG-Fc or Ad5-Δ24-sOPG-Fc-RGD. At the indicated times, medium was harvested, diluted 1:300 and expression of sOPG-Fc was detected in an ELISA. D , sOPG-Fc binds RANKL. Medium from MDA-MB-231 cells 48 h postinfection was incubated in the presence (+) or absence (−) of sRANKL and pulled down with protein G-agarose. Proteins were released and subjected to immunoblot using anti-RANKL primary antibody. C: sRANKL.

    Techniques Used: Multiple Displacement Amplification, Infection, Quantitative RT-PCR, Expressing, Enzyme-linked Immunosorbent Assay, Incubation

    Oncolytic potency of armed CRAds. MDA-MB-231 ( A ) and MDA-MB-435 ( B ) cells were infected. DNA was extracted from medium 2 and 4 days postinfection and subjected to Q-PCR to detect the E4 gene. Results are means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of breast cancer cell lines was infected at the indicated MOIs. Eight days postinfection, cells were stained with crystal violet. Representative results of 3 separate experiments are shown.
    Figure Legend Snippet: Oncolytic potency of armed CRAds. MDA-MB-231 ( A ) and MDA-MB-435 ( B ) cells were infected. DNA was extracted from medium 2 and 4 days postinfection and subjected to Q-PCR to detect the E4 gene. Results are means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of breast cancer cell lines was infected at the indicated MOIs. Eight days postinfection, cells were stained with crystal violet. Representative results of 3 separate experiments are shown.

    Techniques Used: Multiple Displacement Amplification, Infection, Polymerase Chain Reaction, Staining

    Selectivity of the armed CRAds. Viral replication. Human liver slices ( A ) and MCF-10A normal breast epithelial cells ( B ) were infected with the indicated viruses. The conditioned culture medium was harvested at 2 and 4 days postinfection. DNA was extracted and subjected to Q-PCR to detect the E4 gene as a measure of viral DNA replication. Results are the means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of non-neoplastic cells was infected at the indicated MOIs. Eight days postinfection, viable cells were fixed and stained with crystal violet. Representative results of 3 separate experiments are shown.
    Figure Legend Snippet: Selectivity of the armed CRAds. Viral replication. Human liver slices ( A ) and MCF-10A normal breast epithelial cells ( B ) were infected with the indicated viruses. The conditioned culture medium was harvested at 2 and 4 days postinfection. DNA was extracted and subjected to Q-PCR to detect the E4 gene as a measure of viral DNA replication. Results are the means ± SD of duplicate determinations. Representative results of 3 separate experiments are shown. C , a panel of non-neoplastic cells was infected at the indicated MOIs. Eight days postinfection, viable cells were fixed and stained with crystal violet. Representative results of 3 separate experiments are shown.

    Techniques Used: Infection, Polymerase Chain Reaction, Staining

    72) Product Images from "Human Monoclonal Antibody Combination against SARS Coronavirus: Synergy and Coverage of Escape Mutants"

    Article Title: Human Monoclonal Antibody Combination against SARS Coronavirus: Synergy and Coverage of Escape Mutants

    Journal: PLoS Medicine

    doi: 10.1371/journal.pmed.0030237

    Infection of Differentiated Human Macrophages with SARS-CoV (HKU-39849) in the Presence of CR3014 or a Control mAb One representative experiment of three independent experiments is shown. Total RNA was extracted at 6 and 24 hours postinfection, and the copy number of positive (P) and negative (N) strand RNA of SARS-CoV ORF1b was determined by real-time quantitative RT-PCR and normalized for the levels of β-actin mRNA. The bars represent mean of duplicate viral load titrations. In the control experiment, * indicates an aberrant result.
    Figure Legend Snippet: Infection of Differentiated Human Macrophages with SARS-CoV (HKU-39849) in the Presence of CR3014 or a Control mAb One representative experiment of three independent experiments is shown. Total RNA was extracted at 6 and 24 hours postinfection, and the copy number of positive (P) and negative (N) strand RNA of SARS-CoV ORF1b was determined by real-time quantitative RT-PCR and normalized for the levels of β-actin mRNA. The bars represent mean of duplicate viral load titrations. In the control experiment, * indicates an aberrant result.

    Techniques Used: Infection, Quantitative RT-PCR

    73) Product Images from "Glycosylation of the Hemagglutinin Protein of H5N1 Influenza Virus Increases Its Virulence in Mice by Exacerbating the Host Immune Response"

    Article Title: Glycosylation of the Hemagglutinin Protein of H5N1 Influenza Virus Increases Its Virulence in Mice by Exacerbating the Host Immune Response

    Journal: Journal of Virology

    doi: 10.1128/JVI.02215-16

    Plaque phenotypes and virus morphology in MDCK cells. (A) Plaque phenotypes of CK/1180, CK/1214, and CK/1180-1214HA viruses. Plaque assays were produced under standard conditions and stained with 0.1% crystal violet. (B) Virus morphology of CK/1180, CK/1214, and CK/1180-1214HA viruses. MDCK cells were infected with viruses at an MOI of 5. At 10 h postinfection, the cells were collected and prepared for virion morphology analysis by using transmission electron microscopy.
    Figure Legend Snippet: Plaque phenotypes and virus morphology in MDCK cells. (A) Plaque phenotypes of CK/1180, CK/1214, and CK/1180-1214HA viruses. Plaque assays were produced under standard conditions and stained with 0.1% crystal violet. (B) Virus morphology of CK/1180, CK/1214, and CK/1180-1214HA viruses. MDCK cells were infected with viruses at an MOI of 5. At 10 h postinfection, the cells were collected and prepared for virion morphology analysis by using transmission electron microscopy.

    Techniques Used: Produced, Staining, Infection, Transmission Assay, Electron Microscopy

    Replication and lethality of the CK/1180 and CK/1214 viruses in mice. (A and B) Six-week-old SPF BALB/c mice (three/group) were inoculated intranasally with 10 6 EID 50 of each virus, and organs were collected on day 3 postinfection for virus titration in eggs. Data are means ± standard deviations (SD). (C to F) Mortality assessment of mice infected with different H5N1 viruses: CK/1180 (C), CK/1214 (D), R-CK/1180 (E), and R-CK/1214 (F).
    Figure Legend Snippet: Replication and lethality of the CK/1180 and CK/1214 viruses in mice. (A and B) Six-week-old SPF BALB/c mice (three/group) were inoculated intranasally with 10 6 EID 50 of each virus, and organs were collected on day 3 postinfection for virus titration in eggs. Data are means ± standard deviations (SD). (C to F) Mortality assessment of mice infected with different H5N1 viruses: CK/1180 (C), CK/1214 (D), R-CK/1180 (E), and R-CK/1214 (F).

    Techniques Used: Mouse Assay, Titration, Infection

    Expression of viral proteins in infected MDCK cells. MDCK cells were infected with viruses at an MOI of 5. The infected cells were collected at 12 h postinfection, lysed in SDS loading buffer, and further analyzed by Western blotting (A and B). (A) Protein bands of HA, NP, and M1 proteins detected by Western blotting. The intensity of each band was measured by using ImageJ software, and relative intensity ratios of HA, NP, and M1 compared with that of GAPDH were calculated (B). The infected cells were digested with trypsin to obtain a single cell suspension at 12 h postinfection. The samples were stained with rabbit monoclonal antibody to influenza A virus H5N1 HA protein and Alexa Fluor 488-conjugated goat anti-rabbit IgG (H+L) secondary antibody and then detected on a FACSAria II (BD Biosciences). (C) Mean fluorescence intensity of HA protein was analyzed with FlowJo X 10.0.7r2 (Tree Star, San Carlos, CA). Data are presented as means ± SD ( n = 3). **, P
    Figure Legend Snippet: Expression of viral proteins in infected MDCK cells. MDCK cells were infected with viruses at an MOI of 5. The infected cells were collected at 12 h postinfection, lysed in SDS loading buffer, and further analyzed by Western blotting (A and B). (A) Protein bands of HA, NP, and M1 proteins detected by Western blotting. The intensity of each band was measured by using ImageJ software, and relative intensity ratios of HA, NP, and M1 compared with that of GAPDH were calculated (B). The infected cells were digested with trypsin to obtain a single cell suspension at 12 h postinfection. The samples were stained with rabbit monoclonal antibody to influenza A virus H5N1 HA protein and Alexa Fluor 488-conjugated goat anti-rabbit IgG (H+L) secondary antibody and then detected on a FACSAria II (BD Biosciences). (C) Mean fluorescence intensity of HA protein was analyzed with FlowJo X 10.0.7r2 (Tree Star, San Carlos, CA). Data are presented as means ± SD ( n = 3). **, P

    Techniques Used: Expressing, Infection, Western Blot, Software, Staining, Fluorescence

    74) Product Images from "Viral Semaphorin Inhibits Dendritic Cell Phagocytosis and Migration but Is Not Essential for Gammaherpesvirus-Induced Lymphoproliferation in Malignant Catarrhal Fever"

    Article Title: Viral Semaphorin Inhibits Dendritic Cell Phagocytosis and Migration but Is Not Essential for Gammaherpesvirus-Induced Lymphoproliferation in Malignant Catarrhal Fever

    Journal: Journal of Virology

    doi: 10.1128/JVI.03634-14

    A3 is an early gene encoding a 93-kDa glycoprotein secreted during virus infection. (A) Determination of the A3 kinetic class of transcription. BT cells were infected with AlHV-1 and treated with CHX or PAA or left untreated (−). At 24 h p.i., the expression of ORF73 (IE gene), ORF09 (DPOL, E gene), ORF22 (gH, L gene), or A3 was determined by using a reverse transcription-PCR approach, as described in Materials and Methods. (B) Recombineering methodology used to insert a carboxy-terminal hIgG1 Fc fragment tag to the A3 gene and produce the BAC A3Fc strain. (C) The BAC constructs were analyzed by Southern blotting after EcoRI restriction. Probes are indicated: galK, entire galK coding sequence; A3, entire A3 coding sequence. (D) AlHV-sema kinetics of expression after infection with the BAC A3Fc virus (MOI = 0.01). Infected BT cells were fixed and permeabilized at the given time points postinfection before staining with Alexa Fluor 488-nm anti-human IgG1 goat polyserum for AlHV-sema-Fc detection or MAb 15-A primary antibody (specific to gp115 viral complex), followed by Alexa Fluor 488-nm goat anti-mouse IgG secondary antibody. (E) Supernatants were collected and analyzed by immunoblotting with anti-human IgG1 polyserum.
    Figure Legend Snippet: A3 is an early gene encoding a 93-kDa glycoprotein secreted during virus infection. (A) Determination of the A3 kinetic class of transcription. BT cells were infected with AlHV-1 and treated with CHX or PAA or left untreated (−). At 24 h p.i., the expression of ORF73 (IE gene), ORF09 (DPOL, E gene), ORF22 (gH, L gene), or A3 was determined by using a reverse transcription-PCR approach, as described in Materials and Methods. (B) Recombineering methodology used to insert a carboxy-terminal hIgG1 Fc fragment tag to the A3 gene and produce the BAC A3Fc strain. (C) The BAC constructs were analyzed by Southern blotting after EcoRI restriction. Probes are indicated: galK, entire galK coding sequence; A3, entire A3 coding sequence. (D) AlHV-sema kinetics of expression after infection with the BAC A3Fc virus (MOI = 0.01). Infected BT cells were fixed and permeabilized at the given time points postinfection before staining with Alexa Fluor 488-nm anti-human IgG1 goat polyserum for AlHV-sema-Fc detection or MAb 15-A primary antibody (specific to gp115 viral complex), followed by Alexa Fluor 488-nm goat anti-mouse IgG secondary antibody. (E) Supernatants were collected and analyzed by immunoblotting with anti-human IgG1 polyserum.

    Techniques Used: Infection, Expressing, Polymerase Chain Reaction, BAC Assay, Construct, Southern Blot, Sequencing, Staining

    Impairment of A3 expression does not affect viral replication in vitro . (A and B) Recombineering methodologies used to delete the entire A3 coding sequence by galK insertion and generation of the A3 − and A3-rev strains (A) or insert multistop codons at the 5′ end of the A3 coding sequence and generation of the A3ns and A3ns-rev strains (B). The produced BAC plasmids were analyzed by Southern blotting after EcoRI or HindIII restriction and ethidium bromide staining (EtBr). Probes are indicated as follows: A3, entire A3 coding sequence; galK, entire galK coding sequence. (C) Multistep growth curves of WT, A3 − , A3-rev, A3 ns , or A3 ns -rev virus strains in BT fibroblasts. The data presented are means ± the standard deviations of results from measurements in triplicate. (D) Syncytial areas over time postinfection in MDBK cells. The data presented are means ± the standard deviations of results from syncytium size measurements ( n = 25).
    Figure Legend Snippet: Impairment of A3 expression does not affect viral replication in vitro . (A and B) Recombineering methodologies used to delete the entire A3 coding sequence by galK insertion and generation of the A3 − and A3-rev strains (A) or insert multistop codons at the 5′ end of the A3 coding sequence and generation of the A3ns and A3ns-rev strains (B). The produced BAC plasmids were analyzed by Southern blotting after EcoRI or HindIII restriction and ethidium bromide staining (EtBr). Probes are indicated as follows: A3, entire A3 coding sequence; galK, entire galK coding sequence. (C) Multistep growth curves of WT, A3 − , A3-rev, A3 ns , or A3 ns -rev virus strains in BT fibroblasts. The data presented are means ± the standard deviations of results from measurements in triplicate. (D) Syncytial areas over time postinfection in MDBK cells. The data presented are means ± the standard deviations of results from syncytium size measurements ( n = 25).

    Techniques Used: Expressing, In Vitro, Sequencing, Produced, BAC Assay, Southern Blot, Staining

    Humoral immune response in the absence of AlHV-sema. Serum samples were collected at different time points postinfection for each rabbit, and the relative quantities of anti-AlHV-1 antibodies were measured by indirect ELISA. The data are plotted as individual measurements. Rabbits were identified according to the day of euthanasia postinfection (see numbers, n = 5 to 6).
    Figure Legend Snippet: Humoral immune response in the absence of AlHV-sema. Serum samples were collected at different time points postinfection for each rabbit, and the relative quantities of anti-AlHV-1 antibodies were measured by indirect ELISA. The data are plotted as individual measurements. Rabbits were identified according to the day of euthanasia postinfection (see numbers, n = 5 to 6).

    Techniques Used: Indirect ELISA

    75) Product Images from "Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication"

    Article Title: Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

    Journal: Journal of Virology

    doi: 10.1128/JVI.02867-15

    MHV68 infection prevents p21 induction following p53 stimulation. (A) 3T3 fibroblasts were mock infected or infected with MHV68 at an MOI of 5 PFU/cell. Twelve hours postinfection, cells were treated with DMSO, doxorubicin (Doxo; 5 μM), or nutlin-3a
    Figure Legend Snippet: MHV68 infection prevents p21 induction following p53 stimulation. (A) 3T3 fibroblasts were mock infected or infected with MHV68 at an MOI of 5 PFU/cell. Twelve hours postinfection, cells were treated with DMSO, doxorubicin (Doxo; 5 μM), or nutlin-3a

    Techniques Used: Infection

    Related Articles

    Amplification:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. The MuMBC primer (TGGCTCAAACAAGGAGACCT), specific for mouse TRBC (Eurofins, Huntsville, AL), permits sequencing across the CDR3 region of the TCR gene and was used for PCR amplification of rearranged TCR products.

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: .. Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of a portion of the C. parvum 18S rRNA gene was used as an internal control for normalization of Cp Clec gene expression.

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen). .. Standard curves were generated by amplification of serially diluted proviral and two-LTR plasmids.

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen). .. There are two DpnI sites in the amplicon (nucleotide [nt] 557 to 701), and DpnI digestion is expected to effectively suppress the amplification of the transfected plasmid DNA.

    Synthesized:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: .. Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. The MuMBC primer (TGGCTCAAACAAGGAGACCT), specific for mouse TRBC (Eurofins, Huntsville, AL), permits sequencing across the CDR3 region of the TCR gene and was used for PCR amplification of rearranged TCR products.

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: .. Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of a portion of the C. parvum 18S rRNA gene was used as an internal control for normalization of Cp Clec gene expression.

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen). .. RNA quality was analyzed by agarose gel electrophoresis. cDNA was synthesized on 1 μg of total RNA using the QuantyTect reverse transcription kit (Qiagen).

    Neutralization:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: Paragraph title: Anti-CD81 and bafilomycin A1 neutralization assays. ... Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above.

    Cytometry:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above. .. Cell population profiles, cell death, and CD81 expression were then assessed by flow cytometry (FACSCanto II; BD Biosciences).

    Quantitative RT-PCR:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: .. Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above. .. To control the absence of toxicity of the bafilomycin A1 on cell viability and surface protein expression, naive Raji cells were pretreated for 30 min with DMSO or 20 nM bafilomycin A1, washed, and then incubated for 4 days with cell medium premixed with DMSO or with 20 nM bafilomycin A1, respectively.

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: Paragraph title: Quantitative reverse transcription-PCR (RT-qPCR). ... At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen).

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses
    Article Snippet: Paragraph title: DENV and JEV qRT-PCR. ... DENV genomic RNA was extracted from the supernatants of infected cells on day 2 postinfection, using an RNA extraction kit (Qiagen, Hilden, Germany).

    Real-time Polymerase Chain Reaction:

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of Cp Clec and Cp 18S rRNA cDNA was visualized following conventional PCR and 1.5% agarose gel electrophoresis, with quantification by real-time PCR following MIQE guidelines ( ).

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen). .. Aliquots of the same cDNA solution were used for qPCR with different sets of primers. nsP2-specific primers (5′-GAAACAATAGGAGTGATAGGCA-3′ and 5′-TGCATACCCCTCAGTCTTAGC-3′) were used to measure viral genomic RNA. qPCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) in the CFX96 real-time PCR detection system (Bio-Rad) for 40 cycles.

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations
    Article Snippet: Paragraph title: Quantitative real-time PCR. ... Total intracellular DNA of the parental AcMNPV and the escape mutant viruses was extracted at different times postinfection from ∼5 × 105 infected Sf21 cells maintained in a 24-well plate by using the QIAamp DNA blood minikit (Qiagen) according to the manufacturer's recommendations.

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: Paragraph title: Quantitative real-time PCR (qPCR). ... DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen).

    Article Title: Tumor Suppressor Cylindromatosis (CYLD) Controls HIV Transcription in an NF-κB-Dependent Manner
    Article Snippet: At 1 day postinfection, cellular DNA was isolated using the DNeasy 96 Blood & Tissue kit (Qiagen) and quantitated using the Quant-iTTM PicoGreen R ds DNA assay kit (Invitrogen) on a Cytofluoro multiwell plate reader series 4000 (Applied Biosystems). .. PCRs were carried out using an Applied Biosystems 7500 Fast real-time PCR system.

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: Paragraph title: Infection and viral DNA quantification by real-time PCR. ... Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen).

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses
    Article Snippet: DENV genomic RNA was extracted from the supernatants of infected cells on day 2 postinfection, using an RNA extraction kit (Qiagen, Hilden, Germany). .. Quantitative PCR measurements were performed using a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocol.

    Microarray:

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿
    Article Snippet: Paragraph title: Microarray analysis. ... At 24 h postinfection, the supernatant was removed and macrophage RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA).

    Article Title: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus
    Article Snippet: Paragraph title: hNIS mRNA analysis via microarray ... Six and 24 hours postinfection, 3 samples of each time point were harvested and lysis performed directly using RNeasy mini kit protocol (Qiagen Inc., Valencia, CA).

    Incubation:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: For the CD81 neutralization assay, 5 × 105 Raji cells were incubated with anti-human CD81 antibody (JS81 clone R-phycoerythrin conjugated at a dilution of 1/100; BD Biosciences) for 1 h at 37°C. .. Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above.

    Expressing:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above. .. To control the absence of toxicity of the bafilomycin A1 on cell viability and surface protein expression, naive Raji cells were pretreated for 30 min with DMSO or 20 nM bafilomycin A1, washed, and then incubated for 4 days with cell medium premixed with DMSO or with 20 nM bafilomycin A1, respectively.

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Paragraph title: Unbiased molecular analysis of TCR expression by neutrophils. ... Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA).

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: Paragraph title: Time course of expression of Cp Clec RNA in infected Caco-2 cells. ... Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA.

    Article Title: Bracoviruses Contain a Large Multigene Family Coding for Protein Tyrosine Phosphatases
    Article Snippet: Paragraph title: Analysis of recombinant baculovirus mRNA expression. ... Three days postinfection, cells were harvested ( ) and resuspended in RLT buffer (Qiagen) as per the manufacturer's instructions.

    Western Blot:

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Paragraph title: Northern and Western blot analysis. ... Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA.

    Transformation Assay:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. Each TCR gene product was then ligated into the pGEM-T Easy vector and transformed into competent Escherichia coli cells.

    Hybridization:

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿
    Article Snippet: At 24 h postinfection, the supernatant was removed and macrophage RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA). .. Hybridizations were done for 16 h at 45°C in an Affymetrix GeneChip model 640 hybridization oven set to rotate at 60 rpm.

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells
    Article Snippet: At 6 h postinfection, total RNA was harvested from one dish by using the RNeasy purification kit (Qiagen). .. Cell equivalents of total, nuclear, and cytoplasmic RNA were treated with RNase H and oligo(dT) and then analyzed by Northern blot hybridization for the presence of α-globin transcripts (Fig. A).

    Flow Cytometry:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above. .. Cell population profiles, cell death, and CD81 expression were then assessed by flow cytometry (FACSCanto II; BD Biosciences).

    Northern Blot:

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells
    Article Snippet: At 6 h postinfection, total RNA was harvested from one dish by using the RNeasy purification kit (Qiagen). .. Cell equivalents of total, nuclear, and cytoplasmic RNA were treated with RNase H and oligo(dT) and then analyzed by Northern blot hybridization for the presence of α-globin transcripts (Fig. A).

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Paragraph title: Northern and Western blot analysis. ... Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA.

    Infection:

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿
    Article Snippet: Macrophages were infected in triplicate with H37Rv or the hip1 mutant as described above. .. At 24 h postinfection, the supernatant was removed and macrophage RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA).

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells
    Article Snippet: Duplicate dishes of HeLa cells were infected with HSV-1 strain KOS1.1 or d 27-1 ( ) in the presence of PAA. .. At 6 h postinfection, total RNA was harvested from one dish by using the RNeasy purification kit (Qiagen).

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: Cells were infected with equivalent amount of different HCVcc viruses premixed with DMSO or 20 nM bafilomycin A1. .. Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above.

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: .. Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of a portion of the C. parvum 18S rRNA gene was used as an internal control for normalization of Cp Clec gene expression.

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: BHK-21 cells were infected with SINV/nsP3GFP at an MOI of 20 PFU/cell and treated with nocodazole or dynasore as described above. .. At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen).

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations
    Article Snippet: .. Total intracellular DNA of the parental AcMNPV and the escape mutant viruses was extracted at different times postinfection from ∼5 × 105 infected Sf21 cells maintained in a 24-well plate by using the QIAamp DNA blood minikit (Qiagen) according to the manufacturer's recommendations. ..

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: To control for residual plasmid DNA, 25 μM zidovudine (AZT) was added to one control well 14 h prior to infection. .. DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen).

    Article Title: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus
    Article Snippet: hNIS mRNA analysis via microarray To evaluate the level of hNIS mRNA production in infected cells, cells were plated at 5 × 105 cells per well and infected with GLV-1h153 at an MOI of 5.0. .. Six and 24 hours postinfection, 3 samples of each time point were harvested and lysis performed directly using RNeasy mini kit protocol (Qiagen Inc., Valencia, CA).

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: Paragraph title: Infection and viral DNA quantification by real-time PCR. ... Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen).

    Article Title: Bracoviruses Contain a Large Multigene Family Coding for Protein Tyrosine Phosphatases
    Article Snippet: Sf21 cells seeded in 60-mm dishes (2 × 106 cells per dish) were infected at a multiplicity of infection of 10 PFU/cell with wild-type or recombinant baculoviruses expressing CcBV PTPA (Rec-PTPA) or CcBV PTPM (Rec-PTPM). .. Three days postinfection, cells were harvested ( ) and resuspended in RLT buffer (Qiagen) as per the manufacturer's instructions.

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses
    Article Snippet: .. DENV genomic RNA was extracted from the supernatants of infected cells on day 2 postinfection, using an RNA extraction kit (Qiagen, Hilden, Germany). .. Next, one-step qRT-PCR was carried out in a final volume of 20 μl containing 5 μl of diluted RNA, 1 μl of probe/primer mix, 10 μl of real-time master mix, and 4 μl of nuclease-free water (PrimerDesign, Southampton, UK).

    Generated:

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen). .. Standard curves were generated by amplification of serially diluted proviral and two-LTR plasmids.

    Negative Control:

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: .. Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of a portion of the C. parvum 18S rRNA gene was used as an internal control for normalization of Cp Clec gene expression.

    Sequencing:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. The MuMBC primer (TGGCTCAAACAAGGAGACCT), specific for mouse TRBC (Eurofins, Huntsville, AL), permits sequencing across the CDR3 region of the TCR gene and was used for PCR amplification of rearranged TCR products.

    Article Title: Hhex induces promyelocyte self-renewal and cooperates with growth factor independence to cause myeloid leukemia in mice
    Article Snippet: RNA was extracted from GFP+ -sorted LSK cells 2 days postinfection using the RNeasy Plus Minikit (Qiagen). .. Sequencing was performed on an Illumina Hi-Sequation 2000, producing at least 12.4 million 100-bp paired-end (n = 2 per vector) or 100-bp single-end (n = 1 per vector) reads per sample.

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen). .. The amounts of unintegrated viral DNA and proviruses were quantified using ABI Prism 7700 sequence detection as described previously ( ) or using the Roche LightCycler 480 Real-Time PCR system and LightCycler 480 Probe Master reaction mix according to the manufacturer's instructions.

    Recombinant:

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA. .. The antibodies used in the study were produced in rabbit (polyclonal antibody against anti-NDV F1 or HN recombinant protein or synthetic L protein peptide) or guinea pig antiserum to synthetic peptides (NP, M, and V) or P monoclonal antibody (from Takemasa Sakaguchi of Hiroshima University).

    Article Title: Bracoviruses Contain a Large Multigene Family Coding for Protein Tyrosine Phosphatases
    Article Snippet: Paragraph title: Analysis of recombinant baculovirus mRNA expression. ... Three days postinfection, cells were harvested ( ) and resuspended in RLT buffer (Qiagen) as per the manufacturer's instructions.

    Methylation:

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen). .. The DNA then was digested with DpnI, which digests methylated plasmid DNA but not viral or cellular DNA, to further reduce plasmid DNA contamination.

    Mutagenesis:

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿
    Article Snippet: Macrophages were infected in triplicate with H37Rv or the hip1 mutant as described above. .. At 24 h postinfection, the supernatant was removed and macrophage RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA).

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells
    Article Snippet: To determine the cellular location of the ICP27-induced α-globin pre-mRNAs, we prepared nuclear and cytoplasmic RNA fractions from cells infected with wild-type HSV-1 or an ICP27-null mutant strain. .. At 6 h postinfection, total RNA was harvested from one dish by using the RNeasy purification kit (Qiagen).

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations
    Article Snippet: .. Total intracellular DNA of the parental AcMNPV and the escape mutant viruses was extracted at different times postinfection from ∼5 × 105 infected Sf21 cells maintained in a 24-well plate by using the QIAamp DNA blood minikit (Qiagen) according to the manufacturer's recommendations. ..

    Isolation:

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿
    Article Snippet: .. At 24 h postinfection, the supernatant was removed and macrophage RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA). .. Microarray processing and analysis were carried out by Almac Diagnostics (Durham, NC), using Affymetrix mouse genome 430 2.0 arrays.

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells
    Article Snippet: At 6 h postinfection, total RNA was harvested from one dish by using the RNeasy purification kit (Qiagen). .. Cytoplasmic and nuclear RNA fractions were isolated from the second dish of cells according to the RNeasy handbook (Qiagen).

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: .. Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of a portion of the C. parvum 18S rRNA gene was used as an internal control for normalization of Cp Clec gene expression.

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: .. At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen). .. RNA quality was analyzed by agarose gel electrophoresis. cDNA was synthesized on 1 μg of total RNA using the QuantyTect reverse transcription kit (Qiagen).

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: .. DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen). .. Reverse transcripts in 250 ng of DNA were quantitated by qPCR with an ABI Prism 7300 (Applied Biosystems) and SYBR green reagent (Applied Biosystems).

    Article Title: Tumor Suppressor Cylindromatosis (CYLD) Controls HIV Transcription in an NF-κB-Dependent Manner
    Article Snippet: .. At 1 day postinfection, cellular DNA was isolated using the DNeasy 96 Blood & Tissue kit (Qiagen) and quantitated using the Quant-iTTM PicoGreen R ds DNA assay kit (Invitrogen) on a Cytofluoro multiwell plate reader series 4000 (Applied Biosystems). ..

    Transfection:

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: A duplicate of each virus sample was heat inactivated at 65°C for 1 h and used to infect cells in parallel as a background control to determine the level of contamination with transfected DNA. .. Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen).

    Purification:

    Article Title: Herpes Simplex Virus ICP27 Induces Cytoplasmic Accumulation of Unspliced Polyadenylated ?-Globin Pre-mRNA in Infected HeLa Cells
    Article Snippet: .. At 6 h postinfection, total RNA was harvested from one dish by using the RNeasy purification kit (Qiagen). .. Cytoplasmic and nuclear RNA fractions were isolated from the second dish of cells according to the RNeasy handbook (Qiagen).

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. After amplification, TCR gene products were run on a 1% agarose gel, and amplicons that were appropriate in size (500 to 700 bp) were extracted from the gel and purified using the NucleoSpin extract II kit (Clontech, Mountain View, CA).

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: .. At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen). .. RNA quality was analyzed by agarose gel electrophoresis. cDNA was synthesized on 1 μg of total RNA using the QuantyTect reverse transcription kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: .. Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. The MuMBC primer (TGGCTCAAACAAGGAGACCT), specific for mouse TRBC (Eurofins, Huntsville, AL), permits sequencing across the CDR3 region of the TCR gene and was used for PCR amplification of rearranged TCR products.

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of Cp Clec and Cp 18S rRNA cDNA was visualized following conventional PCR and 1.5% agarose gel electrophoresis, with quantification by real-time PCR following MIQE guidelines ( ).

    Article Title: Tumor Suppressor Cylindromatosis (CYLD) Controls HIV Transcription in an NF-κB-Dependent Manner
    Article Snippet: Paragraph title: Alu PCR. ... At 1 day postinfection, cellular DNA was isolated using the DNeasy 96 Blood & Tissue kit (Qiagen) and quantitated using the Quant-iTTM PicoGreen R ds DNA assay kit (Invitrogen) on a Cytofluoro multiwell plate reader series 4000 (Applied Biosystems).

    Staining:

    Article Title: Specialization of Hepatitis C Virus Envelope Glycoproteins for B Lymphocytes in Chronically Infected Patients
    Article Snippet: Four days postinfection, cells were lysed (RNeasy minikit; Qiagen), total RNA was extracted, and the levels of cell-associated viral RNA and GAPDH mRNA were determined by one-step RT-qPCR as described above. .. Cells were then stained using a propidium iodide staining solution (Affymetrix) and an anti-CD81 antibody (JS81 clone R-phycoerythrin conjugated at a dilution of 1/100; BD Biosciences) for 15 min and 1 h, respectively, at 4°C, washed two times, and fixed (1% paraformaldehyde [PFA], 1% FBS, PBS).

    Mouse Assay:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: .. Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. The MuMBC primer (TGGCTCAAACAAGGAGACCT), specific for mouse TRBC (Eurofins, Huntsville, AL), permits sequencing across the CDR3 region of the TCR gene and was used for PCR amplification of rearranged TCR products.

    Chromatin Immunoprecipitation:

    Article Title: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus
    Article Snippet: Six and 24 hours postinfection, 3 samples of each time point were harvested and lysis performed directly using RNeasy mini kit protocol (Qiagen Inc., Valencia, CA). .. The chip images were scanned and processed to CEL files using the standard GCOS analysis suite (Affymetrix Inc).

    SDS Page:

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA. .. For Western blot analysis, virus-infected cells or F plasmid-transfected 293 cells was separated on 4% to 20% SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with viral protein-specific antibodies followed by HRP-conjugated secondary antibodies.

    Plasmid Preparation:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. Each TCR gene product was then ligated into the pGEM-T Easy vector and transformed into competent Escherichia coli cells.

    Article Title: Hhex induces promyelocyte self-renewal and cooperates with growth factor independence to cause myeloid leukemia in mice
    Article Snippet: RNA was extracted from GFP+ -sorted LSK cells 2 days postinfection using the RNeasy Plus Minikit (Qiagen). .. Sequencing was performed on an Illumina Hi-Sequation 2000, producing at least 12.4 million 100-bp paired-end (n = 2 per vector) or 100-bp single-end (n = 1 per vector) reads per sample.

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA. .. For Western blot analysis, virus-infected cells or F plasmid-transfected 293 cells was separated on 4% to 20% SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with viral protein-specific antibodies followed by HRP-conjugated secondary antibodies.

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: To control for residual plasmid DNA, 25 μM zidovudine (AZT) was added to one control well 14 h prior to infection. .. DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen).

    Article Title: APOBEC3F and APOBEC3G Inhibit HIV-1 DNA Integration by Different Mechanisms ▿
    Article Snippet: Cells were harvested at 6, 24, and 120 h postinfection, and total cellular DNA was extracted using a QIAamp DNA Blood Mini kit (Qiagen). .. The DNA then was digested with DpnI, which digests methylated plasmid DNA but not viral or cellular DNA, to further reduce plasmid DNA contamination.

    Software:

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA. .. The Northern and Western blots were imaged with ImageQuant LAS 4000 (GE Healthcare Sciences), and RNA or protein band intensity was quantitated using GelQuantNET software (BiochemLabSolution).

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses
    Article Snippet: DENV genomic RNA was extracted from the supernatants of infected cells on day 2 postinfection, using an RNA extraction kit (Qiagen, Hilden, Germany). .. Raw data were analyzed with StepOne 2.2.1 software.

    SYBR Green Assay:

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. SYBR green supermix, (Qiagen) and specific primers (see Table S1 in the supplemental material) were used, and reactions were run on a Stratagene Mx3000P thermocycler, with cycling conditions of 95°C for 15 min and 40 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 30 s. All primers were designed using Primer 3 ( ).

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations
    Article Snippet: Total intracellular DNA of the parental AcMNPV and the escape mutant viruses was extracted at different times postinfection from ∼5 × 105 infected Sf21 cells maintained in a 24-well plate by using the QIAamp DNA blood minikit (Qiagen) according to the manufacturer's recommendations. .. Quantitative real-time PCR of the virus DNA from WT AcMNPV and escape mutants was performed with a Rotor-Gene 6000 series instrument (Corbett Robotics), using SYBR green 1 dye chemistry.

    Article Title: Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx ▿ †
    Article Snippet: DNA was isolated 6, 24, and 48 h postinfection by using a DNAeasy kit (Qiagen). .. Reverse transcripts in 250 ng of DNA were quantitated by qPCR with an ABI Prism 7300 (Applied Biosystems) and SYBR green reagent (Applied Biosystems).

    RNA Extraction:

    Article Title: Bracoviruses Contain a Large Multigene Family Coding for Protein Tyrosine Phosphatases
    Article Snippet: Three days postinfection, cells were harvested ( ) and resuspended in RLT buffer (Qiagen) as per the manufacturer's instructions. .. Total RNA extraction was performed from these lysates with RNeasy (Qiagen) according to the manufacturer′s protocol.

    Article Title: Nucleoside Analogs with Selective Antiviral Activity against Dengue Fever and Japanese Encephalitis Viruses
    Article Snippet: .. DENV genomic RNA was extracted from the supernatants of infected cells on day 2 postinfection, using an RNA extraction kit (Qiagen, Hilden, Germany). .. Next, one-step qRT-PCR was carried out in a final volume of 20 μl containing 5 μl of diluted RNA, 1 μl of probe/primer mix, 10 μl of real-time master mix, and 4 μl of nuclease-free water (PrimerDesign, Southampton, UK).

    Agarose Gel Electrophoresis:

    Article Title: TCRβ Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection
    Article Snippet: Approximately 1,000 CD11b+ Ly6G+ TCRβ+ CD3ε− neutrophils sorted from spleen tissue of moribund C57BL/6 mice on day 6 postinfection with strain ANKA were snap frozen in RNAlater and stored at −80°C until use. mRNA was extracted from TCRβ-expressing neutrophils using the Oligotex direct mRNA minikit (Qiagen, Valencia, CA), and cDNA was then synthesized using the SMARTer PCR cDNA synthesis kit (Clontech, Mountain View, CA). .. After amplification, TCR gene products were run on a 1% agarose gel, and amplicons that were appropriate in size (500 to 700 bp) were extracted from the gel and purified using the NucleoSpin extract II kit (Clontech, Mountain View, CA).

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: .. Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA. .. For Western blot analysis, virus-infected cells or F plasmid-transfected 293 cells was separated on 4% to 20% SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with viral protein-specific antibodies followed by HRP-conjugated secondary antibodies.

    Article Title: Identification and Characterization of Cryptosporidium parvum Clec, a Novel C-Type Lectin Domain-Containing Mucin-Like Glycoprotein
    Article Snippet: Confluent Caco-2 cell monolayers were infected with C. parvum oocysts, and RNA was isolated from infected and uninfected Caco-2 cells at 0, 6, 12, 24, 48, and 72 h postinfection by using an RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen). cDNA from uninfected Caco-2 cells was used as a negative control, and reactions without reverse transcriptase were performed in parallel to control for amplification of contaminating genomic DNA. .. Amplification of Cp Clec and Cp 18S rRNA cDNA was visualized following conventional PCR and 1.5% agarose gel electrophoresis, with quantification by real-time PCR following MIQE guidelines ( ).

    Article Title: Functional Sindbis Virus Replicative Complexes Are Formed at the Plasma Membrane ▿
    Article Snippet: At 6 h postinfection, total RNA was isolated using RNA-Bee reagent (Tel-Test) and additionally purified with the RNeasy mini kit (Qiagen). .. RNA quality was analyzed by agarose gel electrophoresis. cDNA was synthesized on 1 μg of total RNA using the QuantyTect reverse transcription kit (Qiagen).

    Next-Generation Sequencing:

    Article Title: Hhex induces promyelocyte self-renewal and cooperates with growth factor independence to cause myeloid leukemia in mice
    Article Snippet: Paragraph title: Next-generation sequencing ... RNA was extracted from GFP+ -sorted LSK cells 2 days postinfection using the RNeasy Plus Minikit (Qiagen).

    Spectrophotometry:

    Article Title: Mycobacterium tuberculosis Hip1 Dampens Macrophage Proinflammatory Responses by Limiting Toll-Like Receptor 2 Activation ▿
    Article Snippet: At 24 h postinfection, the supernatant was removed and macrophage RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA). .. RNA, cRNA, and fragmented cRNA quality were assessed using a spectrophotometer and bioanalyzer, and samples that passed the quality criteria were used for subsequent processing.

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations
    Article Snippet: Total intracellular DNA of the parental AcMNPV and the escape mutant viruses was extracted at different times postinfection from ∼5 × 105 infected Sf21 cells maintained in a 24-well plate by using the QIAamp DNA blood minikit (Qiagen) according to the manufacturer's recommendations. .. The concentration of DNA was determined at an A 260 by using a NanoDrop ND-1000 UV-visible (UV-Vis) spectrophotometer (NanoDrop Technologies).

    Article Title: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus
    Article Snippet: Six and 24 hours postinfection, 3 samples of each time point were harvested and lysis performed directly using RNeasy mini kit protocol (Qiagen Inc., Valencia, CA). .. The mRNA samples were measured by spectrophotometer for proof of purity and hybridized to HG-U133A cDNA microarray chips (Affymetrix Inc, Santa Clara, CA) by the genomic core laboratory at Memorial Sloan-Kettering Cancer Center (MSKCC).

    Produced:

    Article Title: Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy
    Article Snippet: Total intracellular RNA was isolated from virus-infected cells at an MOI of 3.0 at 20 h postinfection using an RNeasy minikit (Qiagen) and electrophoresed in a 1.5% agarose gel containing 0.5 M formaldehyde, transferred to a nitrocellulose membrane, and then hybridized with a biotin-labeled riboprobe specific to the NDV L, HN, or NP gene or to negative-sense viral genomic RNA. .. The antibodies used in the study were produced in rabbit (polyclonal antibody against anti-NDV F1 or HN recombinant protein or synthetic L protein peptide) or guinea pig antiserum to synthetic peptides (NP, M, and V) or P monoclonal antibody (from Takemasa Sakaguchi of Hiroshima University).

    Concentration Assay:

    Article Title: Selection and Characterization of Autographa californica Multiple Nucleopolyhedrovirus DNA Polymerase Mutations
    Article Snippet: Total intracellular DNA of the parental AcMNPV and the escape mutant viruses was extracted at different times postinfection from ∼5 × 105 infected Sf21 cells maintained in a 24-well plate by using the QIAamp DNA blood minikit (Qiagen) according to the manufacturer's recommendations. .. The concentration of DNA was determined at an A 260 by using a NanoDrop ND-1000 UV-visible (UV-Vis) spectrophotometer (NanoDrop Technologies).

    Lysis:

    Article Title: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus
    Article Snippet: .. Six and 24 hours postinfection, 3 samples of each time point were harvested and lysis performed directly using RNeasy mini kit protocol (Qiagen Inc., Valencia, CA). .. The mRNA samples were measured by spectrophotometer for proof of purity and hybridized to HG-U133A cDNA microarray chips (Affymetrix Inc, Santa Clara, CA) by the genomic core laboratory at Memorial Sloan-Kettering Cancer Center (MSKCC).