polynucleotide kinase buffer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84

    Structured Review

    Thermo Fisher polynucleotide kinase buffer
    Polynucleotide Kinase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polynucleotide kinase buffer/product/Thermo Fisher
    Average 84 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    polynucleotide kinase buffer - by Bioz Stars, 2019-12
    84/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: The Phloem-Delivered RNA Pool Contains Small Noncoding RNAs and Interferes with Translation
    Article Snippet: After centrifugation (16,000 g , 30 min at 4°C), the pellet was washed twice with 70% ethanol/(+10 m m NaOAC, pH 5.2, for native conditions), once with 99% ethanol, air dried, and resuspended in 50 μ L acidic buffer (10 m m NaOAC, pH 5.2, 1 m m EDTA). .. In short, approximately 8 ng PS RNA was mixed with 1× polynucleotide kinase buffer (Ambion) containing 5% PEG6000 (Sigma), 5 n m ATP (Sigma), 0.1 m m ADP (Sigma), 10 μ Ci [ γ 32 P]ATP (NEN), and 10 units T4 polynucleotide kinase (Ambion), incubated at 37°C for 30 min, and passed through a G-25 column (Amersham).

    In Vitro:

    Article Title: The role of the priming loop in Influenza A virus RNA synthesis
    Article Snippet: Paragraph title: In vitro pApG extension assays ... To prepare 5ʹ radiolabelled pApG, we set up a 10-μl kinase reaction containing 1 mM ApG, 0.17 μM [γ-32 P]ATP (3000 Ci/mmole, Perking-Elmer), 1x polynucleotide kinase buffer (Invitrogen), and 1 U/μl T4 polynucleotide kinase (Invitrogen).

    Isolation:

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: Paragraph title: Isolation of total cellular RNA and primer extension analysis ... Ten picomoles of the DNA primer TCGCGTACCACTTTA, complementary to the positions 2563–2577 of 23S rRNA ( E. coli numbering), were 32 P-5′-terminally labeled by incubation in the final volume of 10 μL with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units of polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas).

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: The isolated rRNA fragment (0.1–0.5 μg) was denatured by incubation at 65°C for 5 min and then placed on ice. .. The 3′ mononucleotides were then 5′ 32 P phosphorylated by incubation with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas).

    Article Title: The Phloem-Delivered RNA Pool Contains Small Noncoding RNAs and Interferes with Translation
    Article Snippet: Paragraph title: PS Protein and RNA Isolation and Detection ... In short, approximately 8 ng PS RNA was mixed with 1× polynucleotide kinase buffer (Ambion) containing 5% PEG6000 (Sigma), 5 n m ATP (Sigma), 0.1 m m ADP (Sigma), 10 μ Ci [ γ 32 P]ATP (NEN), and 10 units T4 polynucleotide kinase (Ambion), incubated at 37°C for 30 min, and passed through a G-25 column (Amersham).

    Size-exclusion Chromatography:

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: Ten picomoles of the DNA primer TCGCGTACCACTTTA, complementary to the positions 2563–2577 of 23S rRNA ( E. coli numbering), were 32 P-5′-terminally labeled by incubation in the final volume of 10 μL with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units of polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). .. We combined 0.5 pmol of labeled primer with 2 μg of total cellular RNA in 4.5 μL of hybridization buffer (50 mM HEPES-KOH at pH 7, 100 mM KCl).

    Labeling:

    Article Title: Identification of novel methyltransferases, Bmt5 and Bmt6, responsible for the m3U methylations of 25S rRNA in Saccharomyces cerevisiae
    Article Snippet: Primer extension analysis was carried out following the published protocol with some modifications ( ). .. Ten pico moles of the DNA primer PE-2634-GATTTCTGTTCTCCATGAGC and PE 2843-GGAAGAGCCGACATCGAAGAATC , complementary to the positions 2663–2682 and 2863–2885 of 25S rRNA, respectively, were 32 P-5′terminally labeled by incubation in the final volume of 40 µl with 50 µCi γ-[32 P] ATP and 20 U of polynucleotide kinase in 2 µl of polynucleotide kinase buffer (Fermentas). .. The reaction mixture was next purified using Roche columns (11814419001) to get rid of free γ-[32 P] ATP.

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: Primer extension analysis was carried out following the published protocol ( ) with some modifications. .. Ten picomoles of the DNA primer TCGCGTACCACTTTA, complementary to the positions 2563–2577 of 23S rRNA ( E. coli numbering), were 32 P-5′-terminally labeled by incubation in the final volume of 10 μL with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units of polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). .. We combined 0.5 pmol of labeled primer with 2 μg of total cellular RNA in 4.5 μL of hybridization buffer (50 mM HEPES-KOH at pH 7, 100 mM KCl).

    Article Title: Basal microRNA expression patterns in reward circuitry of selectively bred high-responder and low-responder rats vary by brain region and genotype
    Article Snippet: Reactions were run in 96-well 0.1 ml plates. .. ISH probes were generated from RNA oligonucleotides (Invitrogen, Carlsbad, CA) with minor changes to the labeling reaction as follows: 0.75 μl T4 DNA Kinase, 1 μl 10× Polynucleotide Kinase Buffer (Affymetrix, Santa Clara, CA), 2 μl RNA (20 pmol/μl), and 6.25 μl 33 P-γATP (Perkin Elmer, Waltham, MA) and incubated at 37°C for 30 min ( ). .. Antisense and control (two interior mismatched nucleotides) RNA oligonucleotides (Invitrogen) were synthesized based on sequences obtained from and hybridization specificity as determined through comparative ISHs failing to yield autoradiographic signal above background ( ).

    Article Title: The Phloem-Delivered RNA Pool Contains Small Noncoding RNAs and Interferes with Translation
    Article Snippet: Labeling of PS RNA with [ γ 32 P]ATP was done via a phosphate exchange reaction as described ( ). .. In short, approximately 8 ng PS RNA was mixed with 1× polynucleotide kinase buffer (Ambion) containing 5% PEG6000 (Sigma), 5 n m ATP (Sigma), 0.1 m m ADP (Sigma), 10 μ Ci [ γ 32 P]ATP (NEN), and 10 units T4 polynucleotide kinase (Ambion), incubated at 37°C for 30 min, and passed through a G-25 column (Amersham).

    Marker:

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: The 3′ mononucleotides were then 5′ 32 P phosphorylated by incubation with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). .. The reaction was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform and then incubated with 2 μg of nuclease P1 (USBiological) for 3 h to overnight at 37°C.

    Incubation:

    Article Title: Identification of novel methyltransferases, Bmt5 and Bmt6, responsible for the m3U methylations of 25S rRNA in Saccharomyces cerevisiae
    Article Snippet: Primer extension analysis was carried out following the published protocol with some modifications ( ). .. Ten pico moles of the DNA primer PE-2634-GATTTCTGTTCTCCATGAGC and PE 2843-GGAAGAGCCGACATCGAAGAATC , complementary to the positions 2663–2682 and 2863–2885 of 25S rRNA, respectively, were 32 P-5′terminally labeled by incubation in the final volume of 40 µl with 50 µCi γ-[32 P] ATP and 20 U of polynucleotide kinase in 2 µl of polynucleotide kinase buffer (Fermentas). .. The reaction mixture was next purified using Roche columns (11814419001) to get rid of free γ-[32 P] ATP.

    Article Title: Identification of a novel methyltransferase, Bmt2, responsible for the N-1-methyl-adenosine base modification of 25S rRNA in Saccharomyces cerevisiae
    Article Snippet: Primer extension analysis was carried out following the published protocol with some modifications ( ). .. Ten picomoles of the DNA primer GCACTGGGCAGAAATCACATTGCG, complementary to the positions 2178–2201 of 25S rRNA, was 32 P-5′-terminally labelled by incubation in the final volume of 40 µl with 50 µCi γ- [32 P] ATP and 20 U of polynucleotide kinase in a 2 µl polynucleotide kinase buffer (Fermentas). .. The reaction mixture was then purified using Roche columns (11814419001) to get rid of free γ- [32 P] ATP.

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: Primer extension analysis was carried out following the published protocol ( ) with some modifications. .. Ten picomoles of the DNA primer TCGCGTACCACTTTA, complementary to the positions 2563–2577 of 23S rRNA ( E. coli numbering), were 32 P-5′-terminally labeled by incubation in the final volume of 10 μL with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units of polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). .. We combined 0.5 pmol of labeled primer with 2 μg of total cellular RNA in 4.5 μL of hybridization buffer (50 mM HEPES-KOH at pH 7, 100 mM KCl).

    Article Title: Basal microRNA expression patterns in reward circuitry of selectively bred high-responder and low-responder rats vary by brain region and genotype
    Article Snippet: Reactions were run in 96-well 0.1 ml plates. .. ISH probes were generated from RNA oligonucleotides (Invitrogen, Carlsbad, CA) with minor changes to the labeling reaction as follows: 0.75 μl T4 DNA Kinase, 1 μl 10× Polynucleotide Kinase Buffer (Affymetrix, Santa Clara, CA), 2 μl RNA (20 pmol/μl), and 6.25 μl 33 P-γATP (Perkin Elmer, Waltham, MA) and incubated at 37°C for 30 min ( ). .. Antisense and control (two interior mismatched nucleotides) RNA oligonucleotides (Invitrogen) were synthesized based on sequences obtained from and hybridization specificity as determined through comparative ISHs failing to yield autoradiographic signal above background ( ).

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: The denatured RNA was digested to nucleoside 3′ phosphates with 10 units of RNase T2 (Invitrogen) for 15 min at 37°C. .. The 3′ mononucleotides were then 5′ 32 P phosphorylated by incubation with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). .. The reaction was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform and then incubated with 2 μg of nuclease P1 (USBiological) for 3 h to overnight at 37°C.

    Article Title: The Phloem-Delivered RNA Pool Contains Small Noncoding RNAs and Interferes with Translation
    Article Snippet: Labeling of PS RNA with [ γ 32 P]ATP was done via a phosphate exchange reaction as described ( ). .. In short, approximately 8 ng PS RNA was mixed with 1× polynucleotide kinase buffer (Ambion) containing 5% PEG6000 (Sigma), 5 n m ATP (Sigma), 0.1 m m ADP (Sigma), 10 μ Ci [ γ 32 P]ATP (NEN), and 10 units T4 polynucleotide kinase (Ambion), incubated at 37°C for 30 min, and passed through a G-25 column (Amersham). .. Labeled PS RNA was submitted to denaturing 7 m urea 15% PAGE as described ( ).

    Thin Layer Chromatography:

    Article Title: The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
    Article Snippet: The 3′ mononucleotides were then 5′ 32 P phosphorylated by incubation with 10 μCi (1.7 pmol) γ-[32 P] ATP (6000 Ci/mmol) and 10 units polynucleotide kinase in a 1× polynucleotide kinase buffer (Fermentas). .. The reaction was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform and then incubated with 2 μg of nuclease P1 (USBiological) for 3 h to overnight at 37°C.

    Polyacrylamide Gel Electrophoresis:

    Article Title: The role of the priming loop in Influenza A virus RNA synthesis
    Article Snippet: To prepare 5ʹ radiolabelled pApG, we set up a 10-μl kinase reaction containing 1 mM ApG, 0.17 μM [γ-32 P]ATP (3000 Ci/mmole, Perking-Elmer), 1x polynucleotide kinase buffer (Invitrogen), and 1 U/μl T4 polynucleotide kinase (Invitrogen). .. Kinase reactions were incubated at 37 °C for 1h.

    Modification:

    Article Title: The Phloem-Delivered RNA Pool Contains Small Noncoding RNAs and Interferes with Translation
    Article Snippet: PS RNA was extracted from 250 μ L freshly harvested PS under either fully denaturing conditions with 1 mL Trizol LS (guanidinium thiocyanate-phenol, pH 4.5; Invitrogen) and 200 μ L chloroform as described ( ) or relatively mild (native) phenol conditions following a modified protocol ( , ) by adding 50 μ L 3 m NaOAC, pH 5.2, 200 μ L 1× TE buffer (10 m m Tris, pH 7.4, 1 m m EDTA) to 250 μ L PS and submitting to the standard phenol extraction protocol (25:24:1, pH 5.0 ± 0.2). .. In short, approximately 8 ng PS RNA was mixed with 1× polynucleotide kinase buffer (Ambion) containing 5% PEG6000 (Sigma), 5 n m ATP (Sigma), 0.1 m m ADP (Sigma), 10 μ Ci [ γ 32 P]ATP (NEN), and 10 units T4 polynucleotide kinase (Ambion), incubated at 37°C for 30 min, and passed through a G-25 column (Amersham).

    In Situ Hybridization:

    Article Title: Basal microRNA expression patterns in reward circuitry of selectively bred high-responder and low-responder rats vary by brain region and genotype
    Article Snippet: Reactions were run in 96-well 0.1 ml plates. .. ISH probes were generated from RNA oligonucleotides (Invitrogen, Carlsbad, CA) with minor changes to the labeling reaction as follows: 0.75 μl T4 DNA Kinase, 1 μl 10× Polynucleotide Kinase Buffer (Affymetrix, Santa Clara, CA), 2 μl RNA (20 pmol/μl), and 6.25 μl 33 P-γATP (Perkin Elmer, Waltham, MA) and incubated at 37°C for 30 min ( ). .. Antisense and control (two interior mismatched nucleotides) RNA oligonucleotides (Invitrogen) were synthesized based on sequences obtained from and hybridization specificity as determined through comparative ISHs failing to yield autoradiographic signal above background ( ).

    Derivative Assay:

    Article Title: Basal microRNA expression patterns in reward circuitry of selectively bred high-responder and low-responder rats vary by brain region and genotype
    Article Snippet: ISH probes were generated from RNA oligonucleotides (Invitrogen, Carlsbad, CA) with minor changes to the labeling reaction as follows: 0.75 μl T4 DNA Kinase, 1 μl 10× Polynucleotide Kinase Buffer (Affymetrix, Santa Clara, CA), 2 μl RNA (20 pmol/μl), and 6.25 μl 33 P-γATP (Perkin Elmer, Waltham, MA) and incubated at 37°C for 30 min ( ). .. Antisense and control (two interior mismatched nucleotides) RNA oligonucleotides (Invitrogen) were synthesized based on sequences obtained from and hybridization specificity as determined through comparative ISHs failing to yield autoradiographic signal above background ( ).

    Generated:

    Article Title: Basal microRNA expression patterns in reward circuitry of selectively bred high-responder and low-responder rats vary by brain region and genotype
    Article Snippet: Reactions were run in 96-well 0.1 ml plates. .. ISH probes were generated from RNA oligonucleotides (Invitrogen, Carlsbad, CA) with minor changes to the labeling reaction as follows: 0.75 μl T4 DNA Kinase, 1 μl 10× Polynucleotide Kinase Buffer (Affymetrix, Santa Clara, CA), 2 μl RNA (20 pmol/μl), and 6.25 μl 33 P-γATP (Perkin Elmer, Waltham, MA) and incubated at 37°C for 30 min ( ). .. Antisense and control (two interior mismatched nucleotides) RNA oligonucleotides (Invitrogen) were synthesized based on sequences obtained from and hybridization specificity as determined through comparative ISHs failing to yield autoradiographic signal above background ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher t4 polynucleotide kinase 10 u µl
    T4 Polynucleotide Kinase 10 U µl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase 10 u µl/product/Thermo Fisher
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase 10 u µl - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results