polymerase chain reaction purification kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Qiagen polymerase chain reaction purification kit
    Polymerase Chain Reaction Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction purification kit/product/Qiagen
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction purification kit - by Bioz Stars, 2020-04
    86/100 stars

    Related Products / Commonly Used Together

    400-bp polymerase chain reaction

    Images

    Related Articles

    Clone Assay:

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4). .. The resulting PCR fragment was cloned into the NheI-EcoRI digested pCDNA3.1 plasmid (Invitrogen, Karlsruhe, Germany) to generate pExOVA.

    Amplification:

    Article Title: The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties.
    Article Snippet: .. Amplified products were purified using the PCR purification kit (Qiagen) and sequenced. .. The effect of ion channel inhibitors on PRRSV infection Stock solutions of ammonium chloride, chloroquine, amantadine and verapamil (Sigma) were prepared in water at concentrations of 50 mM, 2 mM, 10 mM and 1 mM, respectively.

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: Paragraph title: 2.5. Chikungunya Virus Genome Amplification, Sequencing, and Phylogenetic Analysis ... The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA).

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: Then the transmembrane domain was amplified from the plasmid pCD-G syn using the forward primer 5 tctcttctttggcagatgtgtttcccctagcgctggatccttcggcgacaccggcctga gcaagaac 3 (3) and the reverse primers 5 ctgcagaattctt atcacttgcccagcctg 3 (4) flanked with EcoRI restriction site. .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4).

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    Polymerase Chain Reaction:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: .. DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen). ..

    Article Title: The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties.
    Article Snippet: .. Amplified products were purified using the PCR purification kit (Qiagen) and sequenced. .. The effect of ion channel inhibitors on PRRSV infection Stock solutions of ammonium chloride, chloroquine, amantadine and verapamil (Sigma) were prepared in water at concentrations of 50 mM, 2 mM, 10 mM and 1 mM, respectively.

    Article Title: Rapid Regeneration and Reuse of Silica Columns from PCR Purification and Gel Extraction Kits
    Article Snippet: .. Establishment of a regeneration method for disposable silica columns from a PCR purification kit To establish the method for regenerating used columns, fresh columns from a PCR purification kit (Qiagen) were initially used to purify a human LIF gene from PCR product. ..

    Article Title: Enhanced Production of ?-Galactosyl Epitopes by Metabolically Engineered Pichia pastoris
    Article Snippet: .. The PCR purification kit, QIAEX II gel extraction kit, and DNA Miniprep spin kit were obtained from Qiagen (Santa Clarita, Calif.). .. UDP- d -[6-3 H]galactose was obtained from Sigma Chemical Co. (St. Louis, Mo.).

    Article Title: Multi-contact 4C: long-molecule sequencing of complex proximity ligation products to uncover local cooperative and competitive chromatin topologies.
    Article Snippet: .. We present the experimental protocol and data analysis toolbox for multi-contact 4C (MC-4C), a new proximity ligation method tailored to study the higher-order chromatin contact patterns of selected genomic sites. ..

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA). ..

    Article Title: Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates.
    Article Snippet: .. DNA sequencing The RT-PCR products were purified using a PCR purification kit (Cat. No. 28104, Qiagen, Valencia, CA) according to the manufacturer's instructions. .. The DNA sequencing was done using an automated DNA sequencer (ABI system 377, Applied Biosystem Inc., Foster City, CA).

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4). .. The resulting PCR fragment was cloned into the NheI-EcoRI digested pCDNA3.1 plasmid (Invitrogen, Karlsruhe, Germany) to generate pExOVA.

    Article Title: Real-Time In Vitro Fluorescence Anisotropy of the Cyanobacterial Circadian Clock
    Article Snippet: .. PCR purification kit, optional (QUIAGEN). ..

    Article Title: RNA-seq in the tetraploid Xenopus laevis enables genome-wide insight in a classic developmental biology model organism
    Article Snippet: .. 10× T4 Ligation Buffer (including ATP; New England Biolabs, NEB) 10 mM dNTP mixture Polynucleotide Kinase (10U/µI; NEB) Klenow (1U/µI; NEB) T4 DNA Polymerase (3U/µI; NEB) PCR Purification Kit and Mini-Elute PCR Purification Columns(Qiagen) Klenow 3’-5’ Exo- (5U/µI; NEB) 10 mM dATP 10× NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , 1mM DTT, pH 7.9) 2× Quick Ligation Buffer (NEB) Genomic Adapter Oligo Mix (Illumina cat. no. 10000531) Pair-end adapters, these can be used for single-end sequencing as well: 5' P- GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT Quick Ligase (NEB, approximately 500 U/µl) AMPure-XP (SPRI) Beads (Agencourt) EB Buffer; 10 mM Tris-Cl, pH 8.5 70% and 80% Ethanol .. Blunt cDNA by incubating 16 µl cDNA with 20 µl 10× T4 Ligation Buffer (including ATP), 2 µl 10 mM dNTPs, 1 µl polynucleotide kinase (NEB), 1 µl Klenow (NEB), and 1.2 µl T4 DNA polymerase (NEB) for 30 minutes at 20°C.

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    Article Title: Arabidopsis serine/threonine/tyrosine protein kinase phosphorylates oil body proteins that regulate oil content in the seeds
    Article Snippet: .. The plasmid miniprep kit, agarose gel elution kit, PCR purification kit, nickel-nitrilotriacetic acid (Ni2+ -NTA) matrix, and RNeasy plant minikit were purchased from Qiagen. .. HCS LipidTOX Red neutral lipid stain and BODIPY® 493/503 (4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene) were from Life Technologies.

    Quantitative RT-PCR:

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: Chikungunya Virus Genome Amplification, Sequencing, and Phylogenetic Analysis Chikungunya positive cases by qRT-PCR were randomly selected for partial sequencing (E1 gene) according to the semi-nested protocol described by Reference [ ] and phylogenetic analysis. .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Rapid Regeneration and Reuse of Silica Columns from PCR Purification and Gel Extraction Kits
    Article Snippet: Establishment of a regeneration method for disposable silica columns from a PCR purification kit To establish the method for regenerating used columns, fresh columns from a PCR purification kit (Qiagen) were initially used to purify a human LIF gene from PCR product. .. To evaluate the efficacy of the DNA elimination treatments, a standard curve was established using the mean qPCR Ct values plotted against the minus Log10 values of different concentrations of LIF DNA (Fig. ).

    Expressing:

    Article Title: Enhanced Production of ?-Galactosyl Epitopes by Metabolically Engineered Pichia pastoris
    Article Snippet: The PCR purification kit, QIAEX II gel extraction kit, and DNA Miniprep spin kit were obtained from Qiagen (Santa Clarita, Calif.). .. A multicopy Pichia expression kit was obtained from Invitrogen Corp. (San Diego, Calif.).

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: To construct the expression plasmid for the membrane-bound OVA protein the OVA gene was amplified using the forward primer 5 agctggctagcaagcttccaccatgaagtgcctgctgtacctggccttcctgt tcatcggcgtgaactgcggatccatgggctccatcgg cgcagcaagcatgga 3 (1) containing the VSV-G leader sequence and flanked with NheI and HindIII restriction enzymes, and the reverse primer 5 ggatccagcgctaggggaaacacatctgccaaagaa gag 3 (2) flanked with BamHI and Eco47III restriction enzymes. .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4).

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. E. coli BL21(DE3), BL21(DE3)pLysS and Rosetta (DE3) expression strains used as a host for protein overexpression and pET-28a vector were obtained from Novagen Inc. Madison, WI, USA.

    Transformation Assay:

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    Over Expression:

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. E. coli BL21(DE3), BL21(DE3)pLysS and Rosetta (DE3) expression strains used as a host for protein overexpression and pET-28a vector were obtained from Novagen Inc. Madison, WI, USA.

    Ligation:

    Article Title: Multi-contact 4C: long-molecule sequencing of complex proximity ligation products to uncover local cooperative and competitive chromatin topologies.
    Article Snippet: We present the experimental protocol and data analysis toolbox for multi-contact 4C (MC-4C), a new proximity ligation method tailored to study the higher-order chromatin contact patterns of selected genomic sites. .. We present the experimental protocol and data analysis toolbox for multi-contact 4C (MC-4C), a new proximity ligation method tailored to study the higher-order chromatin contact patterns of selected genomic sites.

    Article Title: RNA-seq in the tetraploid Xenopus laevis enables genome-wide insight in a classic developmental biology model organism
    Article Snippet: .. 10× T4 Ligation Buffer (including ATP; New England Biolabs, NEB) 10 mM dNTP mixture Polynucleotide Kinase (10U/µI; NEB) Klenow (1U/µI; NEB) T4 DNA Polymerase (3U/µI; NEB) PCR Purification Kit and Mini-Elute PCR Purification Columns(Qiagen) Klenow 3’-5’ Exo- (5U/µI; NEB) 10 mM dATP 10× NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , 1mM DTT, pH 7.9) 2× Quick Ligation Buffer (NEB) Genomic Adapter Oligo Mix (Illumina cat. no. 10000531) Pair-end adapters, these can be used for single-end sequencing as well: 5' P- GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT Quick Ligase (NEB, approximately 500 U/µl) AMPure-XP (SPRI) Beads (Agencourt) EB Buffer; 10 mM Tris-Cl, pH 8.5 70% and 80% Ethanol .. Blunt cDNA by incubating 16 µl cDNA with 20 µl 10× T4 Ligation Buffer (including ATP), 2 µl 10 mM dNTPs, 1 µl polynucleotide kinase (NEB), 1 µl Klenow (NEB), and 1.2 µl T4 DNA polymerase (NEB) for 30 minutes at 20°C.

    Generated:

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA). ..

    DNA Sequencing:

    Article Title: Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates.
    Article Snippet: .. DNA sequencing The RT-PCR products were purified using a PCR purification kit (Cat. No. 28104, Qiagen, Valencia, CA) according to the manufacturer's instructions. .. The DNA sequencing was done using an automated DNA sequencer (ABI system 377, Applied Biosystem Inc., Foster City, CA).

    Sequencing:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: A. hydrophila genomic DNA (gDNA) for sequencing was isolated by using the published protocol with some modifications ( ) or by utilizing a DNeasy tissue kit (Qiagen) for PCR assays. .. DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen).

    Article Title: The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties.
    Article Snippet: Paragraph title: RT-PCR and sequencing ... Amplified products were purified using the PCR purification kit (Qiagen) and sequenced.

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA). ..

    Article Title: Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates.
    Article Snippet: DNA sequencing The RT-PCR products were purified using a PCR purification kit (Cat. No. 28104, Qiagen, Valencia, CA) according to the manufacturer's instructions. .. DNA sequencing Nucleotide sequences of our BoCV isolates were first compared for the S1 subunit sequence of the Mebus calf diarrhea strain (GenBank accession No. M31053), Quebec BCQ 3994 respiratory strain (GenBank accession No. AF 339836), Quebec BCQ 7373 winter dysentery (WD) strain (GenBank accession No. AAG40595), and Quebec BCQ 1523 calf diarrhea (CD) strain (Gen-Bank accession No. AF239307) using the Clustal method of the Lasergene Biocomputing Software (DNASTAR Inc. Madison, WI).

    Article Title: RNA-seq in the tetraploid Xenopus laevis enables genome-wide insight in a classic developmental biology model organism
    Article Snippet: .. 10× T4 Ligation Buffer (including ATP; New England Biolabs, NEB) 10 mM dNTP mixture Polynucleotide Kinase (10U/µI; NEB) Klenow (1U/µI; NEB) T4 DNA Polymerase (3U/µI; NEB) PCR Purification Kit and Mini-Elute PCR Purification Columns(Qiagen) Klenow 3’-5’ Exo- (5U/µI; NEB) 10 mM dATP 10× NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , 1mM DTT, pH 7.9) 2× Quick Ligation Buffer (NEB) Genomic Adapter Oligo Mix (Illumina cat. no. 10000531) Pair-end adapters, these can be used for single-end sequencing as well: 5' P- GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT Quick Ligase (NEB, approximately 500 U/µl) AMPure-XP (SPRI) Beads (Agencourt) EB Buffer; 10 mM Tris-Cl, pH 8.5 70% and 80% Ethanol .. Blunt cDNA by incubating 16 µl cDNA with 20 µl 10× T4 Ligation Buffer (including ATP), 2 µl 10 mM dNTPs, 1 µl polynucleotide kinase (NEB), 1 µl Klenow (NEB), and 1.2 µl T4 DNA polymerase (NEB) for 30 minutes at 20°C.

    DNA Extraction:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: Paragraph title: DNA isolation and PCR assays. ... DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen).

    Mutagenesis:

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: This fragment allows us to answer the questions about this study, which consists of the genotyping of circulating strains and observation of specific modifications, such as the A226V mutation, which allowed the emergence of the Indian Ocean Lineage (IOL). .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA).

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: For the construction of pCD-G mut , a glutamine to asparagine point mutation was introduced at position 117 in the codon-optimized VSV-G gene as described for the wild type VSV-G [18] . .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4).

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: Oligonucleotides for PCR and site-directed mutagenesis were ordered from Integrated DNA Technologies Inc. (Coralville, IA). .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc.

    Isolation:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: A. hydrophila genomic DNA (gDNA) for sequencing was isolated by using the published protocol with some modifications ( ) or by utilizing a DNeasy tissue kit (Qiagen) for PCR assays. .. DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen).

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    Purification:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: .. DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen). ..

    Article Title: The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties.
    Article Snippet: .. Amplified products were purified using the PCR purification kit (Qiagen) and sequenced. .. The effect of ion channel inhibitors on PRRSV infection Stock solutions of ammonium chloride, chloroquine, amantadine and verapamil (Sigma) were prepared in water at concentrations of 50 mM, 2 mM, 10 mM and 1 mM, respectively.

    Article Title: Rapid Regeneration and Reuse of Silica Columns from PCR Purification and Gel Extraction Kits
    Article Snippet: .. Establishment of a regeneration method for disposable silica columns from a PCR purification kit To establish the method for regenerating used columns, fresh columns from a PCR purification kit (Qiagen) were initially used to purify a human LIF gene from PCR product. ..

    Article Title: Enhanced Production of ?-Galactosyl Epitopes by Metabolically Engineered Pichia pastoris
    Article Snippet: .. The PCR purification kit, QIAEX II gel extraction kit, and DNA Miniprep spin kit were obtained from Qiagen (Santa Clarita, Calif.). .. UDP- d -[6-3 H]galactose was obtained from Sigma Chemical Co. (St. Louis, Mo.).

    Article Title: Multi-contact 4C: long-molecule sequencing of complex proximity ligation products to uncover local cooperative and competitive chromatin topologies.
    Article Snippet: .. We present the experimental protocol and data analysis toolbox for multi-contact 4C (MC-4C), a new proximity ligation method tailored to study the higher-order chromatin contact patterns of selected genomic sites. ..

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA). ..

    Article Title: Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates.
    Article Snippet: .. DNA sequencing The RT-PCR products were purified using a PCR purification kit (Cat. No. 28104, Qiagen, Valencia, CA) according to the manufacturer's instructions. .. The DNA sequencing was done using an automated DNA sequencer (ABI system 377, Applied Biosystem Inc., Foster City, CA).

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4). .. The resulting PCR fragment was cloned into the NheI-EcoRI digested pCDNA3.1 plasmid (Invitrogen, Karlsruhe, Germany) to generate pExOVA.

    Article Title: Real-Time In Vitro Fluorescence Anisotropy of the Cyanobacterial Circadian Clock
    Article Snippet: .. PCR purification kit, optional (QUIAGEN). ..

    Article Title: RNA-seq in the tetraploid Xenopus laevis enables genome-wide insight in a classic developmental biology model organism
    Article Snippet: .. 10× T4 Ligation Buffer (including ATP; New England Biolabs, NEB) 10 mM dNTP mixture Polynucleotide Kinase (10U/µI; NEB) Klenow (1U/µI; NEB) T4 DNA Polymerase (3U/µI; NEB) PCR Purification Kit and Mini-Elute PCR Purification Columns(Qiagen) Klenow 3’-5’ Exo- (5U/µI; NEB) 10 mM dATP 10× NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , 1mM DTT, pH 7.9) 2× Quick Ligation Buffer (NEB) Genomic Adapter Oligo Mix (Illumina cat. no. 10000531) Pair-end adapters, these can be used for single-end sequencing as well: 5' P- GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT Quick Ligase (NEB, approximately 500 U/µl) AMPure-XP (SPRI) Beads (Agencourt) EB Buffer; 10 mM Tris-Cl, pH 8.5 70% and 80% Ethanol .. Blunt cDNA by incubating 16 µl cDNA with 20 µl 10× T4 Ligation Buffer (including ATP), 2 µl 10 mM dNTPs, 1 µl polynucleotide kinase (NEB), 1 µl Klenow (NEB), and 1.2 µl T4 DNA polymerase (NEB) for 30 minutes at 20°C.

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    Article Title: Arabidopsis serine/threonine/tyrosine protein kinase phosphorylates oil body proteins that regulate oil content in the seeds
    Article Snippet: .. The plasmid miniprep kit, agarose gel elution kit, PCR purification kit, nickel-nitrilotriacetic acid (Ni2+ -NTA) matrix, and RNeasy plant minikit were purchased from Qiagen. .. HCS LipidTOX Red neutral lipid stain and BODIPY® 493/503 (4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene) were from Life Technologies.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties.
    Article Snippet: Paragraph title: RT-PCR and sequencing ... Amplified products were purified using the PCR purification kit (Qiagen) and sequenced.

    Article Title: Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates.
    Article Snippet: .. DNA sequencing The RT-PCR products were purified using a PCR purification kit (Cat. No. 28104, Qiagen, Valencia, CA) according to the manufacturer's instructions. .. The DNA sequencing was done using an automated DNA sequencer (ABI system 377, Applied Biosystem Inc., Foster City, CA).

    Construct:

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: To construct the expression plasmid for the membrane-bound OVA protein the OVA gene was amplified using the forward primer 5 agctggctagcaagcttccaccatgaagtgcctgctgtacctggccttcctgt tcatcggcgtgaactgcggatccatgggctccatcgg cgcagcaagcatgga 3 (1) containing the VSV-G leader sequence and flanked with NheI and HindIII restriction enzymes, and the reverse primer 5 ggatccagcgctaggggaaacacatctgccaaagaa gag 3 (2) flanked with BamHI and Eco47III restriction enzymes. .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4).

    Gel Extraction:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: .. DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen). ..

    Article Title: Enhanced Production of ?-Galactosyl Epitopes by Metabolically Engineered Pichia pastoris
    Article Snippet: .. The PCR purification kit, QIAEX II gel extraction kit, and DNA Miniprep spin kit were obtained from Qiagen (Santa Clarita, Calif.). .. UDP- d -[6-3 H]galactose was obtained from Sigma Chemical Co. (St. Louis, Mo.).

    Article Title: Following in the Footsteps of the Chikungunya Virus in Brazil: The First Autochthonous Cases in Amapá in 2014 and Its Emergence in Rio de Janeiro during 2016
    Article Snippet: .. The fragments generated were purified using PCR Purification Kit or Gel Extraction Kit (Qiagen, Inc., Germany) and sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction version 3.1 kit (Applied Biosystems® , Foster City, CA, USA). ..

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    IA:

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: Oligonucleotides for PCR and site-directed mutagenesis were ordered from Integrated DNA Technologies Inc. (Coralville, IA). .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc.

    Agarose Gel Electrophoresis:

    Article Title: The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties.
    Article Snippet: PCR was conducted under the following conditions; initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s and extension at 72°C for 1 min, followed by a final extension at 72°C for 10 min. PCR products were analyzed by 0.8% or 1.5% agarose gel electrophoresis depending on size of the fragment. .. Amplified products were purified using the PCR purification kit (Qiagen) and sequenced.

    Article Title: Arabidopsis serine/threonine/tyrosine protein kinase phosphorylates oil body proteins that regulate oil content in the seeds
    Article Snippet: .. The plasmid miniprep kit, agarose gel elution kit, PCR purification kit, nickel-nitrilotriacetic acid (Ni2+ -NTA) matrix, and RNeasy plant minikit were purchased from Qiagen. .. HCS LipidTOX Red neutral lipid stain and BODIPY® 493/503 (4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene) were from Life Technologies.

    Plasmid Preparation:

    Article Title: Cold Shock Exoribonuclease R (VacB) Is Involved in Aeromonas hydrophila Pathogenesis
    Article Snippet: Plasmid DNA was isolated by using a QIAprep spin miniprep kit from Qiagen, Valencia, CA. .. DNA fragments were purified by using a PCR purification kit or gel extraction kit (Qiagen).

    Article Title: Enhancement of immunostimulatory properties of exosomal vaccines by incorporation of fusion-competent G protein of vesicular stomatitis virus.
    Article Snippet: Then the transmembrane domain was amplified from the plasmid pCD-G syn using the forward primer 5 tctcttctttggcagatgtgtttcccctagcgctggatccttcggcgacaccggcctga gcaagaac 3 (3) and the reverse primers 5 ctgcagaattctt atcacttgcccagcctg 3 (4) flanked with EcoRI restriction site. .. The products were purified using a PCR purification kit (Qiagen, Oldenburg, Germany) mixed and used as template for the subsequent PCR using the primers (1) and (4).

    Article Title: Real-Time In Vitro Fluorescence Anisotropy of the Cyanobacterial Circadian Clock
    Article Snippet: Only add DpnI to the products that show bright bands at the correct size of the plasmid. .. PCR purification kit, optional (QUIAGEN).

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: .. QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. Restriction enzymes Nco I, Nde I and Xho I were purchased from New England BioLabs, Inc. Escherichia coli strain XL1-Blue used for transformation and amplification of plasmids and QuikChange mutagenesis kit were purchased from Stratagene, La Jolla, CA.

    Article Title: Arabidopsis serine/threonine/tyrosine protein kinase phosphorylates oil body proteins that regulate oil content in the seeds
    Article Snippet: .. The plasmid miniprep kit, agarose gel elution kit, PCR purification kit, nickel-nitrilotriacetic acid (Ni2+ -NTA) matrix, and RNeasy plant minikit were purchased from Qiagen. .. HCS LipidTOX Red neutral lipid stain and BODIPY® 493/503 (4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene) were from Life Technologies.

    Software:

    Article Title: Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates.
    Article Snippet: DNA sequencing The RT-PCR products were purified using a PCR purification kit (Cat. No. 28104, Qiagen, Valencia, CA) according to the manufacturer's instructions. .. DNA sequencing Nucleotide sequences of our BoCV isolates were first compared for the S1 subunit sequence of the Mebus calf diarrhea strain (GenBank accession No. M31053), Quebec BCQ 3994 respiratory strain (GenBank accession No. AF 339836), Quebec BCQ 7373 winter dysentery (WD) strain (GenBank accession No. AAG40595), and Quebec BCQ 1523 calf diarrhea (CD) strain (Gen-Bank accession No. AF239307) using the Clustal method of the Lasergene Biocomputing Software (DNASTAR Inc. Madison, WI).

    Positron Emission Tomography:

    Article Title: HETEROLOGOUS PRODUCTION, PURIFICATION AND CHARACTERIZATION OF ENZYMATICALLY ACTIVE SINDBIS VIRUS NONSTRUCTURAL PROTEIN NSP1
    Article Snippet: QIAprep spin miniprep kit for plasmid isolation, PCR purification kit and DNA Gel Extraction kit were from Qiagen Inc. .. E. coli BL21(DE3), BL21(DE3)pLysS and Rosetta (DE3) expression strains used as a host for protein overexpression and pET-28a vector were obtained from Novagen Inc. Madison, WI, USA.

    Sample Prep:

    Article Title: Real-Time In Vitro Fluorescence Anisotropy of the Cyanobacterial Circadian Clock
    Article Snippet: Paragraph title: 3.1. DNA Sample Preparation using Quikchange PCR (Time of Completion: 5–6 h) ... PCR purification kit, optional (QUIAGEN).

    Staining:

    Article Title: Arabidopsis serine/threonine/tyrosine protein kinase phosphorylates oil body proteins that regulate oil content in the seeds
    Article Snippet: The plasmid miniprep kit, agarose gel elution kit, PCR purification kit, nickel-nitrilotriacetic acid (Ni2+ -NTA) matrix, and RNeasy plant minikit were purchased from Qiagen. .. HCS LipidTOX Red neutral lipid stain and BODIPY® 493/503 (4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene) were from Life Technologies.

    Permeability:

    Article Title: Multi-contact 4C: long-molecule sequencing of complex proximity ligation products to uncover local cooperative and competitive chromatin topologies.
    Article Snippet: We present the experimental protocol and data analysis toolbox for multi-contact 4C (MC-4C), a new proximity ligation method tailored to study the higher-order chromatin contact patterns of selected genomic sites. .. We present the experimental protocol and data analysis toolbox for multi-contact 4C (MC-4C), a new proximity ligation method tailored to study the higher-order chromatin contact patterns of selected genomic sites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen qiaquick pcr purificatin kit
    Qiaquick Pcr Purificatin Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick pcr purificatin kit/product/Qiagen
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    qiaquick pcr purificatin kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results