poly t oligonucleotide primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Thermo Fisher poly t oligonucleotide primers
    Poly T Oligonucleotide Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/poly t oligonucleotide primers/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    poly t oligonucleotide primers - by Bioz Stars, 2020-04
    92/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: A novel mechanism for variable phenotypic expressivity in Mendelian diseases uncovered by an AU-rich element (ARE)-creating mutation
    Article Snippet: Total RNA from patients and control lymphoblast cell lines were extracted using QIAamp RNA mini Kit (Qiagen inc., Germantown, MD, USA) with DNAase treatment (Qiagen), according to manufacturer’s instructions. cDNA was prepared using the iScript™ cDNA synthesis kit and poly-T oligonucleotide primers (Applied Biosystems, Carlsbad, CA, USA). .. Relative quantification reverse transcription polymerase chain reaction (RT-QPCR) was performed using SYBR green and Applied Biosystems 7500 Fast Real-Time PCR system.

    Article Title: Mutations in SMG9, Encoding an Essential Component of Nonsense-Mediated Decay Machinery, Cause a Multiple Congenital Anomaly Syndrome in Humans and Mice
    Article Snippet: Preparation of the cDNA was carried out with the iScriptTM cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems). .. Relative qRT-PCR for the expression of SMG9 , VIM (MIM: ), TNS3 (MIM: ), EGR1 (MIM: ), UCHL1 (MIM: ), SPINT2 (MIM: ), RORA (MIM: ), and VCAN (MIM: ) was performed with SYBR Green and an Applied Biosystems 7500 Fast Real-Time PCR System ( ).

    Article Title: The functional interactome of PYHIN immune regulators reveals IFIX is a sensor of viral DNA
    Article Snippet: RNA isolation, reverse transcription, and qPCR Total cellular RNA was extracted from cells with TRIzol reagent (Life Technologies) according to the manufacturer's instructions. mRNA then was reverse-transcribed via the poly-A tail using poly(dT) oligonucleotide primers and RETROscript reverse transcription kit (Life Technologies). .. For quantitative PCR experiments, the resulting cDNA was amplified using gene-specific primers and SYBR Green PCR master mix (Life Technologies) with an ABI 7900HT Fast Real-Time PCR System (Life Technologies).

    Amplification:

    Article Title: A novel mechanism for variable phenotypic expressivity in Mendelian diseases uncovered by an AU-rich element (ARE)-creating mutation
    Article Snippet: Total RNA from patients and control lymphoblast cell lines were extracted using QIAamp RNA mini Kit (Qiagen inc., Germantown, MD, USA) with DNAase treatment (Qiagen), according to manufacturer’s instructions. cDNA was prepared using the iScript™ cDNA synthesis kit and poly-T oligonucleotide primers (Applied Biosystems, Carlsbad, CA, USA). .. Primers were designed to flank an intron to specifically amplify cDNA (SLC4A4 5’- ATTCCTTGAACGCCACACAT; 5’- TTTCTGTTCCCTTGCTCCTC), generating 159 bp amplicon.

    Article Title: LPS-responsive beige-like anchor (LRBA) gene mutation in a family with inflammatory bowel disease and combined immunodeficiency
    Article Snippet: The coding sequence of LRBA exon 44 ( ) was amplified by using specially designed primers on genomic DNA. .. The source of RNAwas lymphoblasts extracted with the QIAamp RNA Mini Kit (Qiagen, Germantown, Md) and DNase treated with the RNase-Free DNase Set (Qiagen), according to the manufacturer’s recommendations, and used for cDNA synthesis with the iScript cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems, Carlsbad, Calif).

    Article Title: The functional interactome of PYHIN immune regulators reveals IFIX is a sensor of viral DNA
    Article Snippet: RNA isolation, reverse transcription, and qPCR Total cellular RNA was extracted from cells with TRIzol reagent (Life Technologies) according to the manufacturer's instructions. mRNA then was reverse-transcribed via the poly-A tail using poly(dT) oligonucleotide primers and RETROscript reverse transcription kit (Life Technologies). .. For quantitative PCR experiments, the resulting cDNA was amplified using gene-specific primers and SYBR Green PCR master mix (Life Technologies) with an ABI 7900HT Fast Real-Time PCR System (Life Technologies).

    Isolation:

    Article Title: The functional interactome of PYHIN immune regulators reveals IFIX is a sensor of viral DNA
    Article Snippet: .. RNA isolation, reverse transcription, and qPCR Total cellular RNA was extracted from cells with TRIzol reagent (Life Technologies) according to the manufacturer's instructions. mRNA then was reverse-transcribed via the poly-A tail using poly(dT) oligonucleotide primers and RETROscript reverse transcription kit (Life Technologies). .. For quantitative PCR experiments, the resulting cDNA was amplified using gene-specific primers and SYBR Green PCR master mix (Life Technologies) with an ABI 7900HT Fast Real-Time PCR System (Life Technologies).

    Quantitative RT-PCR:

    Article Title: A novel mechanism for variable phenotypic expressivity in Mendelian diseases uncovered by an AU-rich element (ARE)-creating mutation
    Article Snippet: Total RNA from patients and control lymphoblast cell lines were extracted using QIAamp RNA mini Kit (Qiagen inc., Germantown, MD, USA) with DNAase treatment (Qiagen), according to manufacturer’s instructions. cDNA was prepared using the iScript™ cDNA synthesis kit and poly-T oligonucleotide primers (Applied Biosystems, Carlsbad, CA, USA). .. Relative quantification reverse transcription polymerase chain reaction (RT-QPCR) was performed using SYBR green and Applied Biosystems 7500 Fast Real-Time PCR system.

    Article Title: Mutations in SMG9, Encoding an Essential Component of Nonsense-Mediated Decay Machinery, Cause a Multiple Congenital Anomaly Syndrome in Humans and Mice
    Article Snippet: Paragraph title: Real-Time RT-PCR and Immunoblotting ... Preparation of the cDNA was carried out with the iScriptTM cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A novel mechanism for variable phenotypic expressivity in Mendelian diseases uncovered by an AU-rich element (ARE)-creating mutation
    Article Snippet: Total RNA from patients and control lymphoblast cell lines were extracted using QIAamp RNA mini Kit (Qiagen inc., Germantown, MD, USA) with DNAase treatment (Qiagen), according to manufacturer’s instructions. cDNA was prepared using the iScript™ cDNA synthesis kit and poly-T oligonucleotide primers (Applied Biosystems, Carlsbad, CA, USA). .. Relative quantification reverse transcription polymerase chain reaction (RT-QPCR) was performed using SYBR green and Applied Biosystems 7500 Fast Real-Time PCR system.

    Article Title: LPS-responsive beige-like anchor (LRBA) gene mutation in a family with inflammatory bowel disease and combined immunodeficiency
    Article Snippet: Paragraph title: PCR and RT-PCR ... The source of RNAwas lymphoblasts extracted with the QIAamp RNA Mini Kit (Qiagen, Germantown, Md) and DNase treated with the RNase-Free DNase Set (Qiagen), according to the manufacturer’s recommendations, and used for cDNA synthesis with the iScript cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems, Carlsbad, Calif).

    Article Title: Mutations in SMG9, Encoding an Essential Component of Nonsense-Mediated Decay Machinery, Cause a Multiple Congenital Anomaly Syndrome in Humans and Mice
    Article Snippet: For RT-PCR and relative qRT-PCR, total RNA from affected-individual and control-individual lymphoblastoid cell lines was extracted with the QIAamp RNA Mini Kit (QIAGEN), and DNase was treated by the RNase-Free DNase Set (QIAGEN), according to the manufacturer’s recommendations. .. Preparation of the cDNA was carried out with the iScriptTM cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems).

    Real-time Polymerase Chain Reaction:

    Article Title: A novel mechanism for variable phenotypic expressivity in Mendelian diseases uncovered by an AU-rich element (ARE)-creating mutation
    Article Snippet: Total RNA from patients and control lymphoblast cell lines were extracted using QIAamp RNA mini Kit (Qiagen inc., Germantown, MD, USA) with DNAase treatment (Qiagen), according to manufacturer’s instructions. cDNA was prepared using the iScript™ cDNA synthesis kit and poly-T oligonucleotide primers (Applied Biosystems, Carlsbad, CA, USA). .. Relative quantification reverse transcription polymerase chain reaction (RT-QPCR) was performed using SYBR green and Applied Biosystems 7500 Fast Real-Time PCR system.

    Article Title: Mutations in SMG9, Encoding an Essential Component of Nonsense-Mediated Decay Machinery, Cause a Multiple Congenital Anomaly Syndrome in Humans and Mice
    Article Snippet: Preparation of the cDNA was carried out with the iScriptTM cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems). .. Relative qRT-PCR for the expression of SMG9 , VIM (MIM: ), TNS3 (MIM: ), EGR1 (MIM: ), UCHL1 (MIM: ), SPINT2 (MIM: ), RORA (MIM: ), and VCAN (MIM: ) was performed with SYBR Green and an Applied Biosystems 7500 Fast Real-Time PCR System ( ).

    Article Title: The functional interactome of PYHIN immune regulators reveals IFIX is a sensor of viral DNA
    Article Snippet: .. RNA isolation, reverse transcription, and qPCR Total cellular RNA was extracted from cells with TRIzol reagent (Life Technologies) according to the manufacturer's instructions. mRNA then was reverse-transcribed via the poly-A tail using poly(dT) oligonucleotide primers and RETROscript reverse transcription kit (Life Technologies). .. For quantitative PCR experiments, the resulting cDNA was amplified using gene-specific primers and SYBR Green PCR master mix (Life Technologies) with an ABI 7900HT Fast Real-Time PCR System (Life Technologies).

    Polymerase Chain Reaction:

    Article Title: LPS-responsive beige-like anchor (LRBA) gene mutation in a family with inflammatory bowel disease and combined immunodeficiency
    Article Snippet: Paragraph title: PCR and RT-PCR ... The source of RNAwas lymphoblasts extracted with the QIAamp RNA Mini Kit (Qiagen, Germantown, Md) and DNase treated with the RNase-Free DNase Set (Qiagen), according to the manufacturer’s recommendations, and used for cDNA synthesis with the iScript cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems, Carlsbad, Calif).

    Article Title: The functional interactome of PYHIN immune regulators reveals IFIX is a sensor of viral DNA
    Article Snippet: RNA isolation, reverse transcription, and qPCR Total cellular RNA was extracted from cells with TRIzol reagent (Life Technologies) according to the manufacturer's instructions. mRNA then was reverse-transcribed via the poly-A tail using poly(dT) oligonucleotide primers and RETROscript reverse transcription kit (Life Technologies). .. For quantitative PCR experiments, the resulting cDNA was amplified using gene-specific primers and SYBR Green PCR master mix (Life Technologies) with an ABI 7900HT Fast Real-Time PCR System (Life Technologies).

    Expressing:

    Article Title: Mutations in SMG9, Encoding an Essential Component of Nonsense-Mediated Decay Machinery, Cause a Multiple Congenital Anomaly Syndrome in Humans and Mice
    Article Snippet: Preparation of the cDNA was carried out with the iScriptTM cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems). .. Relative qRT-PCR for the expression of SMG9 , VIM (MIM: ), TNS3 (MIM: ), EGR1 (MIM: ), UCHL1 (MIM: ), SPINT2 (MIM: ), RORA (MIM: ), and VCAN (MIM: ) was performed with SYBR Green and an Applied Biosystems 7500 Fast Real-Time PCR System ( ).

    Sequencing:

    Article Title: LPS-responsive beige-like anchor (LRBA) gene mutation in a family with inflammatory bowel disease and combined immunodeficiency
    Article Snippet: The coding sequence of LRBA exon 44 ( ) was amplified by using specially designed primers on genomic DNA. .. The source of RNAwas lymphoblasts extracted with the QIAamp RNA Mini Kit (Qiagen, Germantown, Md) and DNase treated with the RNase-Free DNase Set (Qiagen), according to the manufacturer’s recommendations, and used for cDNA synthesis with the iScript cDNA synthesis kit and Poly T oligonucleotide primers (Applied Biosystems, Carlsbad, Calif).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher barcode umi poly dt oligo
    Barcode Umi Poly Dt Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcode umi poly dt oligo/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    barcode umi poly dt oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher aidtm m mulv reverse transcriptase
    Aidtm M Mulv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aidtm m mulv reverse transcriptase/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aidtm m mulv reverse transcriptase - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results