pnk mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    T4 Polynucleotide Kinase
    Description:
    T4 Polynucleotide Kinase 2 500 units
    Catalog Number:
    m0201l
    Price:
    228
    Size:
    2 500 units
    Category:
    Polynucleotide Kinases
    Buy from Supplier


    Structured Review

    New England Biolabs pnk mix
    T4 Polynucleotide Kinase
    T4 Polynucleotide Kinase 2 500 units
    https://www.bioz.com/result/pnk mix/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pnk mix - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: Together, these modifications allow for scarless cloning into the pX330 vector. .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA). .. Golden gate cloning was used to insert sgRNA oligos into FgH1tUTG (100 ng) by digesting with BsmbI (cat. no. ER0451; Fermentas, Vilnius, Lithuania) and annealing with T7 ligase (cat. no. M0318S; New England Biolabs) in the thermocycler: 37°C for 5 minutes then 23°C for 5 minutes, 15 cycles, and hold at 4°C.

    Centrifugation:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: The powdered cells were recovered by centrifugation at 4000 g for 15 min at 4 °C, then the supernatant was additionally centrifuged at 16,000 g for 10 min at 4 °C. .. For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB).

    Amplification:

    Article Title: CMV2b-Dependent Regulation of Host Defense Pathways in the Context of Viral Infection
    Article Snippet: The mixture of three 1-kb fragments at the 3′-terminus of each CMV cDNA clone were amplified and labeled with [α-32 P] dCTP was used as probe. .. The mixture of DNA oligonucleotides [ ] specific to CMV RNA3 labeled with [r-32 P] using T4 PNK (NEB, M0201V, Ipswich, MA, USA) was used as probe.

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions. .. The library was amplified with limited cycles of PCR, gel-extracted on an 8% native PAGE gel, and sequenced on an Illumina MiSeq.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: Samples were resolved on a 20% 19:1 acrylamide:bis-acrylamide PAGE gel containing 8 M urea, 89 mM Tris borate and 2 mM EDTA. .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Synthesized:

    Article Title: Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine
    Article Snippet: Firstly, oligo 1, oligo 3, oligo 4 and oligo 5 (150 pmol each) were phosphorylated by 10 units T4 PNK at 37°C for 2 h. The solution was buffer with 1 × ligation buffer (New England Biolabs, Ipswich, MA, USA). .. The control probe was synthesized according to the same procedure, but 5hmC-oligo 1 was replaced with the oligo 1 containing a C or 5mC at the same position of 5hmC.

    Construct:

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: Sequencing libraries were constructed using NEBNext® Small RNA Library Prep Set for Illumina® (NEB, E7330) according to the manufacturer’s instructions. .. The fragmented RNA was end-repaired using T4-polynucletide kinase (T4-PNK; NEB, M0201) by adding 2µl T4-PNK 10X buffer, 2 µl T4-PNK and then incubating the reaction at 37°C for 2h.

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. For library construction, the small RNA library prep kit for Illumina (NEB) was used and the constructed library was sequenced using the 50 bp read recipe on an Illumina Hiseq2500.

    Incubation:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer). .. The product was ligated into the pX330 vector using a single-step digestion-ligation with FastDigest BbsI (Thermo Fisher Scientific) and T4 ligase (New England Biolabs, Inc.).

    Article Title: Simplified ChIP-exo assays
    Article Snippet: .. The kinase reaction (30 µl) containing: 10 U T4 PNK (NEB), 1 × T4 DNA Ligase Buffer (NEB), and 2 × BSA was incubated for 15 min at 37 °C; then washed with 10 mM Tris-HCl, pH 8.0 at 4 °C. .. The λ exonuclease digestion (100 µl) containing: 20 U λ exonuclease (NEB), 1 × λ exonuclease reaction buffer (NEB), 0.1% Triton-X 100, and 5% DMSO was incubated for 30 min at 37 °C; then washed with 10 mM Tris-HCl, pH 8.0 at 4 °C.

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: .. The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking. .. The beads were washed once with PNK buffer and twice with PGB Cell Lysis Buffer (the last wash was rotated for at least 5 min in the cold room).

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: .. For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Article Title: Nucleotide Resolution Comparison of Transcription of Human Cytomegalovirus and Host Genomes Reveals Universal Use of RNA Polymerase II Elongation Control Driven by Dissimilar Core Promoter Elements
    Article Snippet: .. PRO-Seq samples were then incubated at 37°C for 1 h with 80 µl 5/4× T4 polynucleotide kinase (PNK) mix (0.313 U/µl T4 PNK [NEB M0201], 5/4× T4 PNK buffer, 1.25 mM ATP, and 0.625 U/µl SUPERase-In). ..

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK. ..

    Activity Assay:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only. .. Assays for 3′ A-tailing activity were carried out at 37 °C or 65 °C using annealed oligonucleotides in a final concentration of 0.5 µM and 2 units of Taq DNA pol, Klenow Fragment (3′-5′ exo− ) or Hemo KlenTaq (NEB) in 10 µl reaction in the presence of 1x NEBNext End Repair Buffer (NEB) or a 3′ A tailing buffer.

    In Silico:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Small-guide RNAs (sgRNAs) were designed in silico (crispr.mit.edu) based on experimentally determined algorithms described previously by to be targeted at the promoter region or exon 5 and areas measured by ChIP primers. .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Expressing:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: CRISPR/Cas9 To target Ska1 exon 1, the guide 5′-TAATTGTTCCAGATCTGACG-3′ (Ska1 GuideA top) was cloned into the human codon optimized SpCas9 and chimeric guide expression plasmid (pX330; Addgene) using BbsI. .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Modification:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Capillary Gel Electrophoresis Analysis Enzyme modification of the DNA substrates was monitored using fluorescence capillary gel electrophoresis (CE) as described previously . .. Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Transformation Assay:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA). .. The reaction was then transformed into homemade Sbtl3 cells by following manufacturer’s instructions (cat. no. T3001; Zymo Research, Irvine, CA, made from cat. no. C737303; Thermo Scientific), plated on LB-Amp plates at 37°C, and grown overnight.

    Transfection:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer). .. Cells were transfected with 1.5 µg plasmid using Fugene6 (Roche) in 1.5 ml DMEM according to the manufacturer’s instructions.

    Ligation:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer). .. The product was ligated into the pX330 vector using a single-step digestion-ligation with FastDigest BbsI (Thermo Fisher Scientific) and T4 ligase (New England Biolabs, Inc.).

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: Paragraph title: hiCLIP (3′ end RNA dephosphorylation and 1st round of adaptor ligation) ... The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking.

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB). .. For 3′-adapter ligation with T4 RNA ligase, a noncommercial buffer without ATP was made up and 1 μg of the following activated 3′-adapter added: 5′-AppCTGTAGGCACCATCAAT–NH2-3′ (NEB 1315).

    Article Title: Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine
    Article Snippet: .. Firstly, oligo 1, oligo 3, oligo 4 and oligo 5 (150 pmol each) were phosphorylated by 10 units T4 PNK at 37°C for 2 h. The solution was buffer with 1 × ligation buffer (New England Biolabs, Ipswich, MA, USA). ..

    Northern Blot:

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Cell Culture:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Small RNA sequencing G. stearothermophilus was obtained from ATCC and cultured at 55 °C in nutrient broth (3 g beef extract and 5 g peptone per liter water, pH 6.8) to saturation. .. Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions.

    Sequencing:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: For BbsI compatibility, the sequence CACCG was added to the 5′ end (creating 5′-CACCG TAATTGTTCCAGATCTGACG-3′). .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: The sequencing reads were adapter trimmed using the FASTX-Toolkit (fastx_clipper -Q33 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -l 25 -c -n -v -i input_fastq_file) and inserts sized 25nt to 40nt were aligned to reference genome and analyzed as above. .. The fragmented RNA was end-repaired using T4-polynucletide kinase (T4-PNK; NEB, M0201) by adding 2µl T4-PNK 10X buffer, 2 µl T4-PNK and then incubating the reaction at 37°C for 2h.

    Recombinant:

    Article Title: Nucleotide Resolution Comparison of Transcription of Human Cytomegalovirus and Host Genomes Reveals Universal Use of RNA Polymerase II Elongation Control Driven by Dissimilar Core Promoter Elements
    Article Snippet: Finally, samples were incubated at 37°C for 1 h with 10 µl 2× recombinant SAP (rSAP) mix (0.1 U/µl recombinant shrimp alkaline phosphatase [NEB M0371], 2× CutSmart buffer, and 2 U/µl SUPERase-In). .. PRO-Seq samples were then incubated at 37°C for 1 h with 80 µl 5/4× T4 polynucleotide kinase (PNK) mix (0.313 U/µl T4 PNK [NEB M0201], 5/4× T4 PNK buffer, 1.25 mM ATP, and 0.625 U/µl SUPERase-In).

    Nucleic Acid Electrophoresis:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Paragraph title: Capillary Gel Electrophoresis Analysis ... Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    RNA Sequencing Assay:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Paragraph title: Small RNA sequencing ... Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions.

    RNA HS Assay:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Fluorescence:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Capillary Gel Electrophoresis Analysis Enzyme modification of the DNA substrates was monitored using fluorescence capillary gel electrophoresis (CE) as described previously . .. Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: The gels were imaged directly through low fluorescence glass plates (CBS Scientific) using a Typhoon FLA 9000 (GE Healthcare Life Sciences). .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Isolation:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: The recovered ribosome-bound RNA was isolated by using TRIzol and the remaining rRNAs were removed with the Ribo-Zero™ rRNA Removal Kit for Meta-bacteria. .. For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB).

    Article Title: Nucleotide Resolution Comparison of Transcription of Human Cytomegalovirus and Host Genomes Reveals Universal Use of RNA Polymerase II Elongation Control Driven by Dissimilar Core Promoter Elements
    Article Snippet: RNA was isolated with TRIzol LS and precipitated, and pellets were resuspended in 10 µl RNase-free H2 O, incubated at 65°C for 2 min, and snap-cooled on ice. .. PRO-Seq samples were then incubated at 37°C for 1 h with 80 µl 5/4× T4 polynucleotide kinase (PNK) mix (0.313 U/µl T4 PNK [NEB M0201], 5/4× T4 PNK buffer, 1.25 mM ATP, and 0.625 U/µl SUPERase-In).

    Subcloning:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: BsmBI sites (forward, 5′-TCCC-3′; reverse, 5′−AAAC-3′) were added to the CRISPR design to facilitate subcloning into the inducible vector (FgH1tUTG was a gift from Marco Herold [Addgene plasmid 70183]) ( ). .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Labeling:

    Article Title: CMV2b-Dependent Regulation of Host Defense Pathways in the Context of Viral Infection
    Article Snippet: .. The mixture of DNA oligonucleotides [ ] specific to CMV RNA3 labeled with [r-32 P] using T4 PNK (NEB, M0201V, Ipswich, MA, USA) was used as probe. .. RNA blotting signals were detected using ImageQuant TL 7.0 software (GE Healthcare, Cincinnati, OH, USA).

    Purification:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Article Title: Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine
    Article Snippet: Paragraph title: Design, synthesis and purification of X-ds100mers ... Firstly, oligo 1, oligo 3, oligo 4 and oligo 5 (150 pmol each) were phosphorylated by 10 units T4 PNK at 37°C for 2 h. The solution was buffer with 1 × ligation buffer (New England Biolabs, Ipswich, MA, USA).

    Polymerase Chain Reaction:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions. .. The library was amplified with limited cycles of PCR, gel-extracted on an 8% native PAGE gel, and sequenced on an Illumina MiSeq.

    De-Phosphorylation Assay:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: Paragraph title: hiCLIP (3′ end RNA dephosphorylation and 1st round of adaptor ligation) ... The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking.

    CRISPR:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: Paragraph title: CRISPR/Cas9 ... The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: BsmBI sites (forward, 5′-TCCC-3′; reverse, 5′−AAAC-3′) were added to the CRISPR design to facilitate subcloning into the inducible vector (FgH1tUTG was a gift from Marco Herold [Addgene plasmid 70183]) ( ). .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Chromatin Immunoprecipitation:

    Article Title: Simplified ChIP-exo assays
    Article Snippet: Paragraph title: ChIP-exo 3.0 and 3.1 (tagmentation-based version) ... The kinase reaction (30 µl) containing: 10 U T4 PNK (NEB), 1 × T4 DNA Ligase Buffer (NEB), and 2 × BSA was incubated for 15 min at 37 °C; then washed with 10 mM Tris-HCl, pH 8.0 at 4 °C.

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Small-guide RNAs (sgRNAs) were designed in silico (crispr.mit.edu) based on experimentally determined algorithms described previously by to be targeted at the promoter region or exon 5 and areas measured by ChIP primers. .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Plasmid Preparation:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: Together, these modifications allow for scarless cloning into the pX330 vector. .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: BsmBI sites (forward, 5′-TCCC-3′; reverse, 5′−AAAC-3′) were added to the CRISPR design to facilitate subcloning into the inducible vector (FgH1tUTG was a gift from Marco Herold [Addgene plasmid 70183]) ( ). .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Software:

    Article Title: CMV2b-Dependent Regulation of Host Defense Pathways in the Context of Viral Infection
    Article Snippet: The mixture of DNA oligonucleotides [ ] specific to CMV RNA3 labeled with [r-32 P] using T4 PNK (NEB, M0201V, Ipswich, MA, USA) was used as probe. .. RNA blotting signals were detected using ImageQuant TL 7.0 software (GE Healthcare, Cincinnati, OH, USA).

    Ethanol Precipitation:

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Article Title: Library preparation for highly accurate population sequencing of RNA viruses
    Article Snippet: Glycogen, RNA grade (Thermo Scientific, cat. no. R0551) ▴ CRITICAL In our experience, glycogen from other vendors can result in lower yield of nucleic acids after ethanol precipitation. .. T4 polynucleotide kinase, 10,000 U/ml (New England Biolabs, cat. no. M0201S/L) T4 RNA ligase 1, 10,000 U/ml, supplied with 10× T4 RNA ligase buffer and 10 mM ATP (New England Biolabs, cat. no. M0204S/L) Phenol:chloroform:isoamyl alcohol (25:24:1; Invitrogen, cat. no. 15593-031) !

    Produced:

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: Alkaline hydrolysis ladders were produced by incubating 5 µL of RNA substrate (200 nM) in buffer with 5 µL of 50 mM bicarbonate buffer pH 9.2, 1 mM EDTA at 95 °C for 10 min. .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Concentration Assay:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking. .. We ligated the RNA duplexes bound to STAU1 to an equimolar concentration of RNA adaptors A and B.

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only. .. Assays for 3′ A-tailing activity were carried out at 37 °C or 65 °C using annealed oligonucleotides in a final concentration of 0.5 µM and 2 units of Taq DNA pol, Klenow Fragment (3′-5′ exo− ) or Hemo KlenTaq (NEB) in 10 µl reaction in the presence of 1x NEBNext End Repair Buffer (NEB) or a 3′ A tailing buffer.

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Lysis:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking. .. The beads were washed once with PNK buffer and twice with PGB Cell Lysis Buffer (the last wash was rotated for at least 5 min in the cold room).

    Clear Native PAGE:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions. .. The library was amplified with limited cycles of PCR, gel-extracted on an 8% native PAGE gel, and sequenced on an Illumina MiSeq.

    Hood:

    Article Title: Library preparation for highly accurate population sequencing of RNA viruses
    Article Snippet: T4 polynucleotide kinase, 10,000 U/ml (New England Biolabs, cat. no. M0201S/L) T4 RNA ligase 1, 10,000 U/ml, supplied with 10× T4 RNA ligase buffer and 10 mM ATP (New England Biolabs, cat. no. M0204S/L) Phenol:chloroform:isoamyl alcohol (25:24:1; Invitrogen, cat. no. 15593-031) ! .. Wear personal protective equipment and handle it in a fume hood.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs pnk mixture
    Pnk Mixture, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pnk mixture/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pnk mixture - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    New England Biolabs pnk mix
    Pnk Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pnk mix/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pnk mix - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    93
    New England Biolabs pnk reaction mix
    Pnk Reaction Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pnk reaction mix/product/New England Biolabs
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    pnk reaction mix - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    Image Search Results