pmsf  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    PMSF Protease Inhibitor
    Description:
    Thermo Scientific PMSF is a protease inhibitor that reacts with serine residues to inhibit trypsin chymotrypsin thrombin and papain Features of PMSF • Targets serine proteases including trypsin chymotrypsin thrombin and papain • Effective in most protein solutions at 0 1 to 1 mM final concentration • Because PMSF has limited water solubility it must be dissolved in a small amount of solvent such as ethanol methanol or isopropyl alcohol before addition to a buffer PMSF is an abbreviation for phenylmethylsulfonyl fluoride the most common chemical name for this small compound In addition to inhibiting serine proteases PMSF will also inhibit cysteine proteases like papain reversible by DTT treatment and mammalian acetylcholinesterase Properties of PMSF • Synonyms alpha Toluenesulfonyl fluoride Benzylsulfonyl fluoride Phenylmethylsulfonyl fluoride • Formula C6H5CH2SO2F • Molecular weight 174 19 • CAS Number 329 98 6 EC Number 206 350 2 • R S Codes R 25 34 S 26 36 37 39 45 • Storage conditions room temperature in a dry place protected from light • Working solution dissolve PMSF in isopropanol at 1 74 mg mL 10 mM store in aliquots at 20°C Specifications of PMSF Part No 36978 • Appearance white powder • Purity 99 0 • Melting point 90 95°C • Humidity 0 1 Related Products Pierce Protease and Phosphatase Inhibitor Mini Tablets EDTA Free Pierce Protease Inhibitor Mini Tablets EDTA Free
    Catalog Number:
    36978
    Price:
    None
    Category:
    Lab Reagents and Chemicals
    Applications:
    Cell Lysis & Fractionation|Protease and Phosphatase Inhibition|Protein Biology|Protein Purification & Isolation
    Buy from Supplier


    Structured Review

    Thermo Fisher pmsf
    Thermo Scientific PMSF is a protease inhibitor that reacts with serine residues to inhibit trypsin chymotrypsin thrombin and papain Features of PMSF • Targets serine proteases including trypsin chymotrypsin thrombin and papain • Effective in most protein solutions at 0 1 to 1 mM final concentration • Because PMSF has limited water solubility it must be dissolved in a small amount of solvent such as ethanol methanol or isopropyl alcohol before addition to a buffer PMSF is an abbreviation for phenylmethylsulfonyl fluoride the most common chemical name for this small compound In addition to inhibiting serine proteases PMSF will also inhibit cysteine proteases like papain reversible by DTT treatment and mammalian acetylcholinesterase Properties of PMSF • Synonyms alpha Toluenesulfonyl fluoride Benzylsulfonyl fluoride Phenylmethylsulfonyl fluoride • Formula C6H5CH2SO2F • Molecular weight 174 19 • CAS Number 329 98 6 EC Number 206 350 2 • R S Codes R 25 34 S 26 36 37 39 45 • Storage conditions room temperature in a dry place protected from light • Working solution dissolve PMSF in isopropanol at 1 74 mg mL 10 mM store in aliquots at 20°C Specifications of PMSF Part No 36978 • Appearance white powder • Purity 99 0 • Melting point 90 95°C • Humidity 0 1 Related Products Pierce Protease and Phosphatase Inhibitor Mini Tablets EDTA Free Pierce Protease Inhibitor Mini Tablets EDTA Free
    https://www.bioz.com/result/pmsf/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pmsf - by Bioz Stars, 2021-03
    86/100 stars

    Images

    Related Articles

    Lysis:

    Article Title: Dopamine D1 receptor density in the mPFC responds to cognitive demands and receptor turnover contributes to general cognitive ability in mice
    Article Snippet: .. Once the mPFC was extracted it was placed into an ice-cold lysis buffer (10 mM Tris-HCL pH 7.4, 1% (v/v) NP-40, 150 mM NaCl, 5 mM EDTA, 50 mM NaF, 1 mM phenylmethylsulfonyl fluoride; PMSF), containing a protease inhibitor cocktail (Cat# 78430, Thermo Scientific). ..

    Article Title: The Opening of Connexin 43 Hemichannels Alters Hippocampal Astrocyte Function and Neuronal Survival in Prenatally LPS-Exposed Adult Offspring
    Article Snippet: Mice were anesthetized with ketamine/xylazine (10:1 mg/kg of body weight, i.p.) and then perfused and decapitated. .. Afterward the hippocampus was removed and homogenized with an Ultra-Turrax homogenizer in buffer containing Tris-HCl 100 mM pH 7.4, EDTA 5 mM, SDS 1%, PMSF 1 μM and the protease inhibitor cocktail (ratio: 0.1 g hippocampus tissue: 1 ml lysis buffer) (Pierce, Rockford, IL, United States). .. Protein concentrations were determined by using a detergent-compatible Bio-Rad protein assay kit (Bio-Rad, Richmond, CA, United States).

    Article Title: EBP1 nuclear accumulation negatively feeds back on FERONIA-mediated RALF1 signaling
    Article Snippet: The seedlings were washed twice with sterile water, frozen in liquid nitrogen, ground to a fine powder, and homogenized in the nuclear extraction buffer 1 (10 mM Tris-HCL [pH 8.0], 0.4 M sucrose, 10 mM MgCl2 , 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]). .. Nuclei were precipitated by centrifugation in a centrifuge at 4,000 g for 20 minutes, washed with the nuclear extraction buffer 2 (10 mM Tris-HCl [pH 8.0], 0.25 M sucrose, 10 mM MgCl2 , 1% Triton X-100, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]), and lysed in the nuclei lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1% SDS, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]). .. The chromatin solution was diluted 10-fold with ChIP dilution buffer (16.7 mM Tris-HCl [pH 8.0], 167 mM NaCl, 1.1% Triton X-100, 1.2 mM EDTA, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]).

    Article Title: MiR-302a sensitizes leukemia cells to etoposide by targeting Rad52
    Article Snippet: .. Cells were lysed in RIPA lysis buffer(50mM Tris(pH 7.4), 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1mM PMSF and protease inhibitor cocktail) for 30min on ice, protein quantificated with BCA protein assay kit (Thermo Fisher). ..

    Article Title: Polyploidy and Mitotic Cell Death Are Two Distinct HIV-1 Vpr-Driven Outcomes in Renal Tubule Epithelial Cells
    Article Snippet: Doxorubicin and cisplatin were obtained from Sigma. .. Cells were lysed in NP-40 lysis buffer (catalog no. FNN0021; Invitrogen) containing 10 mM phenylmethylsulfonyl fluoride (PMSF) (catalog no. 36978; Thermo Fisher), protease inhibitors (cOmplete Mini protease inhibitor cocktail tablets; catalog no. 11836153001; Roche), and phosphatase inhibitors (Pierce Phosphatase Inhibitor Mini tablets; catalog no. 88667; Thermo Fisher) for 30 min on ice. .. Cell lysates were run through a QIAshredder column (catalog no. 79654; Qiagen) at 14,000 rpm for 2 min. Each experiment was conducted at least three separate times, and representative blots are provided.

    Protease Inhibitor:

    Article Title: Dopamine D1 receptor density in the mPFC responds to cognitive demands and receptor turnover contributes to general cognitive ability in mice
    Article Snippet: .. Once the mPFC was extracted it was placed into an ice-cold lysis buffer (10 mM Tris-HCL pH 7.4, 1% (v/v) NP-40, 150 mM NaCl, 5 mM EDTA, 50 mM NaF, 1 mM phenylmethylsulfonyl fluoride; PMSF), containing a protease inhibitor cocktail (Cat# 78430, Thermo Scientific). ..

    Article Title: The Opening of Connexin 43 Hemichannels Alters Hippocampal Astrocyte Function and Neuronal Survival in Prenatally LPS-Exposed Adult Offspring
    Article Snippet: Mice were anesthetized with ketamine/xylazine (10:1 mg/kg of body weight, i.p.) and then perfused and decapitated. .. Afterward the hippocampus was removed and homogenized with an Ultra-Turrax homogenizer in buffer containing Tris-HCl 100 mM pH 7.4, EDTA 5 mM, SDS 1%, PMSF 1 μM and the protease inhibitor cocktail (ratio: 0.1 g hippocampus tissue: 1 ml lysis buffer) (Pierce, Rockford, IL, United States). .. Protein concentrations were determined by using a detergent-compatible Bio-Rad protein assay kit (Bio-Rad, Richmond, CA, United States).

    Article Title: EBP1 nuclear accumulation negatively feeds back on FERONIA-mediated RALF1 signaling
    Article Snippet: The seedlings were washed twice with sterile water, frozen in liquid nitrogen, ground to a fine powder, and homogenized in the nuclear extraction buffer 1 (10 mM Tris-HCL [pH 8.0], 0.4 M sucrose, 10 mM MgCl2 , 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]). .. Nuclei were precipitated by centrifugation in a centrifuge at 4,000 g for 20 minutes, washed with the nuclear extraction buffer 2 (10 mM Tris-HCl [pH 8.0], 0.25 M sucrose, 10 mM MgCl2 , 1% Triton X-100, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]), and lysed in the nuclei lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1% SDS, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]). .. The chromatin solution was diluted 10-fold with ChIP dilution buffer (16.7 mM Tris-HCl [pH 8.0], 167 mM NaCl, 1.1% Triton X-100, 1.2 mM EDTA, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]).

    Article Title: MiR-302a sensitizes leukemia cells to etoposide by targeting Rad52
    Article Snippet: .. Cells were lysed in RIPA lysis buffer(50mM Tris(pH 7.4), 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1mM PMSF and protease inhibitor cocktail) for 30min on ice, protein quantificated with BCA protein assay kit (Thermo Fisher). ..

    Article Title: Unfractionated and Low Molecular Weight Heparin Reduce Platelet Induced Epithelial-Mesenchymal Transition in Pancreatic and Prostate Cancer Cells
    Article Snippet: Relative quantification of mRNA expression was calculated by the 2−ΔΔC T method. .. Western Blot First, cell pellets obtained by EMT induction experiments were lysed using extraction buffer (Life Technologies, Carlsbad, CA, USA), supplemented with protease inhibitor cocktail (1 g/mL aprotinin, 1 g/mL leupeptin) (Life Technologies) and phenylmethanesulfonylfluoride (0.1 mM PMSF) (Life Technologies), according to manufacturer’s instructions. .. Then supernatants were collected by centrifugation (35,000× g , 15 min, 4 °C) and protein quantification was carried out using a Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Article Title: Polyploidy and Mitotic Cell Death Are Two Distinct HIV-1 Vpr-Driven Outcomes in Renal Tubule Epithelial Cells
    Article Snippet: Doxorubicin and cisplatin were obtained from Sigma. .. Cells were lysed in NP-40 lysis buffer (catalog no. FNN0021; Invitrogen) containing 10 mM phenylmethylsulfonyl fluoride (PMSF) (catalog no. 36978; Thermo Fisher), protease inhibitors (cOmplete Mini protease inhibitor cocktail tablets; catalog no. 11836153001; Roche), and phosphatase inhibitors (Pierce Phosphatase Inhibitor Mini tablets; catalog no. 88667; Thermo Fisher) for 30 min on ice. .. Cell lysates were run through a QIAshredder column (catalog no. 79654; Qiagen) at 14,000 rpm for 2 min. Each experiment was conducted at least three separate times, and representative blots are provided.

    Centrifugation:

    Article Title: EBP1 nuclear accumulation negatively feeds back on FERONIA-mediated RALF1 signaling
    Article Snippet: The seedlings were washed twice with sterile water, frozen in liquid nitrogen, ground to a fine powder, and homogenized in the nuclear extraction buffer 1 (10 mM Tris-HCL [pH 8.0], 0.4 M sucrose, 10 mM MgCl2 , 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]). .. Nuclei were precipitated by centrifugation in a centrifuge at 4,000 g for 20 minutes, washed with the nuclear extraction buffer 2 (10 mM Tris-HCl [pH 8.0], 0.25 M sucrose, 10 mM MgCl2 , 1% Triton X-100, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]), and lysed in the nuclei lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1% SDS, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]). .. The chromatin solution was diluted 10-fold with ChIP dilution buffer (16.7 mM Tris-HCl [pH 8.0], 167 mM NaCl, 1.1% Triton X-100, 1.2 mM EDTA, 0.1 mM PMSF, and protease inhibitor [78430, Thermo Fisher Scientific]).

    BIA-KA:

    Article Title: MiR-302a sensitizes leukemia cells to etoposide by targeting Rad52
    Article Snippet: .. Cells were lysed in RIPA lysis buffer(50mM Tris(pH 7.4), 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1mM PMSF and protease inhibitor cocktail) for 30min on ice, protein quantificated with BCA protein assay kit (Thermo Fisher). ..

    Incubation:

    Article Title: The Cell-Specific Induction of CXC Chemokine Ligand 9 Mediated by IFN-? in Microglia of the Central Nervous System Is Determined by the Myeloid Transcription Factor PU.1 1
    Article Snippet: An aliquot (5 μl) of IP DNA or input control (1 μl) were then subjected to PCR analysis using primers directed against the Cxcl9 gene promoter ( ; upstream - 5′ AGCTTTGACTTGTGAGGAAAGG 3′; downstream - 5′ TATTGAGTCACTGTGTTGGAGTTGA 3′). .. For the preparation of nuclear extracts, cells were washed in 10ml cold PBS, re-suspended in 500μl Buffer A (10 mM HEPES (pH 7.9), 1.5 mM MgCl2 , 10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, protease inhibitors (Invitrogen)) and incubated on ice for 15 min. .. Following this, NP-40 was added to give a final concentration of 0.5% v/v and the cells vortexed for 10 sec. Nuclear material was obtained by centrifugation at 3,800 × g for 20 sec, followed by addition of 150μl Buffer C (20 mM HEPES, 1.5 mM MgCl2 , 420 mM NaCl, 02 mM EDTA, 25% (v/v) Glycerol, 0.5 mM PMSF, protease inhibitors) to re-suspend the nuclear pellet.

    Western Blot:

    Article Title: Unfractionated and Low Molecular Weight Heparin Reduce Platelet Induced Epithelial-Mesenchymal Transition in Pancreatic and Prostate Cancer Cells
    Article Snippet: Relative quantification of mRNA expression was calculated by the 2−ΔΔC T method. .. Western Blot First, cell pellets obtained by EMT induction experiments were lysed using extraction buffer (Life Technologies, Carlsbad, CA, USA), supplemented with protease inhibitor cocktail (1 g/mL aprotinin, 1 g/mL leupeptin) (Life Technologies) and phenylmethanesulfonylfluoride (0.1 mM PMSF) (Life Technologies), according to manufacturer’s instructions. .. Then supernatants were collected by centrifugation (35,000× g , 15 min, 4 °C) and protein quantification was carried out using a Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Cell Culture:

    Article Title: Calmodulin Lobes Facilitate Dimerization and Activation of Estrogen Receptor-α *
    Article Snippet: First, GFP-tagged CaM-F, CaM-N, or CaM-C (or GFP alone) were transfected into HEK-293 cells. .. Cells were cultured at 37 °C for 3 days, then lysed with 500 μl of Buffer A (50 m m Tris-HCl, pH 7.4, 150 m m NaCl, and 1% Triton X-100) containing 1 m m EGTA, 1× Protease & Phosphatase Inhibitor Mixture (Thermo Scientific), and 1 m m PMSF. .. GFP was immunoprecipitated with GFP-Trap_A (anti-GFP VH H conjugated to agarose, ChromoTek) for 3 h at 4 °C, then washed 3 times with Buffer A containing 1 m m EGTA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pmsf
    Pmsf, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmsf/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pmsf - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher protease inhibitor pmsf
    Protease Inhibitor Pmsf, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protease inhibitor pmsf/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    protease inhibitor pmsf - by Bioz Stars, 2021-03
    97/100 stars
      Buy from Supplier

    Image Search Results