Structured Review

TaKaRa plvx ires zsgreen1
Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with <t>pLVX</t> <t>ZsGreen1,</t> pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.
Plvx Ires Zsgreen1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plvx ires zsgreen1/product/TaKaRa
Average 97 stars, based on 10 article reviews
Price from $9.99 to $1999.99
plvx ires zsgreen1 - by Bioz Stars, 2020-01
97/100 stars

Images

1) Product Images from "Selection of an optimal promoter for gene transfer in normal B cells"

Article Title: Selection of an optimal promoter for gene transfer in normal B cells

Journal: Molecular Medicine Reports

doi: 10.3892/mmr.2017.6974

Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with pLVX ZsGreen1, pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.
Figure Legend Snippet: Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with pLVX ZsGreen1, pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.

Techniques Used: Transduction, Modification, Flow Cytometry, Cytometry

2) Product Images from "Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer"

Article Title: Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer

Journal: PLoS ONE

doi: 10.1371/journal.pone.0198347

Generation and characterization of FOLR1-CAR T cells. T cells were obtained from human PBMCs of three healthy donors and the FOLR1-CAR gene was cloned into the pLVX-IRES-GFP vector and the lentivirus infection efficiency was determined. (A) The growth rate of infected or untransduced T cells was measured by CellTiter-Glo assay for 12 days. (B) Lentivirus infection rate was analyzed by GFP fluorescence on day 12 using FACS analysis. (C) Expression of FOLR1-CAR in T cells was measured by western blot analysis. (D-E) The population of T cells was evaluated by FACS analysis using CD3, CD4, and CD8 antibodies on day 12. Experiments were repeated three times with similar results. The data are represented as the mean of luminescence ± SD and positive rate ± SD (%) from triplicate cultures. Statistical analysis was performed using the two-sided unpaired t-test.
Figure Legend Snippet: Generation and characterization of FOLR1-CAR T cells. T cells were obtained from human PBMCs of three healthy donors and the FOLR1-CAR gene was cloned into the pLVX-IRES-GFP vector and the lentivirus infection efficiency was determined. (A) The growth rate of infected or untransduced T cells was measured by CellTiter-Glo assay for 12 days. (B) Lentivirus infection rate was analyzed by GFP fluorescence on day 12 using FACS analysis. (C) Expression of FOLR1-CAR in T cells was measured by western blot analysis. (D-E) The population of T cells was evaluated by FACS analysis using CD3, CD4, and CD8 antibodies on day 12. Experiments were repeated three times with similar results. The data are represented as the mean of luminescence ± SD and positive rate ± SD (%) from triplicate cultures. Statistical analysis was performed using the two-sided unpaired t-test.

Techniques Used: Clone Assay, Plasmid Preparation, Infection, Glo Assay, Fluorescence, FACS, Expressing, Western Blot

3) Product Images from "Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia"

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia

Journal: Cell Death & Disease

doi: 10.1038/cddis.2017.184

Characterization of cultured rat BMMSCs and detection of lentivirus-mediated overexpression of BDNF and VEGF. ( a ) Representative phase-contrast micrographs show the morphology of rat BMMSC cultures at passage 0 (P0) and passage 3 (P3); ( b ) Flow cytometry analysis shows the majority of BMMSCs at P3-expressing stem cells markers CD44 and CD90, and a small portion of cells expressing CD34 and CD44; ( c ) Schematics (on the top) show the expression cassette with either rat brain BDNF exon IV or VEGF-A open reading frame coding sequence followed by an IRES-directed ZsGreen1 and tdTomato fluorescent protein coding sequences in the lentivirus constructs, respectively; fluorescence micrographs (four panels in the bottom) show that transduced BMMSCs co-express both ZsGreen1 (green) and tdTomato (red) fluorescent proteins; ( d ) RT-qPCR results show the relative abundance of BDNF and VEGF mRNAs in un-transduced (naive) BMMSCs as well as 48 h after transduction with an empty lentiviral vector (Lent-vector) or BDNF- VEGF lentivirus-co-transduced (Lenti-B V). Data are depicted as mean±S.D.; ( e ) Western blots of whole-cell lysates detect markedly increased levels of BDNF and VEGF in cells co-transduced with both BDNF- and VEGF-lentiviruses
Figure Legend Snippet: Characterization of cultured rat BMMSCs and detection of lentivirus-mediated overexpression of BDNF and VEGF. ( a ) Representative phase-contrast micrographs show the morphology of rat BMMSC cultures at passage 0 (P0) and passage 3 (P3); ( b ) Flow cytometry analysis shows the majority of BMMSCs at P3-expressing stem cells markers CD44 and CD90, and a small portion of cells expressing CD34 and CD44; ( c ) Schematics (on the top) show the expression cassette with either rat brain BDNF exon IV or VEGF-A open reading frame coding sequence followed by an IRES-directed ZsGreen1 and tdTomato fluorescent protein coding sequences in the lentivirus constructs, respectively; fluorescence micrographs (four panels in the bottom) show that transduced BMMSCs co-express both ZsGreen1 (green) and tdTomato (red) fluorescent proteins; ( d ) RT-qPCR results show the relative abundance of BDNF and VEGF mRNAs in un-transduced (naive) BMMSCs as well as 48 h after transduction with an empty lentiviral vector (Lent-vector) or BDNF- VEGF lentivirus-co-transduced (Lenti-B V). Data are depicted as mean±S.D.; ( e ) Western blots of whole-cell lysates detect markedly increased levels of BDNF and VEGF in cells co-transduced with both BDNF- and VEGF-lentiviruses

Techniques Used: Cell Culture, Over Expression, Flow Cytometry, Cytometry, Expressing, Sequencing, Construct, Fluorescence, Quantitative RT-PCR, Transduction, Plasmid Preparation, Western Blot

4) Product Images from "Selection of an optimal promoter for gene transfer in normal B cells"

Article Title: Selection of an optimal promoter for gene transfer in normal B cells

Journal: Molecular Medicine Reports

doi: 10.3892/mmr.2017.6974

Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with pLVX ZsGreen1, pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.
Figure Legend Snippet: Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with pLVX ZsGreen1, pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.

Techniques Used: Transduction, Modification, Flow Cytometry, Cytometry

Related Articles

Transduction:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Paragraph title: Preparation of BMMSCs, lentiviral constructs, and transduction ... Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China).

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: Paragraph title: Lentiviral transduction of target cells ... The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA).

Clone Assay:

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ]. .. The gene encoding sCD4 (amino acids 1-209 of CD4, UniProtKB P01730, followed by GGGSGAGCCPGCC HHHHHH) and the different signal peptides were synthesized and sequenced by Genscript (Piscataway, United States).

Article Title: FOXA2 alleviates CCl4-induced liver fibrosis by protecting hepatocytes in mice
Article Snippet: For non-specific FOXA2 upregulation in the liver, the FOXA2 gene was cloned into the lentiviral vector pCDH-CMV-MCS-EF1-copGFP (System Biosciences) to generate the lentivirus LV-CMV-FOXA2. .. The CMV promoter of pLVX-IRES-ZsGreen1 (PT4064-5, Clontech) was replaced with the hGFAP promoter to establish the HSC-specific expression lentiviral vector pLVX-GFAP-IRES-ZsGreen1.

Article Title: Control of HIV Infection In Vivo Using Gene Therapy with a Secreted Entry Inhibitor
Article Snippet: pLV-CMV was generated by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA, USA) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP. .. The UCOE (nt 1,397–2,942 of the HNRPA2B1 gene) along with a Cla I site at the 5′ end and nt 2,184–2,378 from pLV-CMV at the 3′ end were synthesized by Genscript (Piscataway, NJ, USA). pLV-UCMV was generated by inserting the UCOE as a Cla I-to-Nde I fragment into the same sites of pLV-CMV.

Article Title: Forced co-expression of IL-21 and IL-7 in whole-cell cancer vaccines promotes antitumor immunity
Article Snippet: Coding sequences of murine Il-21 and Il-7 genes were amplified from C57BL/6 spleen cDNA. .. The two fragments were either directly cloned into a lentiviral vector, pLVX-IRES-Bsd, which was derived from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA USA) by replacing ZsGreen1 coding sequence with that of the blasticidin resistance gene, or first joined by coding sequences of a furin cleavage site and a P2A peptide, and then cloned into the same vector. .. IL-7 signal peptide coding sequence was cloned as forementioned to create the control vector.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: The anti-sense primer, 5′- ATTCGGATCCATGGTTAGTAGTCATCGTA-3′ , carried a BamHI restriction site. .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech). .. The identity of the resulting plasmid, pLVX-IRES-ZsGreen1+Ecrg4, was confirmed by DNA sequencing (Retrogen, San Diego, CA).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. To downregulate miR-211 expression in MSCs, lentivirus-based miR-211 silencing sponge plasmid (miR-211-shRNA) and the control sponge plasmid (miR-211-scramble) were constructed, respectively (GenePharma, Shanghai, People’s Republic of China, ).

Article Title: A Mutant Tat Protein Provides Strong Protection from HIV-1 Infection in Human CD4+ T Cells
Article Snippet: The pGCsamEN-Nullbasic-EGFP construct was made by PCR of Nullbasic-EGFP from pcDNA3.1-Nullbasic-EGFP (Meredith et al. , ), using primers P1 and P2, which introduce unique Not I and Sna BI restriction sites compatible with the multiple cloning site of pGCsamEN ( ). .. Similarly, pGCsamEN-EGFP was made by PCR of an EGFP cassette from pCDN3.1-EGFP, using primers P2 and P3, and pGCsamEN-ZsGreen1 was made by PCR of ZsGreen1 from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), using primers P4 and P5.

Article Title: Lineage mapping and characterization of the native progenitor population in cellular allograft
Article Snippet: To create a plasmid for lentiviral vector production that includes a 24-bp barcode library and a green fluorescent protein (GFP) identifier, we used an 83-bp oligo containing 24 degenerate nucleotide sequence bases, an EcoRI recognition site at the 5′ end and an NheI site at the 3’end as PCR template. .. To construct pLV-library-ZsGreen1, the PCR product was cut with the appropriate restriction enzymes and cloned into pLVX-IRES-ZsGreen1 (Clontech, Palo Alto, CA). .. TOP10 E. coli (Invitrogen, Carlsbad, CA) was transformed with the ligation mix and grown overnight in LB medium in the presence of 100 μg/ml ampicillin.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Paragraph title: Cloning of Lentiviral and Luciferase Vectors and Packaging of Lentivirus ... The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Paragraph title: Cloning of FLAG-RAX ... The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1.

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb). .. The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb).

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb). .. The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb).

Amplification:

Article Title: Forced co-expression of IL-21 and IL-7 in whole-cell cancer vaccines promotes antitumor immunity
Article Snippet: Coding sequences of murine Il-21 and Il-7 genes were amplified from C57BL/6 spleen cDNA. .. The two fragments were either directly cloned into a lentiviral vector, pLVX-IRES-Bsd, which was derived from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA USA) by replacing ZsGreen1 coding sequence with that of the blasticidin resistance gene, or first joined by coding sequences of a furin cleavage site and a P2A peptide, and then cloned into the same vector.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: To engineer the lentivirus plasmid constructs, the coding sequence of human Ecrg4 was PCR amplified from a commercial plasmid containing the full-length human cDNA (Origene, Rockville, MD). .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. To downregulate miR-211 expression in MSCs, lentivirus-based miR-211 silencing sponge plasmid (miR-211-shRNA) and the control sponge plasmid (miR-211-scramble) were constructed, respectively (GenePharma, Shanghai, People’s Republic of China, ).

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Full-length IRF8 coding sequence was amplified by PCR using primers with a 5′ XhoI site (ccgctcgaggccaccatgtgtgaccggaacggc) and a 3′ XbaI site (gctctagattagacggtgatctgttgattttctc). .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

DNA Ligation:

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: IRF8 K79E and IRF8 R289E inserts were excised from pcDNA3.1(+) backbones using EcoRI. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions. .. Unless otherwise indicated, cells were treated with 1000 units/ml IFNβ (PBL), Sendai virus infection, or poly(I:C) transfection for 8 h before lysis.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Full-length IRF8 coding sequence was amplified by PCR using primers with a 5′ XhoI site (ccgctcgaggccaccatgtgtgaccggaacggc) and a 3′ XbaI site (gctctagattagacggtgatctgttgattttctc). .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1. .. To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template.

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Extracted, DNase-treated RNA was then reverse transcribed with the Superscript III system (Invitrogen) using random hexamers according to manufacturers instructions. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1. .. The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche).

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

Synthesized:

Article Title: Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer
Article Snippet: The FOLR1-CAR DNA, which contained the scFv of the FOLR1 antibody, CD28, and CD3ζ, was synthesized from Macrogen (Korea). .. Lentiviral expression vectors, including pLVX-Puro (Cat. #632164) and pLVX-IRES-ZsGreen1 (Cat. #632187), were obtained from Clontech (USA).

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ]. .. The monocistronic vector pLV-CMV-M was generated by deleting the Sac II fragment of pLV-CMV.

Article Title: Control of HIV Infection In Vivo Using Gene Therapy with a Secreted Entry Inhibitor
Article Snippet: pLV-CMV was generated by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA, USA) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP. .. Cloning the Bss HII-to-Bam HI fragment of pHIV-ZsGreen1 into the corresponding sites of pLV-CMV resulted in pLV-EF1α.

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. To downregulate miR-211 expression in MSCs, lentivirus-based miR-211 silencing sponge plasmid (miR-211-shRNA) and the control sponge plasmid (miR-211-scramble) were constructed, respectively (GenePharma, Shanghai, People’s Republic of China, ).

Construct:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Prior to lentivirus transduction, cells at passage 3 were characterized by flow cytometric analysis using a BD FACSCalibur (BD Biosciences, San Jose, CA, USA) after staining with a fluorescein isothiocyanate-labeled specific antibody against CD34, CD44, CD45, or CD90 (BD Pharmingen, Shanghai, China) to determine the nature of cells. .. Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China). .. Rat brain BDNF exon IV and VEGF-A cDNAs were prepared by reverse transcription polymerase chain reaction (RT-PCR).

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA). .. To select GOI-containing cells, either puromycin selection or sorting for fluorescent-positive cells using a FACSAria III cell sorter (BD Biosciences, La Jolla, CA, USA) was performed 7 days post-transduction.

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: 293 T and TZM-bl cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific, Waltham, United States) supplemented with 10 % fetal bovine serum (FBS, Thermo Fisher Scientific) and 1 % Antibiotic-Antimycotic (Thermo Fisher Scientific). .. The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ]. .. The monocistronic vector pLV-CMV-M was generated by deleting the Sac II fragment of pLV-CMV.

Article Title: Screening for inhibitor of episomal DNA identified dicumarol as a hepatitis B virus inhibitor
Article Snippet: All cell lines were cultured at 37°C in 5% CO2 . .. Plasmids were constructed as follows: pLVX-IRES-mCherry or pLVX-IRES-ZsGreen1 (Clontech) was digested using XhoI and NotI, and then firefly or renilla luciferase was inserted into the vector. .. Lentiviruses were produced via the transient transfection of HEK293T cells.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: Paragraph title: Adenoviral and lentiviral constructs ... The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ).

Article Title: A Mutant Tat Protein Provides Strong Protection from HIV-1 Infection in Human CD4+ T Cells
Article Snippet: The pGCsamEN-Nullbasic-EGFP construct was made by PCR of Nullbasic-EGFP from pcDNA3.1-Nullbasic-EGFP (Meredith et al. , ), using primers P1 and P2, which introduce unique Not I and Sna BI restriction sites compatible with the multiple cloning site of pGCsamEN ( ). .. Similarly, pGCsamEN-EGFP was made by PCR of an EGFP cassette from pCDN3.1-EGFP, using primers P2 and P3, and pGCsamEN-ZsGreen1 was made by PCR of ZsGreen1 from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), using primers P4 and P5.

Article Title: Lineage mapping and characterization of the native progenitor population in cellular allograft
Article Snippet: To create a plasmid for lentiviral vector production that includes a 24-bp barcode library and a green fluorescent protein (GFP) identifier, we used an 83-bp oligo containing 24 degenerate nucleotide sequence bases, an EcoRI recognition site at the 5′ end and an NheI site at the 3’end as PCR template. .. To construct pLV-library-ZsGreen1, the PCR product was cut with the appropriate restriction enzymes and cloned into pLVX-IRES-ZsGreen1 (Clontech, Palo Alto, CA). .. TOP10 E. coli (Invitrogen, Carlsbad, CA) was transformed with the ligation mix and grown overnight in LB medium in the presence of 100 μg/ml ampicillin.

Article Title: SHOX2 Overexpression Favors Differentiation of Embryonic Stem Cells into Cardiac Pacemaker Cells, Improving Biological Pacing Ability
Article Snippet: The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen. .. The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb). .. The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb).

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb). .. The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb).

Luciferase:

Article Title: Screening for inhibitor of episomal DNA identified dicumarol as a hepatitis B virus inhibitor
Article Snippet: All cell lines were cultured at 37°C in 5% CO2 . .. Plasmids were constructed as follows: pLVX-IRES-mCherry or pLVX-IRES-ZsGreen1 (Clontech) was digested using XhoI and NotI, and then firefly or renilla luciferase was inserted into the vector. .. Lentiviruses were produced via the transient transfection of HEK293T cells.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Paragraph title: Cloning of Lentiviral and Luciferase Vectors and Packaging of Lentivirus ... The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Infection:

Article Title: Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer
Article Snippet: Paragraph title: Cell transfection and infection ... Lentiviral expression vectors, including pLVX-Puro (Cat. #632164) and pLVX-IRES-ZsGreen1 (Cat. #632187), were obtained from Clontech (USA).

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: These vectors were then used to generate lentivirus particles for infection. .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1.

Expressing:

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: B cells co-cultured with feeder cells formed clumps of proliferating cells that were viable for ≥14 consecutive days ( ). .. To determine the levels of transgene expression in B cells three bicistronic plasmids were used that encode various GFPs under the control of different promoters, namely pGIPZ [cytomegalovirus (CMV) promoter; turbo GFP, which is an improved variant of the green fluorescent protein CopGFP], pLVTHM [elongation factor 1 alpha (EF1α) promoter; GFP) and pLVX-IRES-ZsGreen1 (CMV promoter; ZsGreen1, which is a human codon-optimized variant of ZsGreen) ( ). .. Independent of the vectors used in the present study, a very low level of transgene expression was detected in B cells; expression did not exceed 10%, as assessed with flow cytometry 7 days post-transduction ( ).

Article Title: Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer
Article Snippet: The FOLR1-CAR DNA, which contained the scFv of the FOLR1 antibody, CD28, and CD3ζ, was synthesized from Macrogen (Korea). .. Lentiviral expression vectors, including pLVX-Puro (Cat. #632164) and pLVX-IRES-ZsGreen1 (Cat. #632187), were obtained from Clontech (USA). .. Lentiviral packaging plasmids, including pMDLg/pRRE (Cat. #12251), pRSV-Rev (Cat. #12253), and pMD2.G (Cat. #12259), were purchased from Addgene (USA).

Article Title: FOXA2 alleviates CCl4-induced liver fibrosis by protecting hepatocytes in mice
Article Snippet: For non-specific FOXA2 upregulation in the liver, the FOXA2 gene was cloned into the lentiviral vector pCDH-CMV-MCS-EF1-copGFP (System Biosciences) to generate the lentivirus LV-CMV-FOXA2. .. The CMV promoter of pLVX-IRES-ZsGreen1 (PT4064-5, Clontech) was replaced with the hGFAP promoter to establish the HSC-specific expression lentiviral vector pLVX-GFAP-IRES-ZsGreen1. .. The FOXA2 gene was cloned into the EcoRI and BamHI sites of pLVX-GFAP-IRES-ZsGreen1 to generate lentivirus LVX-GFAP-FOXA2 for specific overexpression of FOXA2 in HSCs.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: The adenovirus expressing green fluorescent protein (ADgfp) was obtained from Vector Biolabs (Philadelphia, PA) and propagated according to the manufacturer's directions. .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ).

Article Title: SHOX2 Overexpression Favors Differentiation of Embryonic Stem Cells into Cardiac Pacemaker Cells, Improving Biological Pacing Ability
Article Snippet: Cells were maintained at 37°C in a humidified atmosphere of 5% CO2 . .. The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen. .. The recombinant target gene was then introduced to an adenovirus vector backbone by Gateway recombination cloning using Gateway-adapted vectors (Invitrogen).

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: All key features of the native pacemaker are reproduced in iSAN cells. .. The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb). .. We utilized ZsGreen1 as the reporter protein for Tbx18-transduced cardiomyocytes.

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: This molecular effect, which is at least partially attributable to transcriptional repression, results in reductions of cell-cell coupling and conduction velocity in cardiomyocyte monolayers. .. The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb). .. We utilized ZsGreen1 as the reporter protein for TBX18 -transduced cardiomyocytes.

Modification:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Cells were re-suspended with Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, Beijing, China) supplemented with 10% non-heat inactivated fetal bovine serum (Thermo Fisher Scientific) and grown in culture flasks in humidified atmosphere containing 5% CO2 at 37 °C. .. Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China).

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA). .. To select GOI-containing cells, either puromycin selection or sorting for fluorescent-positive cells using a FACSAria III cell sorter (BD Biosciences, La Jolla, CA, USA) was performed 7 days post-transduction.

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: 293 T and TZM-bl cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific, Waltham, United States) supplemented with 10 % fetal bovine serum (FBS, Thermo Fisher Scientific) and 1 % Antibiotic-Antimycotic (Thermo Fisher Scientific). .. The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ].

Over Expression:

Article Title: FOXA2 alleviates CCl4-induced liver fibrosis by protecting hepatocytes in mice
Article Snippet: In addition, the human FOXA2 gene was inserted between the MluI and SalI sites of pENN-AVV-TBG-PI-RBG to generate the AAV8-TBG-FOXA2 virus for hepatocyte-specific overexpression of FOXA2. .. The CMV promoter of pLVX-IRES-ZsGreen1 (PT4064-5, Clontech) was replaced with the hGFAP promoter to establish the HSC-specific expression lentiviral vector pLVX-GFAP-IRES-ZsGreen1.

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ).

Chloramphenicol Acetyltransferase Assay:

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Extracted, DNase-treated RNA was then reverse transcribed with the Superscript III system (Invitrogen) using random hexamers according to manufacturers instructions. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1. .. The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche).

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

Derivative Assay:

Article Title: Forced co-expression of IL-21 and IL-7 in whole-cell cancer vaccines promotes antitumor immunity
Article Snippet: Coding sequences of murine Il-21 and Il-7 genes were amplified from C57BL/6 spleen cDNA. .. The two fragments were either directly cloned into a lentiviral vector, pLVX-IRES-Bsd, which was derived from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA USA) by replacing ZsGreen1 coding sequence with that of the blasticidin resistance gene, or first joined by coding sequences of a furin cleavage site and a P2A peptide, and then cloned into the same vector. .. IL-7 signal peptide coding sequence was cloned as forementioned to create the control vector.

Countercurrent Chromatography:

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Extracted, DNase-treated RNA was then reverse transcribed with the Superscript III system (Invitrogen) using random hexamers according to manufacturers instructions. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1. .. The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche).

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

Transfection:

Article Title: Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer
Article Snippet: Paragraph title: Cell transfection and infection ... Lentiviral expression vectors, including pLVX-Puro (Cat. #632164) and pLVX-IRES-ZsGreen1 (Cat. #632187), were obtained from Clontech (USA).

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China). .. Both BDNF (exon IV transcript) and VEGF-A open reading frame sequences were inserted into the vectors through EcoRI and BamHI sites to get pLVX-BDNF-IRES-ZsGreen1 and pLVX-VEGF-IRES-tdTomato constructs.

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: For lentiviral production, HEK-293T cells were seeded into 6-well plates (4×105 /well) and were co-transfected with 2 µg gene-of-interest (GOI)-containing vectors and components of 2nd generation packaging vectors: 1.5 µg psPAX2 packaging vector and 1 µg pMD2.G envelope vector (both vectors were obtained from Professor Didier Trono; École Polytechnique Fédérale de Lausanne, Lausanne, Switzerland), using GeneJuice® transfection reagent (EMD Millipore, Billerica, MA, USA), according to the manufacturer's protocol. .. The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA).

Article Title: FOXA2 alleviates CCl4-induced liver fibrosis by protecting hepatocytes in mice
Article Snippet: The CMV promoter of pLVX-IRES-ZsGreen1 (PT4064-5, Clontech) was replaced with the hGFAP promoter to establish the HSC-specific expression lentiviral vector pLVX-GFAP-IRES-ZsGreen1. .. The FOXA2 gene was cloned into the EcoRI and BamHI sites of pLVX-GFAP-IRES-ZsGreen1 to generate lentivirus LVX-GFAP-FOXA2 for specific overexpression of FOXA2 in HSCs.

Cell Culture:

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA). .. To select GOI-containing cells, either puromycin selection or sorting for fluorescent-positive cells using a FACSAria III cell sorter (BD Biosciences, La Jolla, CA, USA) was performed 7 days post-transduction.

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: 293 T and TZM-bl cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific, Waltham, United States) supplemented with 10 % fetal bovine serum (FBS, Thermo Fisher Scientific) and 1 % Antibiotic-Antimycotic (Thermo Fisher Scientific). .. The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ].

Generated:

Article Title: Control of HIV Infection In Vivo Using Gene Therapy with a Secreted Entry Inhibitor
Article Snippet: UCB samples were collected, and HSPC-containing fractions were purified from these samples as previously described. .. pLV-CMV was generated by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA, USA) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP. .. The UCOE (nt 1,397–2,942 of the HNRPA2B1 gene) along with a Cla I site at the 5′ end and nt 2,184–2,378 from pLV-CMV at the 3′ end were synthesized by Genscript (Piscataway, NJ, USA). pLV-UCMV was generated by inserting the UCOE as a Cla I-to-Nde I fragment into the same sites of pLV-CMV.

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ).

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: A cloning procedure identical to that used to generate pLVX mIRF8 IRES ZsGreen1 (above) was used to generate pLVX mIRF8 K310R IRES ZsGreen1. pLVX mIRF8 K79E IRES ZsGreen1, a plasmid containing the K79E mutation of murine IRF8, and pLVX mIRF8 R289E IRES ZsGreen1, which contains the R289E mutant of murine IRF8, were generated by direct subcloning. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1. .. To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template.

DNA Sequencing:

Article Title: SHOX2 Overexpression Favors Differentiation of Embryonic Stem Cells into Cardiac Pacemaker Cells, Improving Biological Pacing Ability
Article Snippet: The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen. .. LR recombination reaction was performed between the entry clone and the destination vector, pAd/CMV/V5-DEST, to generate the desired adenoviral expression construct, pAd-CMV-SHOX2-IRES-ZsGreen.

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb). .. The recombinant target gene was then introduced to an adenovirus vector backbone by Gateway recombination cloning using Gateway-adapted vectors (Invitrogen). attL and attR recombination reaction was performed between the entry clone and the destination vector, pAd/CMV/V5-DEST (∼36.7 kb), to generate the desired adenoviral expression construct, pAd-CMV- TBX18 -IRES-GFP (∼39.8 kb).

Sequencing:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China). .. Rat brain BDNF exon IV and VEGF-A cDNAs were prepared by reverse transcription polymerase chain reaction (RT-PCR).

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ]. .. The gene encoding sCD4 was preceded by an Eco RI site and followed by a Not I site and cloned as an Eco RI-to-Not I fragment into the multiple cloning site of the bicistronic lentiviral vector pLV-CMV to generate pLV-CMV-sCD4.

Article Title: Control of HIV Infection In Vivo Using Gene Therapy with a Secreted Entry Inhibitor
Article Snippet: pLV-CMV was generated by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA, USA) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP. .. Cloning the Bss HII-to-Bam HI fragment of pHIV-ZsGreen1 into the corresponding sites of pLV-CMV resulted in pLV-EF1α.

Article Title: Forced co-expression of IL-21 and IL-7 in whole-cell cancer vaccines promotes antitumor immunity
Article Snippet: Coding sequences of murine Il-21 and Il-7 genes were amplified from C57BL/6 spleen cDNA. .. The two fragments were either directly cloned into a lentiviral vector, pLVX-IRES-Bsd, which was derived from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA USA) by replacing ZsGreen1 coding sequence with that of the blasticidin resistance gene, or first joined by coding sequences of a furin cleavage site and a P2A peptide, and then cloned into the same vector. .. IL-7 signal peptide coding sequence was cloned as forementioned to create the control vector.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: The sense primer, 5′-AGTCCTCGAGCCCCGCCGCCATGGC-3′ , was designed to retain the original Kozak sequence, with an engineered XhoI restriction site. .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. To downregulate miR-211 expression in MSCs, lentivirus-based miR-211 silencing sponge plasmid (miR-211-shRNA) and the control sponge plasmid (miR-211-scramble) were constructed, respectively (GenePharma, Shanghai, People’s Republic of China, ).

Article Title: Lineage mapping and characterization of the native progenitor population in cellular allograft
Article Snippet: To create a plasmid for lentiviral vector production that includes a 24-bp barcode library and a green fluorescent protein (GFP) identifier, we used an 83-bp oligo containing 24 degenerate nucleotide sequence bases, an EcoRI recognition site at the 5′ end and an NheI site at the 3’end as PCR template. .. To construct pLV-library-ZsGreen1, the PCR product was cut with the appropriate restriction enzymes and cloned into pLVX-IRES-ZsGreen1 (Clontech, Palo Alto, CA).

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Full-length IRF8 coding sequence was amplified by PCR using primers with a 5′ XhoI site (ccgctcgaggccaccatgtgtgaccggaacggc) and a 3′ XbaI site (gctctagattagacggtgatctgttgattttctc). .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Extracted, DNase-treated RNA was then reverse transcribed with the Superscript III system (Invitrogen) using random hexamers according to manufacturers instructions. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1. .. The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche).

Recombinant:

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Replication-deficient, VSV-pseudotyped recombinant lentivirus was produced by cotransfection of pLVX IRES ZsGreen1-derived plasmids with the packaging plasmid pCMV-dR8.74 (Addgene) and the pseudotyping plasmid pVSV-G (Clontech) using calcium phosphate into HEK293T cells ( ). .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1.

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb). .. The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb).

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb). .. The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb).

Cellular Antioxidant Activity Assay:

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Extracted, DNase-treated RNA was then reverse transcribed with the Superscript III system (Invitrogen) using random hexamers according to manufacturers instructions. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1. .. The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche).

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

Molecular Cloning:

Article Title: SHOX2 Overexpression Favors Differentiation of Embryonic Stem Cells into Cardiac Pacemaker Cells, Improving Biological Pacing Ability
Article Snippet: Paragraph title: Molecular Cloning and Adenovirus Purification ... The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen.

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: Paragraph title: Molecular cloning, adenovirus construction and purification ... The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb).

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: Paragraph title: Molecular Cloning ... The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb).

Mutagenesis:

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: A cloning procedure identical to that used to generate pLVX mIRF8 IRES ZsGreen1 (above) was used to generate pLVX mIRF8 K310R IRES ZsGreen1. pLVX mIRF8 K79E IRES ZsGreen1, a plasmid containing the K79E mutation of murine IRF8, and pLVX mIRF8 R289E IRES ZsGreen1, which contains the R289E mutant of murine IRF8, were generated by direct subcloning. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1. .. To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template.

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Paragraph title: Mutation of FLAG-RAX ... The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1.

Isolation:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Isolation and cultivation of BMMSCs were conducted as previously described with a slight modification. .. Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China).

Article Title: Lineage mapping and characterization of the native progenitor population in cellular allograft
Article Snippet: To construct pLV-library-ZsGreen1, the PCR product was cut with the appropriate restriction enzymes and cloned into pLVX-IRES-ZsGreen1 (Clontech, Palo Alto, CA). .. TOP10 E. coli (Invitrogen, Carlsbad, CA) was transformed with the ligation mix and grown overnight in LB medium in the presence of 100 μg/ml ampicillin.

Subcloning:

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: A cloning procedure identical to that used to generate pLVX mIRF8 IRES ZsGreen1 (above) was used to generate pLVX mIRF8 K310R IRES ZsGreen1. pLVX mIRF8 K79E IRES ZsGreen1, a plasmid containing the K79E mutation of murine IRF8, and pLVX mIRF8 R289E IRES ZsGreen1, which contains the R289E mutant of murine IRF8, were generated by direct subcloning. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1. .. To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template.

Flow Cytometry:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Prior to lentivirus transduction, cells at passage 3 were characterized by flow cytometric analysis using a BD FACSCalibur (BD Biosciences, San Jose, CA, USA) after staining with a fluorescein isothiocyanate-labeled specific antibody against CD34, CD44, CD45, or CD90 (BD Pharmingen, Shanghai, China) to determine the nature of cells. .. Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China).

Purification:

Article Title: FOXA2 alleviates CCl4-induced liver fibrosis by protecting hepatocytes in mice
Article Snippet: A replication-incompetent AAV8-TBG-Cre virus with Cre expression under the control of TBG promoter was packaged and purified by Biowit biotechnologies (Shenzhen, China). .. The CMV promoter of pLVX-IRES-ZsGreen1 (PT4064-5, Clontech) was replaced with the hGFAP promoter to establish the HSC-specific expression lentiviral vector pLVX-GFAP-IRES-ZsGreen1.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: The anti-sense primer, 5′- ATTCGGATCCATGGTTAGTAGTCATCGTA-3′ , carried a BamHI restriction site. .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech). .. The identity of the resulting plasmid, pLVX-IRES-ZsGreen1+Ecrg4, was confirmed by DNA sequencing (Retrogen, San Diego, CA).

Article Title: SHOX2 Overexpression Favors Differentiation of Embryonic Stem Cells into Cardiac Pacemaker Cells, Improving Biological Pacing Ability
Article Snippet: Paragraph title: Molecular Cloning and Adenovirus Purification ... The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen.

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: Paragraph title: Molecular cloning, adenovirus construction and purification ... The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb).

Polymerase Chain Reaction:

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: The anti-sense primer, 5′- ATTCGGATCCATGGTTAGTAGTCATCGTA-3′ , carried a BamHI restriction site. .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech). .. The identity of the resulting plasmid, pLVX-IRES-ZsGreen1+Ecrg4, was confirmed by DNA sequencing (Retrogen, San Diego, CA).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. To downregulate miR-211 expression in MSCs, lentivirus-based miR-211 silencing sponge plasmid (miR-211-shRNA) and the control sponge plasmid (miR-211-scramble) were constructed, respectively (GenePharma, Shanghai, People’s Republic of China, ).

Article Title: A Mutant Tat Protein Provides Strong Protection from HIV-1 Infection in Human CD4+ T Cells
Article Snippet: The pGCsamEN-Nullbasic-EGFP construct was made by PCR of Nullbasic-EGFP from pcDNA3.1-Nullbasic-EGFP (Meredith et al. , ), using primers P1 and P2, which introduce unique Not I and Sna BI restriction sites compatible with the multiple cloning site of pGCsamEN ( ). .. Similarly, pGCsamEN-EGFP was made by PCR of an EGFP cassette from pCDN3.1-EGFP, using primers P2 and P3, and pGCsamEN-ZsGreen1 was made by PCR of ZsGreen1 from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), using primers P4 and P5. .. A precursor plasmid, pcDNA3.1-Nullbasic-ZsGreen1 was constructed by PCR of pLVX-ZsGreen, using primers P6 and P7, which introduce unique Xho I and Xba I restriction to replace EGFP in pCDN3.1-NB-EGFP with ZsGreen1.

Article Title: Lineage mapping and characterization of the native progenitor population in cellular allograft
Article Snippet: To create a plasmid for lentiviral vector production that includes a 24-bp barcode library and a green fluorescent protein (GFP) identifier, we used an 83-bp oligo containing 24 degenerate nucleotide sequence bases, an EcoRI recognition site at the 5′ end and an NheI site at the 3’end as PCR template. .. To construct pLV-library-ZsGreen1, the PCR product was cut with the appropriate restriction enzymes and cloned into pLVX-IRES-ZsGreen1 (Clontech, Palo Alto, CA). .. TOP10 E. coli (Invitrogen, Carlsbad, CA) was transformed with the ligation mix and grown overnight in LB medium in the presence of 100 μg/ml ampicillin.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Full-length IRF8 coding sequence was amplified by PCR using primers with a 5′ XhoI site (ccgctcgaggccaccatgtgtgaccggaacggc) and a 3′ XbaI site (gctctagattagacggtgatctgttgattttctc). .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1. .. To generate pLVX mIRF8 K310R IRES ZsGreen1, a plasmid containing the K310R mutant of murine IRF8, a pcDNA3.1IRF8 K310R construct was used as a PCR template.

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: Extracted, DNase-treated RNA was then reverse transcribed with the Superscript III system (Invitrogen) using random hexamers according to manufacturers instructions. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1. .. The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche).

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

Selection:

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA). .. The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA).

Cotransfection:

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Replication-deficient, VSV-pseudotyped recombinant lentivirus was produced by cotransfection of pLVX IRES ZsGreen1-derived plasmids with the packaging plasmid pCMV-dR8.74 (Addgene) and the pseudotyping plasmid pVSV-G (Clontech) using calcium phosphate into HEK293T cells ( ). .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1.

Activated Clotting Time Assay:

Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
Article Snippet: The oligonucleotides AGC TTG GTA CCA TGG ACT ACA AGG ACG ATG ACG ATA AGC ATG and GAT CCA TGC TTA TCG TCA TCG TCC TTG TAG TCC ATG GTA CCA were annealed and ligated into HindIII and BamHI digested pcDNA3 (Invitrogen) using Rapid DNA Ligation Kit (Roche) to generate pcDNA3-FLAG. .. The resulting cDNA was used to PCR the coding sequence of RAX using the primers: 5′ AGT AGT GGA TCC ATG TCC CAT AGC AGG C and 3′ AGT AGT TCT AGA CTA CTT TCT TTC TGC TAT TAT C with Expand High Fidelity PCR System (Roche), the PCR product was then digested with BamHI and XbaI (New England Biolabs) and ligated into BamHI-XbaI digested pcDNA3-FLAG with Rapid DNA Ligation Kit (Roche), this clone was designated pcDNA3-FLAG-RAX. pcDNA3-FLAG-RAX was used as a template in a PCR reaction using the primers: 5′ 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX-IRES-ZsGreen1.

Plasmid Preparation:

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: For lentiviral production, HEK-293T cells were seeded into 6-well plates (4×105 /well) and were co-transfected with 2 µg gene-of-interest (GOI)-containing vectors and components of 2nd generation packaging vectors: 1.5 µg psPAX2 packaging vector and 1 µg pMD2.G envelope vector (both vectors were obtained from Professor Didier Trono; École Polytechnique Fédérale de Lausanne, Lausanne, Switzerland), using GeneJuice® transfection reagent (EMD Millipore, Billerica, MA, USA), according to the manufacturer's protocol. .. The following lentiviral vectors were used in this study: pLVX–IRES-Puro and pLVX-IRES-ZsGreen1 (both from Clontech, Takara Bio Europe), pGIPZ (Open Biosystems; GE Healthcare Life Sciences), pLVTHM (AddGene, Inc., Cambridge, MA, USA).

Article Title: Lentiviral expression system for the purification of secreted proteins from human cell cultures
Article Snippet: 293 T and TZM-bl cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific, Waltham, United States) supplemented with 10 % fetal bovine serum (FBS, Thermo Fisher Scientific) and 1 % Antibiotic-Antimycotic (Thermo Fisher Scientific). .. The self-inactivating bicistronic lentiviral vector pLV-CMV was constructed by replacing the Pst I-to-Nhe I fragment of pLVX-IRES-ZsGreen1 (Clontech, Mountain View California, United States) with the compatible Nsi I-to-Avr II fragment from pLJM1-EGFP [ ]. .. The monocistronic vector pLV-CMV-M was generated by deleting the Sac II fragment of pLV-CMV.

Article Title: FOXA2 alleviates CCl4-induced liver fibrosis by protecting hepatocytes in mice
Article Snippet: For non-specific FOXA2 upregulation in the liver, the FOXA2 gene was cloned into the lentiviral vector pCDH-CMV-MCS-EF1-copGFP (System Biosciences) to generate the lentivirus LV-CMV-FOXA2. .. The CMV promoter of pLVX-IRES-ZsGreen1 (PT4064-5, Clontech) was replaced with the hGFAP promoter to establish the HSC-specific expression lentiviral vector pLVX-GFAP-IRES-ZsGreen1. .. The FOXA2 gene was cloned into the EcoRI and BamHI sites of pLVX-GFAP-IRES-ZsGreen1 to generate lentivirus LVX-GFAP-FOXA2 for specific overexpression of FOXA2 in HSCs.

Article Title: Screening for inhibitor of episomal DNA identified dicumarol as a hepatitis B virus inhibitor
Article Snippet: All cell lines were cultured at 37°C in 5% CO2 . .. Plasmids were constructed as follows: pLVX-IRES-mCherry or pLVX-IRES-ZsGreen1 (Clontech) was digested using XhoI and NotI, and then firefly or renilla luciferase was inserted into the vector. .. Lentiviruses were produced via the transient transfection of HEK293T cells.

Article Title: Forced co-expression of IL-21 and IL-7 in whole-cell cancer vaccines promotes antitumor immunity
Article Snippet: Coding sequences of murine Il-21 and Il-7 genes were amplified from C57BL/6 spleen cDNA. .. The two fragments were either directly cloned into a lentiviral vector, pLVX-IRES-Bsd, which was derived from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA USA) by replacing ZsGreen1 coding sequence with that of the blasticidin resistance gene, or first joined by coding sequences of a furin cleavage site and a P2A peptide, and then cloned into the same vector. .. IL-7 signal peptide coding sequence was cloned as forementioned to create the control vector.

Article Title: Ecrg4 Attenuates the Inflammatory Proliferative Response of Mucosal Epithelial Cells to Infection
Article Snippet: To engineer the lentivirus plasmid constructs, the coding sequence of human Ecrg4 was PCR amplified from a commercial plasmid containing the full-length human cDNA (Origene, Rockville, MD). .. The PCR products were purified and cloned into pLVX-IRES-ZsGreen1 (Clontech).

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: For miR-211 overexpression in MSCs, we constructed lentivirus that contained the miR-211 expressing plasmid (miR-211-over), while an empty plasmid served as control (miR-211-control). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ).

Article Title: A Mutant Tat Protein Provides Strong Protection from HIV-1 Infection in Human CD4+ T Cells
Article Snippet: The plasmid pGCsamEN has been described (Treisman et al. , ). .. Similarly, pGCsamEN-EGFP was made by PCR of an EGFP cassette from pCDN3.1-EGFP, using primers P2 and P3, and pGCsamEN-ZsGreen1 was made by PCR of ZsGreen1 from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), using primers P4 and P5.

Article Title: Lineage mapping and characterization of the native progenitor population in cellular allograft
Article Snippet: Paragraph title: LOLIG Plasmid construction ... To construct pLV-library-ZsGreen1, the PCR product was cut with the appropriate restriction enzymes and cloned into pLVX-IRES-ZsGreen1 (Clontech, Palo Alto, CA).

Article Title: SHOX2 Overexpression Favors Differentiation of Embryonic Stem Cells into Cardiac Pacemaker Cells, Improving Biological Pacing Ability
Article Snippet: Cells were maintained at 37°C in a humidified atmosphere of 5% CO2 . .. The human SHOX2 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech) to create pLV-Tbx18-IRES-ZsGreen. .. The recombinant target gene was then introduced to an adenovirus vector backbone by Gateway recombination cloning using Gateway-adapted vectors (Invitrogen).

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: A cloning procedure identical to that used to generate pLVX mIRF8 IRES ZsGreen1 (above) was used to generate pLVX mIRF8 K310R IRES ZsGreen1. pLVX mIRF8 K79E IRES ZsGreen1, a plasmid containing the K79E mutation of murine IRF8, and pLVX mIRF8 R289E IRES ZsGreen1, which contains the R289E mutant of murine IRF8, were generated by direct subcloning. .. The released products were ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA ligation kit (Roche Applied Science) as per the manufacturer's instructions.

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Replication-deficient, VSV-pseudotyped recombinant lentivirus was produced by cotransfection of pLVX IRES ZsGreen1-derived plasmids with the packaging plasmid pCMV-dR8.74 (Addgene) and the pseudotyping plasmid pVSV-G (Clontech) using calcium phosphate into HEK293T cells ( ). .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1.

Article Title: Transcription factor-driven conversion of quiescent cardiomyocytes to pacemaker cells
Article Snippet: All key features of the native pacemaker are reproduced in iSAN cells. .. The human TBX18 gene with a C-terminal myc/FLAG tag was excised from pCMV6-Tbx18 (Origene, Rockville, MD) by digestion with Fse I and Sal I, then subcloned into a Not I- and Xho I-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), to create pLV-Tbx18-IRES-ZsGreen (~10.1 kb). .. We utilized ZsGreen1 as the reporter protein for Tbx18-transduced cardiomyocytes.

Article Title: Transcriptional Suppression of Connexin43 by TBX1
Article Snippet: This molecular effect, which is at least partially attributable to transcriptional repression, results in reductions of cell-cell coupling and conduction velocity in cardiomyocyte monolayers. .. The human TBX18 gene with a C-terminal Myc/FLAG tag was excised from pCMV6- TBX18 (OriGene, Rockville, MD) by digestion with FseI and SalI and then subcloned into a NotI- and XhoI-digested lentiviral expression vector with the desired reporter gene, pLVX-IRES-ZsGreen1 (Clontech), to create pLV- TBX18 -IRES-ZsGreen (∼10.1 kb). .. We utilized ZsGreen1 as the reporter protein for TBX18 -transduced cardiomyocytes.

Introduce:

Article Title: A Mutant Tat Protein Provides Strong Protection from HIV-1 Infection in Human CD4+ T Cells
Article Snippet: The pGCsamEN-Nullbasic-EGFP construct was made by PCR of Nullbasic-EGFP from pcDNA3.1-Nullbasic-EGFP (Meredith et al. , ), using primers P1 and P2, which introduce unique Not I and Sna BI restriction sites compatible with the multiple cloning site of pGCsamEN ( ). .. Similarly, pGCsamEN-EGFP was made by PCR of an EGFP cassette from pCDN3.1-EGFP, using primers P2 and P3, and pGCsamEN-ZsGreen1 was made by PCR of ZsGreen1 from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA), using primers P4 and P5.

shRNA:

Article Title: MiR-211/STAT5A Signaling Modulates Migration of Mesenchymal Stem Cells to Improve Its Therapeutic Efficacy
Article Snippet: Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ). .. Two fragments encompassing precusor miR-211 sequence were synthesized chemically and then cloned into the EcoRI and NotI sites in plvx-IRES-ZsGreen1 (#632187; Clontech Laboratories, Mountain View, CA, ).

Produced:

Article Title: Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members
Article Snippet: Replication-deficient, VSV-pseudotyped recombinant lentivirus was produced by cotransfection of pLVX IRES ZsGreen1-derived plasmids with the packaging plasmid pCMV-dR8.74 (Addgene) and the pseudotyping plasmid pVSV-G (Clontech) using calcium phosphate into HEK293T cells ( ). .. Following digestion with XhoI and XbaI (New England Biolabs), this PCR product was ligated into pLVX IRES ZsGreen1 (Clontech) using a Rapid DNA Ligation kit (Roche Applied Science) as per the manufacturer's instructions to generate pLVX mIRF8 IRES ZsGreen1.

Staining:

Article Title: Enhanced neuroprotective efficacy of bone marrow mesenchymal stem cells co-overexpressing BDNF and VEGF in a rat model of cardiac arrest-induced global cerebral ischemia
Article Snippet: Prior to lentivirus transduction, cells at passage 3 were characterized by flow cytometric analysis using a BD FACSCalibur (BD Biosciences, San Jose, CA, USA) after staining with a fluorescein isothiocyanate-labeled specific antibody against CD34, CD44, CD45, or CD90 (BD Pharmingen, Shanghai, China) to determine the nature of cells. .. Lentiviral constructs that express rat BDNF or VEGF were prepared by Land Biology (Guangzhou, China) using Clontech pLVX-IRES-ZsGreen1 and pLVX-IRES-tdTomato bicistronic shuttle vectors (Takara Biomed Technology, Beijing, China).

Variant Assay:

Article Title: Selection of an optimal promoter for gene transfer in normal B cells
Article Snippet: B cells co-cultured with feeder cells formed clumps of proliferating cells that were viable for ≥14 consecutive days ( ). .. To determine the levels of transgene expression in B cells three bicistronic plasmids were used that encode various GFPs under the control of different promoters, namely pGIPZ [cytomegalovirus (CMV) promoter; turbo GFP, which is an improved variant of the green fluorescent protein CopGFP], pLVTHM [elongation factor 1 alpha (EF1α) promoter; GFP) and pLVX-IRES-ZsGreen1 (CMV promoter; ZsGreen1, which is a human codon-optimized variant of ZsGreen) ( ). .. Independent of the vectors used in the present study, a very low level of transgene expression was detected in B cells; expression did not exceed 10%, as assessed with flow cytometry 7 days post-transduction ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    TaKaRa lentivirus vector plvx ires zsgreen1
    The anti-leukemia effects of miR-375 in vivo. About 1х10 7 viable HL-60 cells transduced with MSCV-miR-375 or MSCV-NC were injected subcutaneously into right flank of each nude mouse. a A photograph of xenografted tumors in mice xenografted by HL-60 cells, which were transduced with MSCV-miR-375 or MSCV-NC. b Volumes of all xenografted tumors were measured when the experiment was terminated at 42 days after tumor cell inoculation. c Net weights of all xenografted tumors were measured at the termination of the experiment. d The protein expression of HOXB3 was detected in xenografted tumor lysates from HL-60 cells transduced with MSCV-miR-375 or MSCV-NC. e THP1 cells were transduced with <t>lentivirus</t> vector <t>pLVX-IRES-ZsGreen1</t> and GFP-positive cells were sorted by flow cytometry. The GFP-positive cells were further transduced with MSCV-miR-375 or MSCV-NC and treated with puromycin for 1 week. Then, THP1-GFP-miR-375 or THP1-GFP-NC were xenografted into NSG mice. Peripheral blood cells were extracted from mice when the mice became moribund and GFP-positive cells were analyzed by flow cytometry. * P
    Lentivirus Vector Plvx Ires Zsgreen1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vector plvx ires zsgreen1/product/TaKaRa
    Average 88 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    lentivirus vector plvx ires zsgreen1 - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    Image Search Results


    The anti-leukemia effects of miR-375 in vivo. About 1х10 7 viable HL-60 cells transduced with MSCV-miR-375 or MSCV-NC were injected subcutaneously into right flank of each nude mouse. a A photograph of xenografted tumors in mice xenografted by HL-60 cells, which were transduced with MSCV-miR-375 or MSCV-NC. b Volumes of all xenografted tumors were measured when the experiment was terminated at 42 days after tumor cell inoculation. c Net weights of all xenografted tumors were measured at the termination of the experiment. d The protein expression of HOXB3 was detected in xenografted tumor lysates from HL-60 cells transduced with MSCV-miR-375 or MSCV-NC. e THP1 cells were transduced with lentivirus vector pLVX-IRES-ZsGreen1 and GFP-positive cells were sorted by flow cytometry. The GFP-positive cells were further transduced with MSCV-miR-375 or MSCV-NC and treated with puromycin for 1 week. Then, THP1-GFP-miR-375 or THP1-GFP-NC were xenografted into NSG mice. Peripheral blood cells were extracted from mice when the mice became moribund and GFP-positive cells were analyzed by flow cytometry. * P

    Journal: BMC Cancer

    Article Title: A novel miR-375-HOXB3-CDCA3/DNMT3B regulatory circuitry contributes to leukemogenesis in acute myeloid leukemia

    doi: 10.1186/s12885-018-4097-z

    Figure Lengend Snippet: The anti-leukemia effects of miR-375 in vivo. About 1х10 7 viable HL-60 cells transduced with MSCV-miR-375 or MSCV-NC were injected subcutaneously into right flank of each nude mouse. a A photograph of xenografted tumors in mice xenografted by HL-60 cells, which were transduced with MSCV-miR-375 or MSCV-NC. b Volumes of all xenografted tumors were measured when the experiment was terminated at 42 days after tumor cell inoculation. c Net weights of all xenografted tumors were measured at the termination of the experiment. d The protein expression of HOXB3 was detected in xenografted tumor lysates from HL-60 cells transduced with MSCV-miR-375 or MSCV-NC. e THP1 cells were transduced with lentivirus vector pLVX-IRES-ZsGreen1 and GFP-positive cells were sorted by flow cytometry. The GFP-positive cells were further transduced with MSCV-miR-375 or MSCV-NC and treated with puromycin for 1 week. Then, THP1-GFP-miR-375 or THP1-GFP-NC were xenografted into NSG mice. Peripheral blood cells were extracted from mice when the mice became moribund and GFP-positive cells were analyzed by flow cytometry. * P

    Article Snippet: THP1 cells were transduced with lentivirus vector pLVX-IRES-ZsGreen1 (Clontech), followed by sorting to obtain GFP-positive cells.

    Techniques: In Vivo, Transduction, Injection, Mouse Assay, Expressing, Plasmid Preparation, Flow Cytometry, Cytometry

    Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with pLVX ZsGreen1, pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.

    Journal: Molecular Medicine Reports

    Article Title: Selection of an optimal promoter for gene transfer in normal B cells

    doi: 10.3892/mmr.2017.6974

    Figure Lengend Snippet: Transduction of Raji cells with plasmids containing various promoters. Raji lymphoma cells were modified with pLVX ZsGreen1, pLVTHM, pGIPZ and HIV-SFFV-RFP. The percentage of fluorescent (GFP- or RFP-positive) cells was determined using flow cytometry. GFP, green fluorescent protein; RFP, red fluorescent protein; HIV, human immunodeficiency virus; SFFV, spleen focus-forming virus.

    Article Snippet: To determine the levels of transgene expression in B cells three bicistronic plasmids were used that encode various GFPs under the control of different promoters, namely pGIPZ [cytomegalovirus (CMV) promoter; turbo GFP, which is an improved variant of the green fluorescent protein CopGFP], pLVTHM [elongation factor 1 alpha (EF1α) promoter; GFP) and pLVX-IRES-ZsGreen1 (CMV promoter; ZsGreen1, which is a human codon-optimized variant of ZsGreen) ( ).

    Techniques: Transduction, Modification, Flow Cytometry, Cytometry

    Generation and characterization of FOLR1-CAR T cells. T cells were obtained from human PBMCs of three healthy donors and the FOLR1-CAR gene was cloned into the pLVX-IRES-GFP vector and the lentivirus infection efficiency was determined. (A) The growth rate of infected or untransduced T cells was measured by CellTiter-Glo assay for 12 days. (B) Lentivirus infection rate was analyzed by GFP fluorescence on day 12 using FACS analysis. (C) Expression of FOLR1-CAR in T cells was measured by western blot analysis. (D-E) The population of T cells was evaluated by FACS analysis using CD3, CD4, and CD8 antibodies on day 12. Experiments were repeated three times with similar results. The data are represented as the mean of luminescence ± SD and positive rate ± SD (%) from triplicate cultures. Statistical analysis was performed using the two-sided unpaired t-test.

    Journal: PLoS ONE

    Article Title: Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer

    doi: 10.1371/journal.pone.0198347

    Figure Lengend Snippet: Generation and characterization of FOLR1-CAR T cells. T cells were obtained from human PBMCs of three healthy donors and the FOLR1-CAR gene was cloned into the pLVX-IRES-GFP vector and the lentivirus infection efficiency was determined. (A) The growth rate of infected or untransduced T cells was measured by CellTiter-Glo assay for 12 days. (B) Lentivirus infection rate was analyzed by GFP fluorescence on day 12 using FACS analysis. (C) Expression of FOLR1-CAR in T cells was measured by western blot analysis. (D-E) The population of T cells was evaluated by FACS analysis using CD3, CD4, and CD8 antibodies on day 12. Experiments were repeated three times with similar results. The data are represented as the mean of luminescence ± SD and positive rate ± SD (%) from triplicate cultures. Statistical analysis was performed using the two-sided unpaired t-test.

    Article Snippet: Lentiviral expression vectors, including pLVX-Puro (Cat. #632164) and pLVX-IRES-ZsGreen1 (Cat. #632187), were obtained from Clontech (USA).

    Techniques: Clone Assay, Plasmid Preparation, Infection, Glo Assay, Fluorescence, FACS, Expressing, Western Blot