plvx ef1α ires zsgreen1  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    pLVX EF1alpha IRES ZsGreen1 Vector
    Description:
    Living Colors ZsGreen1 is an exceptionally bright green fluorescent protein derived from a Zoanthus sp reef coral Matz et al 1999 that has been modified for high solubility bright emission and rapid chromophore maturation ZsGreen1 is the brightest commercially available green fluorescent protein up to 4X brighter than EGFP and is ideally suited for whole cell labelling promoter reporter studies or as a transfection control
    Catalog Number:
    631982
    Price:
    None
    Size:
    10 ug
    Category:
    ZsGreen1 fluorescent protein Cyan and green fluorescent proteins Fluorescent protein plasmids Fluorescent proteins Gene function
    Buy from Supplier


    Structured Review

    TaKaRa plvx ef1α ires zsgreen1
    Living Colors ZsGreen1 is an exceptionally bright green fluorescent protein derived from a Zoanthus sp reef coral Matz et al 1999 that has been modified for high solubility bright emission and rapid chromophore maturation ZsGreen1 is the brightest commercially available green fluorescent protein up to 4X brighter than EGFP and is ideally suited for whole cell labelling promoter reporter studies or as a transfection control
    https://www.bioz.com/result/plvx ef1α ires zsgreen1/product/TaKaRa
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    plvx ef1α ires zsgreen1 - by Bioz Stars, 2020-09
    95/100 stars

    Related Products / Commonly Used Together

    human st3gal1 cdna
    st3gal1 overexpression ramos b cells
    pcr

    Images

    Related Articles

    Transfection:

    Article Title: Upregulation of prefrontal metabotropic glutamate receptor 5 mediates neuropathic pain and negative mood symptoms after spinal nerve injury in rats
    Article Snippet: .. In brief, the cDNA of mGluR5 (primer forward: ATGGTCCTTCTGTTGATTCTGTCAG, reverse: TCACAACGATGAAGAACTCTGCG) was amplified and inserted into the lentiviral vector pLVX-EF1α–IRES-ZsGreen1 (Clontech, Catalog No. 631982), and the plasmid was transfected into HEK293FT cells of 60–70% confluency together with psPAX2 (Addgene), pMD2G (Addgene) and polyethyleneimine solution (sigma-Aldrich). ..

    Amplification:

    Article Title: Upregulation of prefrontal metabotropic glutamate receptor 5 mediates neuropathic pain and negative mood symptoms after spinal nerve injury in rats
    Article Snippet: .. In brief, the cDNA of mGluR5 (primer forward: ATGGTCCTTCTGTTGATTCTGTCAG, reverse: TCACAACGATGAAGAACTCTGCG) was amplified and inserted into the lentiviral vector pLVX-EF1α–IRES-ZsGreen1 (Clontech, Catalog No. 631982), and the plasmid was transfected into HEK293FT cells of 60–70% confluency together with psPAX2 (Addgene), pMD2G (Addgene) and polyethyleneimine solution (sigma-Aldrich). ..

    Article Title: Human B Cell Differentiation Is Characterized by Progressive Remodeling of O-Linked Glycans
    Article Snippet: .. To generate ST3Gal1 overexpression Ramos B cells, human ST3Gal1 cDNA (Origene #SC111017) was amplified by PCR and then subcloned into pLVX-EF1α-IRES-ZsGreen1 (Clontech #631982), a bicistronic lentiviral expression vector allowing for simultaneous co-expression of ST3Gal1 and ZsGreen1 from a single mRNA transcript. .. The ST3Gal1 insert was sequenced and was found to match the NCBI reference sequence NM_173344.2 for ST3Gal1 transcript variant 2, except for one synonymous mutation at base 261 (C- > T) of the coding sequence.

    Article Title: Bone Morphogenetic Protein 4 Gene Therapy in Mice Inhibits Myeloma Tumor Growth, But Has a Negative Impact on Bone
    Article Snippet: .. 2.2 Generation of iRFP‐labeled KJON myeloma cells The iRFP sequence was amplified from piRFP (gift from Vladislav Verkhusha, Addgene plasmid# 31857; http://n2t.net/addgene:31857 ; RRID:Addgene_31857). with PCR primers with overhangs containing restriction sites for SpeI and NotI (Sigma). pLVX‐EF1α‐IRES‐ZsGreen1 (Cat# 631982, Clontech, Takara Bio USA, CA, USA) was cut with SpeI and NotI restriction enzymes, treated with FastAP, and ligated with the iRFP PCR product, using T4 DNA ligase (all Fermentas, Thermo Fisher Scientific). .. The resulting plasmid, pLVX‐EF1α‐iRFP‐IRES‐ZsGreen1, was used together with TransLenti Viral Packaging Mix (Open Biosystems) and Genejuice (Novagen, Merck Life Science AS, Oslo, Norway) to transfect 293 T packaging cells (Open Biosystems, Thermo Fisher Scientific).

    Polymerase Chain Reaction:

    Article Title: Human B Cell Differentiation Is Characterized by Progressive Remodeling of O-Linked Glycans
    Article Snippet: .. To generate ST3Gal1 overexpression Ramos B cells, human ST3Gal1 cDNA (Origene #SC111017) was amplified by PCR and then subcloned into pLVX-EF1α-IRES-ZsGreen1 (Clontech #631982), a bicistronic lentiviral expression vector allowing for simultaneous co-expression of ST3Gal1 and ZsGreen1 from a single mRNA transcript. .. The ST3Gal1 insert was sequenced and was found to match the NCBI reference sequence NM_173344.2 for ST3Gal1 transcript variant 2, except for one synonymous mutation at base 261 (C- > T) of the coding sequence.

    Article Title: Bone Morphogenetic Protein 4 Gene Therapy in Mice Inhibits Myeloma Tumor Growth, But Has a Negative Impact on Bone
    Article Snippet: .. 2.2 Generation of iRFP‐labeled KJON myeloma cells The iRFP sequence was amplified from piRFP (gift from Vladislav Verkhusha, Addgene plasmid# 31857; http://n2t.net/addgene:31857 ; RRID:Addgene_31857). with PCR primers with overhangs containing restriction sites for SpeI and NotI (Sigma). pLVX‐EF1α‐IRES‐ZsGreen1 (Cat# 631982, Clontech, Takara Bio USA, CA, USA) was cut with SpeI and NotI restriction enzymes, treated with FastAP, and ligated with the iRFP PCR product, using T4 DNA ligase (all Fermentas, Thermo Fisher Scientific). .. The resulting plasmid, pLVX‐EF1α‐iRFP‐IRES‐ZsGreen1, was used together with TransLenti Viral Packaging Mix (Open Biosystems) and Genejuice (Novagen, Merck Life Science AS, Oslo, Norway) to transfect 293 T packaging cells (Open Biosystems, Thermo Fisher Scientific).

    Expressing:

    Article Title: Human B Cell Differentiation Is Characterized by Progressive Remodeling of O-Linked Glycans
    Article Snippet: .. To generate ST3Gal1 overexpression Ramos B cells, human ST3Gal1 cDNA (Origene #SC111017) was amplified by PCR and then subcloned into pLVX-EF1α-IRES-ZsGreen1 (Clontech #631982), a bicistronic lentiviral expression vector allowing for simultaneous co-expression of ST3Gal1 and ZsGreen1 from a single mRNA transcript. .. The ST3Gal1 insert was sequenced and was found to match the NCBI reference sequence NM_173344.2 for ST3Gal1 transcript variant 2, except for one synonymous mutation at base 261 (C- > T) of the coding sequence.

    Article Title: Pre-Treatment Mutational and Transcriptomic Landscape of Responding Metastatic Melanoma Patients to Anti-PD1 Immunotherapy
    Article Snippet: .. NFKBIE Wildtype and G34E Expression Vectors NFKBIE cDNA sequences were inserted into the pLVX-EF1a-IRES-ZsGreen1 vector (Clontech/Takara Bio, Mountain View, CA, USA, #631982) by GenScript using the SpeI/NotI restriction enzyme sites (Genscript, Piscataway, NJ, USA). .. Each construct was transformed into TOP10 competent Escherichia coli (E. coli) cells (Invitrogen, Carlsbad, CA, USA).

    Sequencing:

    Article Title: Bone Morphogenetic Protein 4 Gene Therapy in Mice Inhibits Myeloma Tumor Growth, But Has a Negative Impact on Bone
    Article Snippet: .. 2.2 Generation of iRFP‐labeled KJON myeloma cells The iRFP sequence was amplified from piRFP (gift from Vladislav Verkhusha, Addgene plasmid# 31857; http://n2t.net/addgene:31857 ; RRID:Addgene_31857). with PCR primers with overhangs containing restriction sites for SpeI and NotI (Sigma). pLVX‐EF1α‐IRES‐ZsGreen1 (Cat# 631982, Clontech, Takara Bio USA, CA, USA) was cut with SpeI and NotI restriction enzymes, treated with FastAP, and ligated with the iRFP PCR product, using T4 DNA ligase (all Fermentas, Thermo Fisher Scientific). .. The resulting plasmid, pLVX‐EF1α‐iRFP‐IRES‐ZsGreen1, was used together with TransLenti Viral Packaging Mix (Open Biosystems) and Genejuice (Novagen, Merck Life Science AS, Oslo, Norway) to transfect 293 T packaging cells (Open Biosystems, Thermo Fisher Scientific).

    Over Expression:

    Article Title: Human B Cell Differentiation Is Characterized by Progressive Remodeling of O-Linked Glycans
    Article Snippet: .. To generate ST3Gal1 overexpression Ramos B cells, human ST3Gal1 cDNA (Origene #SC111017) was amplified by PCR and then subcloned into pLVX-EF1α-IRES-ZsGreen1 (Clontech #631982), a bicistronic lentiviral expression vector allowing for simultaneous co-expression of ST3Gal1 and ZsGreen1 from a single mRNA transcript. .. The ST3Gal1 insert was sequenced and was found to match the NCBI reference sequence NM_173344.2 for ST3Gal1 transcript variant 2, except for one synonymous mutation at base 261 (C- > T) of the coding sequence.

    Plasmid Preparation:

    Article Title: Upregulation of prefrontal metabotropic glutamate receptor 5 mediates neuropathic pain and negative mood symptoms after spinal nerve injury in rats
    Article Snippet: .. In brief, the cDNA of mGluR5 (primer forward: ATGGTCCTTCTGTTGATTCTGTCAG, reverse: TCACAACGATGAAGAACTCTGCG) was amplified and inserted into the lentiviral vector pLVX-EF1α–IRES-ZsGreen1 (Clontech, Catalog No. 631982), and the plasmid was transfected into HEK293FT cells of 60–70% confluency together with psPAX2 (Addgene), pMD2G (Addgene) and polyethyleneimine solution (sigma-Aldrich). ..

    Article Title: Human B Cell Differentiation Is Characterized by Progressive Remodeling of O-Linked Glycans
    Article Snippet: .. To generate ST3Gal1 overexpression Ramos B cells, human ST3Gal1 cDNA (Origene #SC111017) was amplified by PCR and then subcloned into pLVX-EF1α-IRES-ZsGreen1 (Clontech #631982), a bicistronic lentiviral expression vector allowing for simultaneous co-expression of ST3Gal1 and ZsGreen1 from a single mRNA transcript. .. The ST3Gal1 insert was sequenced and was found to match the NCBI reference sequence NM_173344.2 for ST3Gal1 transcript variant 2, except for one synonymous mutation at base 261 (C- > T) of the coding sequence.

    Article Title: BCL6 modulation of acute lymphoblastic leukemia response to chemotherapy
    Article Snippet: .. BCL6 fragment was then ligated into pLVX-EF1α-IRES-ZsGreen1 plasmid (Clontech Laboratories, Inc. Cat# 631982). .. Mice All experimental procedures involving NOD/SCID Gamma (NSG) mice were approved by the West Virginia University Institutional Animal Care and Use Committee.

    Article Title: Bone Morphogenetic Protein 4 Gene Therapy in Mice Inhibits Myeloma Tumor Growth, But Has a Negative Impact on Bone
    Article Snippet: .. 2.2 Generation of iRFP‐labeled KJON myeloma cells The iRFP sequence was amplified from piRFP (gift from Vladislav Verkhusha, Addgene plasmid# 31857; http://n2t.net/addgene:31857 ; RRID:Addgene_31857). with PCR primers with overhangs containing restriction sites for SpeI and NotI (Sigma). pLVX‐EF1α‐IRES‐ZsGreen1 (Cat# 631982, Clontech, Takara Bio USA, CA, USA) was cut with SpeI and NotI restriction enzymes, treated with FastAP, and ligated with the iRFP PCR product, using T4 DNA ligase (all Fermentas, Thermo Fisher Scientific). .. The resulting plasmid, pLVX‐EF1α‐iRFP‐IRES‐ZsGreen1, was used together with TransLenti Viral Packaging Mix (Open Biosystems) and Genejuice (Novagen, Merck Life Science AS, Oslo, Norway) to transfect 293 T packaging cells (Open Biosystems, Thermo Fisher Scientific).

    Article Title: Pre-Treatment Mutational and Transcriptomic Landscape of Responding Metastatic Melanoma Patients to Anti-PD1 Immunotherapy
    Article Snippet: .. NFKBIE Wildtype and G34E Expression Vectors NFKBIE cDNA sequences were inserted into the pLVX-EF1a-IRES-ZsGreen1 vector (Clontech/Takara Bio, Mountain View, CA, USA, #631982) by GenScript using the SpeI/NotI restriction enzyme sites (Genscript, Piscataway, NJ, USA). .. Each construct was transformed into TOP10 competent Escherichia coli (E. coli) cells (Invitrogen, Carlsbad, CA, USA).

    Article Title: Direct Promoter Repression by BCL11A Controls the Fetal to Adult Hemoglobin Switch
    Article Snippet: .. The complete open reading frame (ORF) of human BCL11A isoforms (XL, L, S and XS) and various domain mutants were subcloned into the lentiviral vector pLVX-EF1a-IRES-zsGreen1 (Clontech #631982). ..

    Article Title: Construction of an anti-programmed death-ligand 1 chimeric antigen receptor and determination of its antitumor function with transduced cells
    Article Snippet: .. Construction of vector and production of lentivirus The lentiviral vector pLVX (cat no. 631982; Clontech Laboratories, Inc.) was digested with Eco RI and Not I, prior to being recovered with a Gel DNA Recovery kit (cat no. DP209; Tiangen Biotech Co., Ltd., Beijing, China). .. A scFv fragment, designated FR1 (Invitrogen; Thermo Fisher Scientific, Inc.), which comprised scFv and a transmembrane domain, was amplified from a pUC-vector using the following primers: FR1 forward, 5′-GTGTCGTGAGGATCTATTTCCGGTGAATTCGCCGCCACCATGGCCTTACCAGTGACCGCC-3′ and reverse, 5′-TCTGGACCGCTTAGATCGGTTCCTATGATTTCGGTTCCTATGATTACAATAAAGAGTAAT-3′.

    Article Title: Construction of an anti-programmed death-ligand 1 chimeric antigen receptor and determination of its antitumor function with transduced cells
    Article Snippet: .. The lentiviral vector pLVX (cat no. 631982; Clontech Laboratories, Inc.) was digested with Eco RI and Not I, prior to being recovered with a Gel DNA Recovery kit (cat no. DP209; Tiangen Biotech Co., Ltd., Beijing, China). .. A scFv fragment, designated FR1 (Invitrogen; Thermo Fisher Scientific, Inc.), which comprised scFv and a transmembrane domain, was amplified from a pUC-vector using the following primers: FR1 forward, 5′-GTGTCGTGAGGATCTATTTCCGGTGAATTCGCCGCCACCATGGCCTTACCAGTGACCGCC-3′ and reverse, 5′-TCTGGACCGCTTAGATCGGTTCCTATGATTTCGGTTCCTATGATTACAATAAAGAGTAAT-3′.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    TaKaRa plvx ef1alpha ires zsgreen1 vector
    Plvx Ef1alpha Ires Zsgreen1 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plvx ef1alpha ires zsgreen1 vector/product/TaKaRa
    Average 95 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    plvx ef1alpha ires zsgreen1 vector - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    Image Search Results