Review



plenticrispr v2  (Addgene inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Addgene inc plenticrispr v2
    List of plasmids.
    Plenticrispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr v2/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr v2 - by Bioz Stars, 2024-10
    86/100 stars

    Images

    1) Product Images from "Human tetraspanin CD81 facilitates invasion of Salmonella enterica into human epithelial cells"

    Article Title: Human tetraspanin CD81 facilitates invasion of Salmonella enterica into human epithelial cells

    Journal: Virulence

    doi: 10.1080/21505594.2024.2399792

    List of plasmids.
    Figure Legend Snippet: List of plasmids.

    Techniques Used:



    Similar Products

    plenticrispr plasmids  (OriGene)
    86
    OriGene plenticrispr plasmids
    Plenticrispr Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr plasmids/product/OriGene
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr plasmids - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    plenticrispr v2 plasmid  (GenScript corporation)
    86
    GenScript corporation plenticrispr v2 plasmid
    Plenticrispr V2 Plasmid, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr v2 plasmid/product/GenScript corporation
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr v2 plasmid - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    plenticrispr v2  (GenScript corporation)
    86
    GenScript corporation plenticrispr v2
    Plenticrispr V2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr v2/product/GenScript corporation
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr v2 - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    plenticrispr v2  (Addgene inc)
    86
    Addgene inc plenticrispr v2
    List of plasmids.
    Plenticrispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr v2/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr v2 - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    transfer plasmid plenticrispr v2  (Thermo Fisher)
    86
    Thermo Fisher transfer plasmid plenticrispr v2
    List of plasmids.
    Transfer Plasmid Plenticrispr V2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transfer plasmid plenticrispr v2/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    transfer plasmid plenticrispr v2 - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    plenticrispr sgmettl16  (Addgene inc)
    86
    Addgene inc plenticrispr sgmettl16
    List of plasmids.
    Plenticrispr Sgmettl16, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr sgmettl16/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr sgmettl16 - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    plenticrispr plasmids  (Roche)
    86
    Roche plenticrispr plasmids
    List of plasmids.
    Plenticrispr Plasmids, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenticrispr plasmids/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plenticrispr plasmids - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    List of plasmids.

    Journal: Virulence

    Article Title: Human tetraspanin CD81 facilitates invasion of Salmonella enterica into human epithelial cells

    doi: 10.1080/21505594.2024.2399792

    Figure Lengend Snippet: List of plasmids.

    Article Snippet: CD81 synthetic guide RNA (5’-TGGTGGTCTGCGGGTCATGG-3’), CD9 synthetic guide RNA (5’- GCGACATACCGCATAGTGGA −3’) or a scrambled sequence as control guide RNA (5’-CTAAGGTTAAGTCGCCCTCG-3’) cloned into pLentiCRISPR V2 (a gift from Feng Zhang (Addgene plasmid #52961; http://n2t.net/addgene:52961 ; RRID:Addgene_52961) was incorporated into a lentiviral packaging system ( ) [ ].

    Techniques: