plasmid miniprep classic kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    ZR Plasmid Miniprep - Classic
    Description:
    The ZR Plasmid Miniprep-Classic is designed for efficient isolation of plasmid DNA from E. Coli using a traditional 3-buffer (P1, P2, P3) procedure that is simple, rapid, and reliable. It features a modified alkaline lysis protocol together with Zymo-Spin technology to yield high quality plasmid DNA in minutes. The buffers are color-coded (red, green, yellow) for easy visualization of complete cell lysis and neutralization. The innovative Zymo-Spin llN columns yield endotoxin-free plasmid DNA. Plasmid DNA purified using the ZR Plasmid Miniprep-Classic is well suited for use in restriction endonuclease digestion, sequencing, DNA ligation, cloning, PCR, bacterial transformation, transfection, etc.
    Catalog Number:
    D4015
    Price:
    None
    Applications:
    Plasmid DNA Purification
    Size:
    100 units
    Category:
    Life Science Reagents and Media
    Score:
    85
    Buy from Supplier


    Structured Review

    Zymo Research plasmid miniprep classic kit
    ZR Plasmid Miniprep - Classic
    The ZR Plasmid Miniprep-Classic is designed for efficient isolation of plasmid DNA from E. Coli using a traditional 3-buffer (P1, P2, P3) procedure that is simple, rapid, and reliable. It features a modified alkaline lysis protocol together with Zymo-Spin technology to yield high quality plasmid DNA in minutes. The buffers are color-coded (red, green, yellow) for easy visualization of complete cell lysis and neutralization. The innovative Zymo-Spin llN columns yield endotoxin-free plasmid DNA. Plasmid DNA purified using the ZR Plasmid Miniprep-Classic is well suited for use in restriction endonuclease digestion, sequencing, DNA ligation, cloning, PCR, bacterial transformation, transfection, etc.
    https://www.bioz.com/result/plasmid miniprep classic kit/product/Zymo Research
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plasmid miniprep classic kit - by Bioz Stars, 2020-01
    96/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: The blunt-ending reactions were carried out in CutSmart Buffer (New England Biolabs) with 0.01 mM dNTPs and 1 µL Klenow enzyme in 25 µL reaction volumes and were kept at 30 °C for 15 min followed by inactivation at 75 °C for 10 min. In-Fusion cloning (Takara Clontech, Saint-Germain-en-Laye, France) was carried out following standard protocol with constructs containing native diTPS due to internal endonuclease sites. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Paragraph title: Gene cloning and sequencing of TaOr8 and TaORco ... Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Bait plasmids of UNC-89 Ig53 and UNC-89 Fn2 were created by cloning of PCR-amplified fragments using primers shown in Supplemental Table S3 and inserted into pGBDU-C1. .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: In the set-up and validation of this procedure, 30 positive clones from five representative human DNA samples were analysed. .. Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems).

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: Paragraph title: Cloning of miR-23b promoter region ... The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Mutations were introduced by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit; Agilent Technologies) with primers (listed in ) containing the mutations and verified by Sanger sequencing. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel). .. We ensured that no other mutation was introduced by sequencing the entire cDNA of NTN1 .

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Briefly, annealed synthetic “top” and “bottom” ssDNA guide oligonucleotides flanked by BsaI-compatible 4-nucleotide overhangs were directionally cloned, and insertion was confirmed by PCRs using the “top” strand guide oligonucleotide and a downstream primer, Plasmid 1 REV. pDG plasmids were constructed by transferring the XhoI-NsiI fragment of p2 into p3 that was double-digested with XhoI and NsiI ( ). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. DNA sequencing used Quintarabio DNA basic sequencing service.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: The 5′URS were cloned as a Sac I/Spe I fragment, replacing the authentic GPD promoter. .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Escherichia coli DH5α and BL21(DE3) strains were used as cloning and protein expression hosts, respectively. .. Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research).

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: PCR products were cloned into pCR2.1-TOPO vector using T4-DNA ligase, the TA cloning kit, and One Shot TOP10 chemically competent Escherichia coli (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA). .. Clones were sequenced using dye terminator cycle sequencing with M13 primers on an ABI 3730 automated sequencer.

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Paragraph title: Cloning and mutagenesis of the wbeT gene ... Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA).

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: The bands were excised, purified (Purelink Quickgel extraction kit, Invitrogen), and cloned into the pGL3-Basic reporter vector (Promega) digested with the same enzymes. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA).

    Amplification:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: ATR1 (Arabidopsis thaliana , Gene ID: 3150037), SrCPR (Stevia rebaudiana , Gene ID: 93211213), and SpGGPPS7 (Synechococcus sp., Gene ID: 86553638) were PCR amplified together with yeast codon optimized PsCYP720B4 [ ]. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: PCR amplification of full-length TaOr8 or TaORco coding sequences was performed with antennal or maxillary palp-derived cDNA templates and the following primers: TaORco forward: 5′CACCATGAATGTTCAACCAACCAAG3′; TaORco reverse: TTACTTCAGCTGCACCAGCAC; TaOr8 forward: 5′CACCATGAGACTCAGAAAGATGAACG3′; TaOr8 reverse: 5′CTATTTCGGTCCATACATTGTT3′. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: To generate human and mouse netrin-1 AP fusion proteins in the C-terminal, human and mouse NTN1 cDNAs were amplified by PCR and cloned in pAP-Tag-5 (GenHunter, no. Q202) between NheI and BglII sites. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Paragraph title: Dual-guide plasmid construction and DHFR cassette amplification ... Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: The 161-bp fragment (chromosome 7: 130,132,756–130,132,917 bp; Ensembl release 61) amplified by forward primer 5′-TTTTGGTGYGATTTAAAGGATAGGTTTTAG-3′ and reverse primer 5′-AATACCTAAATCTTAAAATCCTAAACTACACC-3′ contains 10 CpG (cytosine-phosphatidyl-guanine) sites and a cytosine/guanine-SNP (rs2301335) to distinguish the two parental alleles. .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA).

    DNA Synthesis:

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA). .. Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA).

    Recovery:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Synthesized:

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. DNA sequencing used Quintarabio DNA basic sequencing service.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Artificial 5′URS were synthesized by BioCat GmbH (Heidelberg, Germany). .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    TA Cloning:

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: PCR products were cloned into pCR2.1-TOPO vector using T4-DNA ligase, the TA cloning kit, and One Shot TOP10 chemically competent Escherichia coli (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA).

    Construct:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: The blunt-ending reactions were carried out in CutSmart Buffer (New England Biolabs) with 0.01 mM dNTPs and 1 µL Klenow enzyme in 25 µL reaction volumes and were kept at 30 °C for 15 min followed by inactivation at 75 °C for 10 min. In-Fusion cloning (Takara Clontech, Saint-Germain-en-Laye, France) was carried out following standard protocol with constructs containing native diTPS due to internal endonuclease sites. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Briefly, annealed synthetic “top” and “bottom” ssDNA guide oligonucleotides flanked by BsaI-compatible 4-nucleotide overhangs were directionally cloned, and insertion was confirmed by PCRs using the “top” strand guide oligonucleotide and a downstream primer, Plasmid 1 REV. pDG plasmids were constructed by transferring the XhoI-NsiI fragment of p2 into p3 that was double-digested with XhoI and NsiI ( ). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: The multicopy yeast vector p426GPD [ ] was used for the generation of all constructs. .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: The bands were excised, purified (Purelink Quickgel extraction kit, Invitrogen), and cloned into the pGL3-Basic reporter vector (Promega) digested with the same enzymes. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA). .. SHSY5Y and NIH3T3 cells were purchased from the American Type Culture Collection (Manassas, VA) and maintained in 5 % CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 % fetal calf serum (FCS), 100 U/ml penicillin, and 100 μg/ml streptomycin in 10 cm plates.

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    cDNA Library Assay:

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Yeast two-hybrid screening of a C. elegans cDNA library was performed as previously described ( ). .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Luciferase:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: Then, the fragment was purified by DNA Clean & Concentrator TM- 5 kit (Zymo Research) and inserted by using T4 DNA ligase (Promega) into the SacI–Xho I sites upstream of the firefly luciferase reporter gene in the linearized pGL3-Basic vector (Promega). .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Expressing:

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Amplicons were cloned into the pENTRTM vector using the GatewayR directional cloning system (Invitrogen Corp., Carlsbad, CA, USA) and subcloned into the Xenopus laevis expression destination vector, pSP64t RFA. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit. .. Finally, the inserted guide sequences were confirmed by sequencing the pDG plasmid with primers gRNA For and gRNA Rev ( ).

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Escherichia coli DH5α and BL21(DE3) strains were used as cloning and protein expression hosts, respectively. .. Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research).

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA). .. The oligonucleotide was mixed with the primer wbeT m3 for annealing at room temperature for 1 h. A double stranded product was generated by filling in the missing bases using T4 DNA polymerase for 5 min at room temperature in the presence of dNTPs.

    Modification:

    Article Title: A Novel Nonantibiotic, lgt-Based Selection System for Stable Maintenance of Expression Vectors in Escherichia coli and Vibrio cholerae
    Article Snippet: Enzymes, buffers, and deoxynucleotide mix solutions for restriction digestion of DNA, DNA modification, and PCR as well as reagents for agarose gel electrophoresis were all obtained from Thermo Fisher Scientific (Waltham, MA, USA) and used according to the manufacturer's instructions. .. Plasmids were prepared by using the ZR Plasmid Miniprep-classic kit (Zymo Research Corp., Irvine CA, USA).

    Transformation Assay:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: The blunt-ending reactions were carried out in CutSmart Buffer (New England Biolabs) with 0.01 mM dNTPs and 1 µL Klenow enzyme in 25 µL reaction volumes and were kept at 30 °C for 15 min followed by inactivation at 75 °C for 10 min. In-Fusion cloning (Takara Clontech, Saint-Germain-en-Laye, France) was carried out following standard protocol with constructs containing native diTPS due to internal endonuclease sites. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Briefly, annealed synthetic “top” and “bottom” ssDNA guide oligonucleotides flanked by BsaI-compatible 4-nucleotide overhangs were directionally cloned, and insertion was confirmed by PCRs using the “top” strand guide oligonucleotide and a downstream primer, Plasmid 1 REV. pDG plasmids were constructed by transferring the XhoI-NsiI fragment of p2 into p3 that was double-digested with XhoI and NsiI ( ). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit. .. Finally, the inserted guide sequences were confirmed by sequencing the pDG plasmid with primers gRNA For and gRNA Rev ( ).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Assembled DNA was transformed into competent cells prepared by the CCMB80 buffer (TekNova, C3132). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research). .. Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research).

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: The transformation efficiency plate was inspected to ensure that all samples in the 96-well plate received at least 50 colony forming units before refrigeration. .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit (Zymo Research) and a 5-μg silica column (Cat. #D4003, Zymo Research) according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ).

    Bisulfite Sequencing:

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: Paragraph title: Bisulphite sequencing ... Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems).

    High Performance Liquid Chromatography:

    Article Title: Discovery of C-Glycosylpyranonaphthoquinones in Streptomyces sp. MBT76 by a Combined NMR-Based Metabolomics and Bioinformatics Workflow
    Article Snippet: Semipreparative HPLC separation was performed on reversed-phase column (Phenomenex Luna 5 μm C18 (2) 100 Å column, 250 × 10 mm). .. The ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA, U.S.A.) was used for plasmid extraction.

    Electroporation:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research). .. Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research).

    Transfection:

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit. .. The DHFR expression cassette amplicon was prepared using primers (DHFR-Fw or DHFR-For LoxP2 and DHFR-Rv) ( ) on DHFR plasmid ( ) and purified using a DNA Clean & Concentrator-5 kit (Zymo Research, D4003).

    Gas Chromatography:

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Genomic Sequencing:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Transferring:

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Briefly, annealed synthetic “top” and “bottom” ssDNA guide oligonucleotides flanked by BsaI-compatible 4-nucleotide overhangs were directionally cloned, and insertion was confirmed by PCRs using the “top” strand guide oligonucleotide and a downstream primer, Plasmid 1 REV. pDG plasmids were constructed by transferring the XhoI-NsiI fragment of p2 into p3 that was double-digested with XhoI and NsiI ( ). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    Generated:

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Similarly, plasmid 3 (p3) was constructed by replacing the HindIII-NsiI fragment with the HindIII-NsiI fragment of a PCR amplicon generated using plasmid 3 FOR and plasmid 3 XhoI (which contains an XhoI site). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA). .. A library of mutations of the wbeT gene was generated by synthesizing the oligonucleotide, wbeT m1, containing the random codon (NNB) at amino acid position 158.

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: Constructs were generated by digesting the pGEM-T clones with Xho I/ Hin dIII (pBDNFI, II) or Xho I/ Bgl II (pBDNFIII) restriction enzymes (Promega) and resolved on 2.0 % agarose gel. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA).

    DNA Sequencing:

    Article Title: A Novel Nonantibiotic, lgt-Based Selection System for Stable Maintenance of Expression Vectors in Escherichia coli and Vibrio cholerae
    Article Snippet: Plasmids were prepared by using the ZR Plasmid Miniprep-classic kit (Zymo Research Corp., Irvine CA, USA). .. DNA products from PCRs and restriction analyses were analyzed by agarose gel electrophoresis using 1% agarose gels in 1× Tris-acetate-EDTA (TAE) buffer.

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA). .. Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA).

    Sequencing:

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Paragraph title: Gene cloning and sequencing of TaOr8 and TaORco ... Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: In the set-up and validation of this procedure, 30 positive clones from five representative human DNA samples were analysed. .. Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). .. The effectiveness of the entire experimental procedure was also assayed by analysing: (i) CpGenome™ Universal Unmethylated DNA (Chemicon); (ii) unmethylated purified PCR products of each sub-region; and (iii) independent DNA preparations also starting from different tissues.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Mutations were introduced by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit; Agilent Technologies) with primers (listed in ) containing the mutations and verified by Sanger sequencing. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: Paragraph title: Bisulfite plasmid sequencing. ... Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA).

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: The PCR products were subcloned into pGEM-T Easy Vector (Promega) and the DNA fragments were confirmed by sequencing. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA).

    Nucleic Acid Electrophoresis:

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Mass Spectrometry:

    Article Title: Discovery of C-Glycosylpyranonaphthoquinones in Streptomyces sp. MBT76 by a Combined NMR-Based Metabolomics and Bioinformatics Workflow
    Article Snippet: The UHPLC-TOF-MS analyses were performed on an Ultimate 3000 UHPLC system (Thermoscientific, Pittsburgh, PA, U.S.A.) coupled to a micro-ToF-2Q mass spectrometer from Bruker Daltonics (Bremen, Germany) with an electrospray (ESI) interface. .. The ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA, U.S.A.) was used for plasmid extraction.

    Methylation:

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: Classical bisulfite plasmid sequencing was performed to determine the methylation patterns of individual MEST DNA molecules. .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA).

    Mutagenesis:

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Paragraph title: Site-directed mutagenesis ... Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Paragraph title: Cloning and mutagenesis of the wbeT gene ... Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA).

    Isolation:

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: RNA was isolated from antennae or maxillary palps of adult female Toxorhynchites amboinensis by trizol extraction. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: E. coli strains carrying plasmids were cultivated in Luria-Bertani (LB) medium supplemented with antibiotics (100 μg/ml ampicillin or 50 μg/ml kanamycin). .. Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research). .. Indole, isatin, and anthranilic acid were purchased from Sigma-Aldrich; 5-bromoindoline was obtained from Combi-Blocks, Inc. All other chemicals used in this study were of analytical grade.

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: PCR products were cloned into pCR2.1-TOPO vector using T4-DNA ligase, the TA cloning kit, and One Shot TOP10 chemically competent Escherichia coli (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA). .. Clones were sequenced using dye terminator cycle sequencing with M13 primers on an ABI 3730 automated sequencer.

    Article Title: Chromosome-End Knockoff Strategy to Reshape Alkaloid Profiles of a Fungal Endophyte
    Article Snippet: Fungal DNA was isolated from fresh mycelium using ZR Fungal/Bacterial DNA MiniPrep kit (Zymo Research, Irvine, CA), or using Geno/Grinder 2000 (SPEX CertiPrep, Metuchen, NJ) and DNeasy 96 Plant Kit (Qiagen, Valencia, CA). .. Plasmid DNA was isolated from bacterial cultures using the ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA). .. The mRNA was isolated from plant material using RNeasy Plant Mini Kit (Qiagen).

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching 0.6–0.92 OD600 . .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit (Zymo Research) and a 5-μg silica column (Cat. #D4003, Zymo Research) according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. This procedure was preformed in at least triplicate for each knockout strain starting from preparation of electrocompetent cells.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching an OD600 of 0.6–0.9. .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. It should be noted that the Pol II+ Δ recA strain used in these experiments ( ) had a neo cassette at the former recA locus (P_polB(−)lexA-polB+FRT+ΔrecA+KanR+lacZYA:: P_lacUV5-ΔΔ(CoOp) col 2.1, ).

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Enzymes and reagents for manipulation of DNA were obtained from Thermo Fisher Scientific Inc. (Waltham, MA, USA) and reactions were carried out in buffers provided by the manufacturers according to their recommendations. .. Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA). .. A library of mutations of the wbeT gene was generated by synthesizing the oligonucleotide, wbeT m1, containing the random codon (NNB) at amino acid position 158.

    Purification:

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Amplicons were cloned into the pENTRTM vector using the GatewayR directional cloning system (Invitrogen Corp., Carlsbad, CA, USA) and subcloned into the Xenopus laevis expression destination vector, pSP64t RFA. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland). .. DNA and amino-acid sequences for TaOr8 and TaORco have previously been published and can be accessed here ( http://dx.doi.org/10.6084/m9.figshare.1092617 ).

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Bait plasmids of UNC-89 Ig53 and UNC-89 Fn2 were created by cloning of PCR-amplified fragments using primers shown in Supplemental Table S3 and inserted into pGBDU-C1. .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research). .. The minimum regions of PPTR-1 (75-543) and PPTR-2 (10-558) for interaction with UNC-89, as determined by yeast two-hybrid analysis, were expressed as His-tagged proteins in Escherichia coli . cDNAs encoding these two proteins were PCR-amplified using primers shown in Supplemental Table S3 from yeast two-hybrid clones, and their sequences were confirmed to be error-free.

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: In the set-up and validation of this procedure, 30 positive clones from five representative human DNA samples were analysed. .. Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). .. The effectiveness of the entire experimental procedure was also assayed by analysing: (i) CpGenome™ Universal Unmethylated DNA (Chemicon); (ii) unmethylated purified PCR products of each sub-region; and (iii) independent DNA preparations also starting from different tissues.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Mutations were introduced by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit; Agilent Technologies) with primers (listed in ) containing the mutations and verified by Sanger sequencing. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel). .. We ensured that no other mutation was introduced by sequencing the entire cDNA of NTN1 .

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit. .. Finally, the inserted guide sequences were confirmed by sequencing the pDG plasmid with primers gRNA For and gRNA Rev ( ).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Artificial 5′URS were synthesized by BioCat GmbH (Heidelberg, Germany). .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. The nucleotide sequence of the cloned fragments was verified by sequencing.

    In Vivo:

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching 0.6–0.92 OD600 . .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit (Zymo Research) and a 5-μg silica column (Cat. #D4003, Zymo Research) according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. This procedure was preformed in at least triplicate for each knockout strain starting from preparation of electrocompetent cells.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching an OD600 of 0.6–0.9. .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. It should be noted that the Pol II+ Δ recA strain used in these experiments ( ) had a neo cassette at the former recA locus (P_polB(−)lexA-polB+FRT+ΔrecA+KanR+lacZYA:: P_lacUV5-ΔΔ(CoOp) col 2.1, ).

    Polymerase Chain Reaction:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: ATR1 (Arabidopsis thaliana , Gene ID: 3150037), SrCPR (Stevia rebaudiana , Gene ID: 93211213), and SpGGPPS7 (Synechococcus sp., Gene ID: 86553638) were PCR amplified together with yeast codon optimized PsCYP720B4 [ ]. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: PCR amplification of full-length TaOr8 or TaORco coding sequences was performed with antennal or maxillary palp-derived cDNA templates and the following primers: TaORco forward: 5′CACCATGAATGTTCAACCAACCAAG3′; TaORco reverse: TTACTTCAGCTGCACCAGCAC; TaOr8 forward: 5′CACCATGAGACTCAGAAAGATGAACG3′; TaOr8 reverse: 5′CTATTTCGGTCCATACATTGTT3′. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Bait plasmids of UNC-89 Ig53 and UNC-89 Fn2 were created by cloning of PCR-amplified fragments using primers shown in Supplemental Table S3 and inserted into pGBDU-C1. .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: The obtained PCR products, previously purified by DNA Clean & Concentrator-5 Kit (Zymo Research), were cloned into pGEM-T Easy Vector (Promega) according to the manufacturer's protocol. .. Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems).

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: To generate human and mouse netrin-1 AP fusion proteins in the C-terminal, human and mouse NTN1 cDNAs were amplified by PCR and cloned in pAP-Tag-5 (GenHunter, no. Q202) between NheI and BglII sites. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: All enzymatic manipulations of plasmid DNA were performed as described by the manufacturer, and all PCR amplification reactions were performed with Q5 DNA polymerase (New England Biolabs, M0491L). p2 and p3 were prepared in dam − / dcm − competent Escherichia coli (New England Biolabs, C2925I). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: Production of (S)-2-aminobutyric acid and (S)-2-aminobutanol in Saccharomyces cerevisiae
    Article Snippet: Plasmid DNA was prepared using the ZR Plasmid Miniprep-Classic Kit (Zymo Research Corp, Irvine, CA, USA). .. Plasmid DNA was prepared using the ZR Plasmid Miniprep-Classic Kit (Zymo Research Corp, Irvine, CA, USA).

    Article Title: A Novel Nonantibiotic, lgt-Based Selection System for Stable Maintenance of Expression Vectors in Escherichia coli and Vibrio cholerae
    Article Snippet: Enzymes, buffers, and deoxynucleotide mix solutions for restriction digestion of DNA, DNA modification, and PCR as well as reagents for agarose gel electrophoresis were all obtained from Thermo Fisher Scientific (Waltham, MA, USA) and used according to the manufacturer's instructions. .. Plasmids were prepared by using the ZR Plasmid Miniprep-classic kit (Zymo Research Corp., Irvine CA, USA).

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: PCR products were cloned into pCR2.1-TOPO vector using T4-DNA ligase, the TA cloning kit, and One Shot TOP10 chemically competent Escherichia coli (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA).

    Article Title: Chromosome-End Knockoff Strategy to Reshape Alkaloid Profiles of a Fungal Endophyte
    Article Snippet: Plasmid DNA was isolated from bacterial cultures using the ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA). .. Plasmid DNA was isolated from bacterial cultures using the ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA).

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching 0.6–0.92 OD600 . .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit (Zymo Research) and a 5-μg silica column (Cat. #D4003, Zymo Research) according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. This procedure was preformed in at least triplicate for each knockout strain starting from preparation of electrocompetent cells.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching an OD600 of 0.6–0.9. .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. It should be noted that the Pol II+ Δ recA strain used in these experiments ( ) had a neo cassette at the former recA locus (P_polB(−)lexA-polB+FRT+ΔrecA+KanR+lacZYA:: P_lacUV5-ΔΔ(CoOp) col 2.1, ).

    Article Title: Discovery of C-Glycosylpyranonaphthoquinones in Streptomyces sp. MBT76 by a Combined NMR-Based Metabolomics and Bioinformatics Workflow
    Article Snippet: Polymerase chain reactions (PCR) were performed on a T100 Thermal Cycler (Bio-Rad, Hercules, CA, U.S.A.). .. The ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA, U.S.A.) was used for plasmid extraction.

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: The PCR products were subcloned into pGEM-T Easy Vector (Promega) and the DNA fragments were confirmed by sequencing. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA).

    CRISPR:

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Guide sequences were selected using the Eukaryotic Pathogen CRISPR guide RNA/DNA Design Tool (EuPaGDT ( ); ) based on the calculated efficiency score against GT1 genome (and/or Me49 genome) in the latest available version of ToxoDB ( ) ( ).8 Guide sequences for each gene were cloned into p2 and p3, as described in the Addgene protocol with minor modifications. .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit.

    IA:

    Article Title: Chromosome-End Knockoff Strategy to Reshape Alkaloid Profiles of a Fungal Endophyte
    Article Snippet: Plasmid DNA was isolated from bacterial cultures using the ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA). .. For vector construction, the PCR amplifications were performed with Phusion Hot Start High-Fidelity DNA Polymerase (Thermo Scientific, Ratastie, Vantaa, Finland) with Phusion HF buffer (with 1.5 mM MgCl2 ) from the manufacturer.

    Two Hybrid Screening:

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Yeast two-hybrid screening of a C. elegans cDNA library was performed as previously described ( ). .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Plasmid Preparation:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: The blunt-ending reactions were carried out in CutSmart Buffer (New England Biolabs) with 0.01 mM dNTPs and 1 µL Klenow enzyme in 25 µL reaction volumes and were kept at 30 °C for 15 min followed by inactivation at 75 °C for 10 min. In-Fusion cloning (Takara Clontech, Saint-Germain-en-Laye, France) was carried out following standard protocol with constructs containing native diTPS due to internal endonuclease sites. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Amplicons were cloned into the pENTRTM vector using the GatewayR directional cloning system (Invitrogen Corp., Carlsbad, CA, USA) and subcloned into the Xenopus laevis expression destination vector, pSP64t RFA. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland). .. DNA and amino-acid sequences for TaOr8 and TaORco have previously been published and can be accessed here ( http://dx.doi.org/10.6084/m9.figshare.1092617 ).

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Bait plasmids of UNC-89 Ig53 and UNC-89 Fn2 were created by cloning of PCR-amplified fragments using primers shown in Supplemental Table S3 and inserted into pGBDU-C1. .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research). .. The minimum regions of PPTR-1 (75-543) and PPTR-2 (10-558) for interaction with UNC-89, as determined by yeast two-hybrid analysis, were expressed as His-tagged proteins in Escherichia coli . cDNAs encoding these two proteins were PCR-amplified using primers shown in Supplemental Table S3 from yeast two-hybrid clones, and their sequences were confirmed to be error-free.

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: In the set-up and validation of this procedure, 30 positive clones from five representative human DNA samples were analysed. .. Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). .. The effectiveness of the entire experimental procedure was also assayed by analysing: (i) CpGenome™ Universal Unmethylated DNA (Chemicon); (ii) unmethylated purified PCR products of each sub-region; and (iii) independent DNA preparations also starting from different tissues.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Mutations were introduced by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit; Agilent Technologies) with primers (listed in ) containing the mutations and verified by Sanger sequencing. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel). .. We ensured that no other mutation was introduced by sequencing the entire cDNA of NTN1 .

    Article Title: CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology
    Article Snippet: Briefly, annealed synthetic “top” and “bottom” ssDNA guide oligonucleotides flanked by BsaI-compatible 4-nucleotide overhangs were directionally cloned, and insertion was confirmed by PCRs using the “top” strand guide oligonucleotide and a downstream primer, Plasmid 1 REV. pDG plasmids were constructed by transferring the XhoI-NsiI fragment of p2 into p3 that was double-digested with XhoI and NsiI ( ). .. Plasmids were prepared in transformed Top10 cells (Thermo Fisher Scientific) using a ZR Plasmid Miniprep-Classic (Zymo Research, D4016) kit. .. Finally, the inserted guide sequences were confirmed by sequencing the pDG plasmid with primers gRNA For and gRNA Rev ( ).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Assembled DNA was transformed into competent cells prepared by the CCMB80 buffer (TekNova, C3132). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. DNA sequencing used Quintarabio DNA basic sequencing service.

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Artificial 5′URS were synthesized by BioCat GmbH (Heidelberg, Germany). .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. The nucleotide sequence of the cloned fragments was verified by sequencing.

    Article Title: Production of (S)-2-aminobutyric acid and (S)-2-aminobutanol in Saccharomyces cerevisiae
    Article Snippet: All yeast strains were stored in 25% glycerol at −80 °C. .. Plasmid DNA was prepared using the ZR Plasmid Miniprep-Classic Kit (Zymo Research Corp, Irvine, CA, USA). .. Competent E. coli NEB 10-β cells (New England Biolabs, Herts, United Kingdom) were used for all cloning steps.

    Article Title: A Novel Nonantibiotic, lgt-Based Selection System for Stable Maintenance of Expression Vectors in Escherichia coli and Vibrio cholerae
    Article Snippet: Enzymes, buffers, and deoxynucleotide mix solutions for restriction digestion of DNA, DNA modification, and PCR as well as reagents for agarose gel electrophoresis were all obtained from Thermo Fisher Scientific (Waltham, MA, USA) and used according to the manufacturer's instructions. .. Plasmids were prepared by using the ZR Plasmid Miniprep-classic kit (Zymo Research Corp., Irvine CA, USA). .. DNA products from PCRs and restriction analyses were analyzed by agarose gel electrophoresis using 1% agarose gels in 1× Tris-acetate-EDTA (TAE) buffer.

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: E. coli strains carrying plasmids were cultivated in Luria-Bertani (LB) medium supplemented with antibiotics (100 μg/ml ampicillin or 50 μg/ml kanamycin). .. Plasmid DNA was isolated using a ZR Plasmid Miniprep Classic kit (Zymo Research). .. Indole, isatin, and anthranilic acid were purchased from Sigma-Aldrich; 5-bromoindoline was obtained from Combi-Blocks, Inc. All other chemicals used in this study were of analytical grade.

    Article Title: Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus
    Article Snippet: PCR products were cloned into pCR2.1-TOPO vector using T4-DNA ligase, the TA cloning kit, and One Shot TOP10 chemically competent Escherichia coli (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA of individual clones was isolated with the ZR Plasmid Miniprep Classic Kit (Zymo Research, Irvine, CA). .. Clones were sequenced using dye terminator cycle sequencing with M13 primers on an ABI 3730 automated sequencer.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching 0.6–0.92 OD600 . .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit (Zymo Research) and a 5-μg silica column (Cat. #D4003, Zymo Research) according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. This procedure was preformed in at least triplicate for each knockout strain starting from preparation of electrocompetent cells.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: Cells were pelleted, decanted, and frozen after reaching an OD600 of 0.6–0.9. .. In vivo replicated pINFs were isolated using a ZR Plasmid Miniprep-Classic kit according to manufacturer recommendations and advanced to biotin-shift PCR analysis (see ). .. It should be noted that the Pol II+ Δ recA strain used in these experiments ( ) had a neo cassette at the former recA locus (P_polB(−)lexA-polB+FRT+ΔrecA+KanR+lacZYA:: P_lacUV5-ΔΔ(CoOp) col 2.1, ).

    Article Title: Discovery of C-Glycosylpyranonaphthoquinones in Streptomyces sp. MBT76 by a Combined NMR-Based Metabolomics and Bioinformatics Workflow
    Article Snippet: Polymerase chain reactions (PCR) were performed on a T100 Thermal Cycler (Bio-Rad, Hercules, CA, U.S.A.). .. The ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA, U.S.A.) was used for plasmid extraction. .. All organic solvents and chemicals were of analytical or HPLC grade, depending on the experiment.

    Article Title: Development of Stable Vibrio cholerae O1 Hikojima Type Vaccine Strains Co–Expressing the Inaba and Ogawa Lipopolysaccharide Antigens
    Article Snippet: Enzymes and reagents for manipulation of DNA were obtained from Thermo Fisher Scientific Inc. (Waltham, MA, USA) and reactions were carried out in buffers provided by the manufacturers according to their recommendations. .. Plasmids were isolated using the ZR Plasmid MiniprepTM Classic kit (Zymo Research Corp Irvine CA, USA). .. A library of mutations of the wbeT gene was generated by synthesizing the oligonucleotide, wbeT m1, containing the random codon (NNB) at amino acid position 158.

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: The bands were excised, purified (Purelink Quickgel extraction kit, Invitrogen), and cloned into the pGL3-Basic reporter vector (Promega) digested with the same enzymes. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA). .. SHSY5Y and NIH3T3 cells were purchased from the American Type Culture Collection (Manassas, VA) and maintained in 5 % CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 % fetal calf serum (FCS), 100 U/ml penicillin, and 100 μg/ml streptomycin in 10 cm plates.

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: CAUTION Ethidium bromide is toxic and a DNA mutagen; handle properly and avoid contact using appropriate Personal Protective Equipment. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Agarose Gel Electrophoresis:

    Article Title: A Novel Nonantibiotic, lgt-Based Selection System for Stable Maintenance of Expression Vectors in Escherichia coli and Vibrio cholerae
    Article Snippet: Enzymes, buffers, and deoxynucleotide mix solutions for restriction digestion of DNA, DNA modification, and PCR as well as reagents for agarose gel electrophoresis were all obtained from Thermo Fisher Scientific (Waltham, MA, USA) and used according to the manufacturer's instructions. .. Plasmids were prepared by using the ZR Plasmid Miniprep-classic kit (Zymo Research Corp., Irvine CA, USA).

    Article Title: Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans
    Article Snippet: Constructs were generated by digesting the pGEM-T clones with Xho I/ Hin dIII (pBDNFI, II) or Xho I/ Bgl II (pBDNFIII) restriction enzymes (Promega) and resolved on 2.0 % agarose gel. .. Plasmid DNA from all the constructs was prepared using the ZR Plasmid Mini Prep Kit (Zymo Research, CA).

    Activation Assay:

    Article Title: The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
    Article Snippet: Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). .. Therefore, plasmids were purified using ZR Plasmid Miniprep Classic (Zymo Research) and analysed by automated sequencing in a ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems).

    Thin Layer Chromatography:

    Article Title: Discovery of C-Glycosylpyranonaphthoquinones in Streptomyces sp. MBT76 by a Combined NMR-Based Metabolomics and Bioinformatics Workflow
    Article Snippet: Silica gel 60 F254 (Merck, Darmstadt, Germany) was used for TLC analysis, migrated with CHCl3 /MeOH (10:1), and visualized with anisaldehyde/sulfuric acid reagent. .. The ZR Plasmid Miniprep-Classic kit (Zymo Research, Irvine, CA, U.S.A.) was used for plasmid extraction.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Zymo Research plasmid miniprep classic kit
    Plasmid Miniprep Classic Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid miniprep classic kit/product/Zymo Research
    Average 96 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    plasmid miniprep classic kit - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    Image Search Results