pierce rna 3 end biotinylation kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Pierce RNA 3 End Biotinylation Kit
    Description:
    The Thermo Scientific Pierce RNA 3 End Biotinylation Kit is optimized for labeling the 3 prime terminal end of RNA probes to facilitate their use as probes or targets in EMSA and other methods for studying protein RNA interactions Features of the RNA 3 End Biotinylation Kit • Non radioactive incorporates a biotin label which allows detection sensitivity similar to radioactivity when used with chemiluminescent detection systems • Fast RNA can be labeled in 0 5 2 hours with minimal downstream processing • Easy to use RNA ligase and optimized reaction buffer are included • Economical only a fraction of the cost of purchasing synthetic biotinylated RNA probes • End labeled results in minimal disturbance of RNA secondary structure • Flexible label synthetic or in vitro transcribed RNA probes ranging from 22 450 nucleotides This complete kit contains an unlabeled RNA strand to use as a positive control a biotinylated RNA probe standard RNase inhibitor glycogen and ligation enhancing reagents The RNA 3 End Biotinylation Kit uses T4 RNA ligase to conjugate a single nucleotide analog to the 3 terminus of an RNA strand The unique biotinylated cytidine bis phosphate used in this kit enables T4 RNA ligase to attach a single biotin tag on RNA probes of diverse secondary structure and lengths with 70 efficiency Labeling reactions performed with the RNA 3 End Biotinylation Kit typically require 50 pmol of RNA and a 20 fold excess of biotinylated nucleotide in a 2 hour reaction at 16°C Shorter RNA probes with minimal secondary structure can be ligated in 30 minutes at 37°C e g RNA polymerase RNA template Large or structurally complex RNA probes e g Let 7 and hTR require longer incubation times Optimization of biotinylation efficiency for complex RNA molecules is achieved by altering the RNA to biotinylated cytidine ratio increasing the incubation time or by adding DMSO to the labeling reaction in order to denature the RNA structure Following the RNA biotinylation reaction labeled RNA is easily precipitated to remove reaction byproducts The biotin label enables the RNA probe to be immobilized or detected with streptavidin in order to study RNA interactions i e RNA electrophoretic mobility shift assays RNA pull down assays or to perform nonradioactive blotting assays i e Northern blotting and miRNA profiling
    Catalog Number:
    20160
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|Nucleic Acid Labeling & Oligo Synthesis|RNA Labeling|Nucleic Acid Gel Electrophoresis & Blotting
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher pierce rna 3 end biotinylation kit
    The Thermo Scientific Pierce RNA 3 End Biotinylation Kit is optimized for labeling the 3 prime terminal end of RNA probes to facilitate their use as probes or targets in EMSA and other methods for studying protein RNA interactions Features of the RNA 3 End Biotinylation Kit • Non radioactive incorporates a biotin label which allows detection sensitivity similar to radioactivity when used with chemiluminescent detection systems • Fast RNA can be labeled in 0 5 2 hours with minimal downstream processing • Easy to use RNA ligase and optimized reaction buffer are included • Economical only a fraction of the cost of purchasing synthetic biotinylated RNA probes • End labeled results in minimal disturbance of RNA secondary structure • Flexible label synthetic or in vitro transcribed RNA probes ranging from 22 450 nucleotides This complete kit contains an unlabeled RNA strand to use as a positive control a biotinylated RNA probe standard RNase inhibitor glycogen and ligation enhancing reagents The RNA 3 End Biotinylation Kit uses T4 RNA ligase to conjugate a single nucleotide analog to the 3 terminus of an RNA strand The unique biotinylated cytidine bis phosphate used in this kit enables T4 RNA ligase to attach a single biotin tag on RNA probes of diverse secondary structure and lengths with 70 efficiency Labeling reactions performed with the RNA 3 End Biotinylation Kit typically require 50 pmol of RNA and a 20 fold excess of biotinylated nucleotide in a 2 hour reaction at 16°C Shorter RNA probes with minimal secondary structure can be ligated in 30 minutes at 37°C e g RNA polymerase RNA template Large or structurally complex RNA probes e g Let 7 and hTR require longer incubation times Optimization of biotinylation efficiency for complex RNA molecules is achieved by altering the RNA to biotinylated cytidine ratio increasing the incubation time or by adding DMSO to the labeling reaction in order to denature the RNA structure Following the RNA biotinylation reaction labeled RNA is easily precipitated to remove reaction byproducts The biotin label enables the RNA probe to be immobilized or detected with streptavidin in order to study RNA interactions i e RNA electrophoretic mobility shift assays RNA pull down assays or to perform nonradioactive blotting assays i e Northern blotting and miRNA profiling
    https://www.bioz.com/result/pierce rna 3 end biotinylation kit/product/Thermo Fisher
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    pierce rna 3 end biotinylation kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Expression of leukemia inhibitory factor in Müller glia cells is regulated by a redox-dependent mRNA stability mechanism
    Article Snippet: In vitro transcription and 3′ biotin labeling RNAs used for capturing RNA binding proteins from cell extracts were generated by in vitro transcription (Maxiscript kit; Life Technologies) using PCR amplified templates from region 27, region 36 and their respective ARE-null counterparts. .. RNA probes were labeled with biotin at the 3′ end using the RNA 3′ End Biotinylation Kit (Pierce, Rockford, IL, USA).

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: RNA electrophoretic mobility shift assay (RNA EMSA) Pri-miR167b fragment was amplified from Col plant cDNAs using specific primers with a T7 promoter sequence fused to the 5’ terminal of the forward primers ( ). .. The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce).

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: 2.3 In vitro m RNA synthesis and labelling High‐fidelity DNA Taq polymerase (Phusion, ThermoFisher Scientific) was used to amplify LHY from genomic DNA (isolated from Col‐0, DNeasy Plant kit, Qiagen) using the primers gLHY‐f1; 5′‐CACGTGTCGATCTGCGATGACTTC‐3′and gLHY‐r1; 5′‐TGTAGAAGCTTCTCCTTCCAATCGAAGC‐3′ that was then template for the amplification of LHY section −774 to +438 bp (relative to the translational start site; corresponding to coordinates Chr1: 37,835 to 36,624) using the primers LHY‐ex1‐f2; 5′‐GCTGAGATTGCTTCTGGCTTCT‐3′ and LHY‐ex5‐r; 5′‐CTTTGTGAAGAACTTTTGTGC‐3′. .. RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Article Title: Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria
    Article Snippet: Biotinylated RNA pull down Ms1 and Ms1nb templates were amplified from Invitrogen DNA (GeneArt Strings DNA Fragments) with the primer carrying the T7 promoter at their 5′ end (see Supplementary Primer List). .. RNAs were prepared with a T7 RiboMAX Express Large Scale RNA Production System (Promega) and their 3′ends were biotinylated with an RNA 3′ End Biotinylation Kit (Thermo Scientific).

    Synthesized:

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: The 5′‐capped in vitro synthesized RNA was prepared using the mMESSAGE mMACHINE kit (Ambion) using the T7 RNA polymerase site according to the manufacturer's protocol. .. RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Article Title: A novel CsrA titration mechanism regulates fimbrial gene expression in Salmonella typhimurium
    Article Snippet: RNA was synthesized with the MEGAShort script kit (Ambion, Austin, TX) according to the manufacturer's instructions and the resulting RNA was gel purified. .. In all, 50 pmol of purified RNA was 3′-biotinylated using the RNA 3′ End Biotinylation kit (Pierce, Rockford, IL) according to the manufacturer's protocols.

    Construct:

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: RNA pull-down assay For RNA pull-down assay, L-pri-miR-183/96/182 and pri-miR-128-1 RNAs were in vitro transcribed using the pCMV backbone constructs as templates and MEGAscript T7 kit (Ambion). .. RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions.

    Incubation:

    Article Title: Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes
    Article Snippet: The biotinylation of cellular miRNA, cellular mRNA, and exosomal total RNA was performed using Pierce RNA 3' End Biotinylation Kit (Pierce, Thermo Fisher Scientific, USA) following the manufacturer’s instructions with some modifications. .. Biotinylation reactions were incubated at 16°C for 2h (cellular miRNA), overnight (cellular mRNA), and 3h (exosomal total RNA), and determination of the biotinylation efficiency was performed according to the manufacturer´s protocol.

    Article Title: The Arabidopsis RNA-Binding Protein AtRGGA Regulates Tolerance to Salt and Drought Stress 1The Arabidopsis RNA-Binding Protein AtRGGA Regulates Tolerance to Salt and Drought Stress 1 [OPEN]
    Article Snippet: Total RNA (700 ng) extracted from control and salt stress-treated plants was labeled with biotin using the RNA 3′ End Biotinylation Kit (Pierce Biotechnology) following the manufacturer’s instructions. .. RNA was incubated with 7.5 µg of His-tagged AtRGGA or His-tagged PYR1.

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce). .. The mixtures were incubated on ice for 30 min and then fractioned on a 6% native polyacrylamide gel in 1x TBE buffer for about 60 min.

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions. .. Biotinylated RNA transcripts (2 μg) and cell lysate (300 μg) were incubated for 30 min at room temperature in buffer containing 20 mM Tris-HCl pH 7.5, 100 mM KCl and 2 mM EDTA.

    Article Title: Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria
    Article Snippet: RNAs were prepared with a T7 RiboMAX Express Large Scale RNA Production System (Promega) and their 3′ends were biotinylated with an RNA 3′ End Biotinylation Kit (Thermo Scientific). .. RNAs were incubated in the same buffer for 1 h at 4°C with 100 μl magnetic streptavidin-coated beads (Sigma-Aldrich) while being gently agitated.

    Article Title: Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes
    Article Snippet: Biotinylation of cellular and exosomal RNA The biotinylation of cellular miRNA, cellular mRNA, and exosomal total RNA was performed using Pierce RNA 3' End Biotinylation Kit (Pierce, Thermo Fisher Scientific, USA) following the manufacturer’s instructions with some modifications. .. Biotinylation reactions were incubated at 16°C for 2h (cellular miRNA), overnight (cellular mRNA), and 3h (exosomal total RNA), and determination of the biotinylation efficiency was performed according to the manufacturer´s protocol.

    Article Title: A novel CsrA titration mechanism regulates fimbrial gene expression in Salmonella typhimurium
    Article Snippet: In all, 50 pmol of purified RNA was 3′-biotinylated using the RNA 3′ End Biotinylation kit (Pierce, Rockford, IL) according to the manufacturer's protocols. .. Increasing concentrations of purified CsrA-6xHis protein were added to the biotinylated RNA in a total volume of 10 μl in CsrA-binding buffer (10 mM Tris–HCl, pH 7.5, 10 mM MgCl2 , 100 mM KCl, 3.25 ng yeast tRNA, 20 mM DTT, 7.5% glycerol, 2 U/μl RNAse inhibitor) and incubated for 30 min at room temperature.

    RNA Binding Assay:

    Article Title: Expression of leukemia inhibitory factor in Müller glia cells is regulated by a redox-dependent mRNA stability mechanism
    Article Snippet: In vitro transcription and 3′ biotin labeling RNAs used for capturing RNA binding proteins from cell extracts were generated by in vitro transcription (Maxiscript kit; Life Technologies) using PCR amplified templates from region 27, region 36 and their respective ARE-null counterparts. .. RNA probes were labeled with biotin at the 3′ end using the RNA 3′ End Biotinylation Kit (Pierce, Rockford, IL, USA).

    Protease Inhibitor:

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions. .. Cell lysate was prepared by incubating isolated retinas in buffer containing 50 mM Tris-HCl pH 7.5, 150 mM KCl, 2 mM DTT, 10% glycerol, 0.5% Triton X-100, 100 U ml−1 of RNase inhibitor supplemented with protease inhibitor (Roche).

    Generated:

    Article Title: Expression of leukemia inhibitory factor in Müller glia cells is regulated by a redox-dependent mRNA stability mechanism
    Article Snippet: In vitro transcription and 3′ biotin labeling RNAs used for capturing RNA binding proteins from cell extracts were generated by in vitro transcription (Maxiscript kit; Life Technologies) using PCR amplified templates from region 27, region 36 and their respective ARE-null counterparts. .. RNA probes were labeled with biotin at the 3′ end using the RNA 3′ End Biotinylation Kit (Pierce, Rockford, IL, USA).

    Polymerase Chain Reaction:

    Article Title: Expression of leukemia inhibitory factor in Müller glia cells is regulated by a redox-dependent mRNA stability mechanism
    Article Snippet: In vitro transcription and 3′ biotin labeling RNAs used for capturing RNA binding proteins from cell extracts were generated by in vitro transcription (Maxiscript kit; Life Technologies) using PCR amplified templates from region 27, region 36 and their respective ARE-null counterparts. .. RNA probes were labeled with biotin at the 3′ end using the RNA 3′ End Biotinylation Kit (Pierce, Rockford, IL, USA).

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: .. The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce). .. Using LightShift Chemiluminescent RNA EMSA Kit (Thermo Pierce) according to manufactory’s protocol RNA EMSA assays were performed in a 20-μl reaction buffer containing 5% glycerol, 2ug tRNA and 1 nM of labeled pri-miR167b transcripts and purified recombinant proteins, including CDF2, DCL1-RBD, HYL1, CDF2-N (from aa 1 to 279) and CDF2-C (from aa 280 to 457).

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms
    Article Snippet: The annealed product was subjected to PCR‐based filling with Taq polymerase (Thermo Scientific) and agarose gel‐purified using the Syngen Gel/PCR Mini Kit. .. The probes were biotinylated for 2 h at 16°C using the Pierce RNA 3′ End Biotinylation Kit and purified by chloroform extraction.

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: This PCR product was inserted into pCR4‐TOPO (ThermoFisher Scientific), sequence verified, and linearized with Spe I (Promega). .. RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Article Title: Viral Genome-Linked Protein (VPg) Is Essential for Translation Initiation of Rabbit Hemorrhagic Disease Virus (RHDV)
    Article Snippet: RHDV-NSP2 was used as an irrelevant PCR control with primers NSP2-F (5′-GGGGAAGTTGACGACCTGTTT-3′) and NSP2-R (5′-CTCAAACGTGTCAAACAACCT-3′) and the pTVT-RHDV plasmid as template. .. After transcription, a single biotinylated nucleotide was attached to the 3′ terminus of the 5′ -Extreme RNA of RHDV using the RNA 3′ End Biotinylation Kit (Pierce, USA).

    Binding Assay:

    Article Title: Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1
    Article Snippet: The transcribed RNAs were biotinylated on their 3′ end using RNA 3′ End Biotinylation Kit (Thermo Scientific Pierce). .. For binding assay, RNAs were biotinylated at both ends.

    Pull Down Assay:

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: Paragraph title: RNA pull-down assay ... RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions.

    Mutagenesis:

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms
    Article Snippet: Preparation and biotinylation of oligonucleotides Three types of oligonucleotides were used for the specific experiments: Human wild‐type, mutant, and delta MMP‐9 RNA probes (˜80 nt, sequences listed below) were prepared for REMSA on the template of annealed shorter overlapping oligonucleotides (˜50 nt). .. The probes were biotinylated for 2 h at 16°C using the Pierce RNA 3′ End Biotinylation Kit and purified by chloroform extraction.

    Isolation:

    Article Title: The Arabidopsis RNA-Binding Protein AtRGGA Regulates Tolerance to Salt and Drought Stress 1The Arabidopsis RNA-Binding Protein AtRGGA Regulates Tolerance to Salt and Drought Stress 1 [OPEN]
    Article Snippet: Total RNA (700 ng) extracted from control and salt stress-treated plants was labeled with biotin using the RNA 3′ End Biotinylation Kit (Pierce Biotechnology) following the manufacturer’s instructions. .. Similar amounts of labeled RNA were also used for poly(A+ ) and poly(A− ) RNA, which were prepared using the mRNA Isolation Kit (Roche Applied Science).

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: 2.3 In vitro m RNA synthesis and labelling High‐fidelity DNA Taq polymerase (Phusion, ThermoFisher Scientific) was used to amplify LHY from genomic DNA (isolated from Col‐0, DNeasy Plant kit, Qiagen) using the primers gLHY‐f1; 5′‐CACGTGTCGATCTGCGATGACTTC‐3′and gLHY‐r1; 5′‐TGTAGAAGCTTCTCCTTCCAATCGAAGC‐3′ that was then template for the amplification of LHY section −774 to +438 bp (relative to the translational start site; corresponding to coordinates Chr1: 37,835 to 36,624) using the primers LHY‐ex1‐f2; 5′‐GCTGAGATTGCTTCTGGCTTCT‐3′ and LHY‐ex5‐r; 5′‐CTTTGTGAAGAACTTTTGTGC‐3′. .. RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions. .. Cell lysate was prepared by incubating isolated retinas in buffer containing 50 mM Tris-HCl pH 7.5, 150 mM KCl, 2 mM DTT, 10% glycerol, 0.5% Triton X-100, 100 U ml−1 of RNase inhibitor supplemented with protease inhibitor (Roche).

    Electrophoretic Mobility Shift Assay:

    Article Title: Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1
    Article Snippet: Paragraph title: RNA probe preparation and RNA electrophoretic mobility shift assays (REMSA) ... The transcribed RNAs were biotinylated on their 3′ end using RNA 3′ End Biotinylation Kit (Thermo Scientific Pierce).

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: Paragraph title: RNA electrophoretic mobility shift assay (RNA EMSA) ... The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce).

    Purification:

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce). .. Using LightShift Chemiluminescent RNA EMSA Kit (Thermo Pierce) according to manufactory’s protocol RNA EMSA assays were performed in a 20-μl reaction buffer containing 5% glycerol, 2ug tRNA and 1 nM of labeled pri-miR167b transcripts and purified recombinant proteins, including CDF2, DCL1-RBD, HYL1, CDF2-N (from aa 1 to 279) and CDF2-C (from aa 280 to 457).

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms
    Article Snippet: .. The probes were biotinylated for 2 h at 16°C using the Pierce RNA 3′ End Biotinylation Kit and purified by chloroform extraction. ..

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: RNA was purified and recovered with ammonium acetate followed by phenol:chloroform (1:1) extraction and isopropanol precipitation. .. RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions. .. In vitro transcripts were analysed on agarose gels and purified according to the manufacturer's instructions (Ambion).

    Article Title: A novel CsrA titration mechanism regulates fimbrial gene expression in Salmonella typhimurium
    Article Snippet: .. In all, 50 pmol of purified RNA was 3′-biotinylated using the RNA 3′ End Biotinylation kit (Pierce, Rockford, IL) according to the manufacturer's protocols. ..

    Dot Blot:

    Article Title: Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1
    Article Snippet: The transcribed RNAs were biotinylated on their 3′ end using RNA 3′ End Biotinylation Kit (Thermo Scientific Pierce). .. Ribogreen assay (Life Technologies) was used to quantify concentration of RNA, and dot blot was performed to confirm the biotinylation efficiency.

    Sequencing:

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: RNA electrophoretic mobility shift assay (RNA EMSA) Pri-miR167b fragment was amplified from Col plant cDNAs using specific primers with a T7 promoter sequence fused to the 5’ terminal of the forward primers ( ). .. The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce).

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms
    Article Snippet: The forward primer contained the T7 RNA polymerase promoter sequence to enable in vitro transcription of the RNA probe. .. The probes were biotinylated for 2 h at 16°C using the Pierce RNA 3′ End Biotinylation Kit and purified by chloroform extraction.

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: This PCR product was inserted into pCR4‐TOPO (ThermoFisher Scientific), sequence verified, and linearized with Spe I (Promega). .. RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Labeling:

    Article Title: Expression of leukemia inhibitory factor in Müller glia cells is regulated by a redox-dependent mRNA stability mechanism
    Article Snippet: .. RNA probes were labeled with biotin at the 3′ end using the RNA 3′ End Biotinylation Kit (Pierce, Rockford, IL, USA). .. Quantitative mass spectrometry analysis and GO-pathway analysis rMC-1 cells were grown in SILAC DMEM (GE Healthcare Life Sciences, Pittsburgh, PA, USA) supplemented with 3 mM L-glutamine (GE Healthcare Life Sciences), 10% dialyzed fetal bovine serum (GE Healthcare Life Sciences) and 0.55 mM lysine, 0.4 mM arginine.

    Article Title: The Arabidopsis RNA-Binding Protein AtRGGA Regulates Tolerance to Salt and Drought Stress 1The Arabidopsis RNA-Binding Protein AtRGGA Regulates Tolerance to Salt and Drought Stress 1 [OPEN]
    Article Snippet: .. Total RNA (700 ng) extracted from control and salt stress-treated plants was labeled with biotin using the RNA 3′ End Biotinylation Kit (Pierce Biotechnology) following the manufacturer’s instructions. .. One microliter of a 1:20 dilution (approximately 30 ng) of the labeled RNA was used for each reaction.

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: .. The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce). .. Using LightShift Chemiluminescent RNA EMSA Kit (Thermo Pierce) according to manufactory’s protocol RNA EMSA assays were performed in a 20-μl reaction buffer containing 5% glycerol, 2ug tRNA and 1 nM of labeled pri-miR167b transcripts and purified recombinant proteins, including CDF2, DCL1-RBD, HYL1, CDF2-N (from aa 1 to 279) and CDF2-C (from aa 280 to 457).

    Lysis:

    Article Title: Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria
    Article Snippet: RNAs were prepared with a T7 RiboMAX Express Large Scale RNA Production System (Promega) and their 3′ends were biotinylated with an RNA 3′ End Biotinylation Kit (Thermo Scientific). .. The beads were then washed with lysis buffer (20 mM Tris-HCl pH 7.9, 150 mM KCl, 1 mM MgCl2 ) and incubated with ∼400 μg of cell extract (prepared in the same way as for glycerol gradient ultracentrifugation) for 1 h at 4°C, washed 4× with lysis buffer, resuspended in SDS sample buffer, heated for 5 min at 95°C and the eluted proteins were detected by SDS-PAGE and Coomassie staining (SimplyBlue, Invitrogen).

    SDS Page:

    Article Title: Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria
    Article Snippet: RNAs were prepared with a T7 RiboMAX Express Large Scale RNA Production System (Promega) and their 3′ends were biotinylated with an RNA 3′ End Biotinylation Kit (Thermo Scientific). .. The beads were then washed with lysis buffer (20 mM Tris-HCl pH 7.9, 150 mM KCl, 1 mM MgCl2 ) and incubated with ∼400 μg of cell extract (prepared in the same way as for glycerol gradient ultracentrifugation) for 1 h at 4°C, washed 4× with lysis buffer, resuspended in SDS sample buffer, heated for 5 min at 95°C and the eluted proteins were detected by SDS-PAGE and Coomassie staining (SimplyBlue, Invitrogen).

    Plasmid Preparation:

    Article Title: Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1
    Article Snippet: RNA probe preparation and RNA electrophoretic mobility shift assays (REMSA) The pcDNA3 plasmid (Life Technologies) containing the full-length 3′ UTR of rat β-actin mRNA was linearized with XhoI restriction endonuclease and transcribed in vitro from the SP6 promoter using Riboprobe® In Vitro Transcription Systems (Promega) as described in the technical manual. .. The transcribed RNAs were biotinylated on their 3′ end using RNA 3′ End Biotinylation Kit (Thermo Scientific Pierce).

    Article Title: Viral Genome-Linked Protein (VPg) Is Essential for Translation Initiation of Rabbit Hemorrhagic Disease Virus (RHDV)
    Article Snippet: RHDV-NSP2 was used as an irrelevant PCR control with primers NSP2-F (5′-GGGGAAGTTGACGACCTGTTT-3′) and NSP2-R (5′-CTCAAACGTGTCAAACAACCT-3′) and the pTVT-RHDV plasmid as template. .. After transcription, a single biotinylated nucleotide was attached to the 3′ terminus of the 5′ -Extreme RNA of RHDV using the RNA 3′ End Biotinylation Kit (Pierce, USA).

    Recombinant:

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce). .. Using LightShift Chemiluminescent RNA EMSA Kit (Thermo Pierce) according to manufactory’s protocol RNA EMSA assays were performed in a 20-μl reaction buffer containing 5% glycerol, 2ug tRNA and 1 nM of labeled pri-miR167b transcripts and purified recombinant proteins, including CDF2, DCL1-RBD, HYL1, CDF2-N (from aa 1 to 279) and CDF2-C (from aa 280 to 457).

    Agarose Gel Electrophoresis:

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms
    Article Snippet: RNA integrity was verified by agarose gel electrophoresis. .. The probes were biotinylated for 2 h at 16°C using the Pierce RNA 3′ End Biotinylation Kit and purified by chloroform extraction.

    In Vitro:

    Article Title: Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1
    Article Snippet: RNA probe preparation and RNA electrophoretic mobility shift assays (REMSA) The pcDNA3 plasmid (Life Technologies) containing the full-length 3′ UTR of rat β-actin mRNA was linearized with XhoI restriction endonuclease and transcribed in vitro from the SP6 promoter using Riboprobe® In Vitro Transcription Systems (Promega) as described in the technical manual. .. The transcribed RNAs were biotinylated on their 3′ end using RNA 3′ End Biotinylation Kit (Thermo Scientific Pierce).

    Article Title: Expression of leukemia inhibitory factor in Müller glia cells is regulated by a redox-dependent mRNA stability mechanism
    Article Snippet: Paragraph title: In vitro transcription and 3′ biotin labeling ... RNA probes were labeled with biotin at the 3′ end using the RNA 3′ End Biotinylation Kit (Pierce, Rockford, IL, USA).

    Article Title: The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs
    Article Snippet: .. The PCR products were then used as templates for in vitro transcription (Megascript; Ambion), then make biotin labeled or unlabeled RNA transcripts using RNA 3’ End Biotinylation Kit (Thermo Pierce). .. Using LightShift Chemiluminescent RNA EMSA Kit (Thermo Pierce) according to manufactory’s protocol RNA EMSA assays were performed in a 20-μl reaction buffer containing 5% glycerol, 2ug tRNA and 1 nM of labeled pri-miR167b transcripts and purified recombinant proteins, including CDF2, DCL1-RBD, HYL1, CDF2-N (from aa 1 to 279) and CDF2-C (from aa 280 to 457).

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms
    Article Snippet: The forward primer contained the T7 RNA polymerase promoter sequence to enable in vitro transcription of the RNA probe. .. The probes were biotinylated for 2 h at 16°C using the Pierce RNA 3′ End Biotinylation Kit and purified by chloroform extraction.

    Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
    Article Snippet: Paragraph title: In vitro m RNA synthesis and labelling ... RNA (approximately 70–400 ng) was labelled using the RNA 3′end biotinylation kit (Pierce) according to the manufacturer's instructions.

    Article Title: Viral Genome-Linked Protein (VPg) Is Essential for Translation Initiation of Rabbit Hemorrhagic Disease Virus (RHDV)
    Article Snippet: Evaluation of the interaction between VPg protein and the 5′ -Extreme RNA of RHDV The 5′ -Extreme RNA of RHDV, including the 5′ UTR and NSP1-coding region of RHDV, was produced by in vitro transcription using the T7 RNA polymerase RiboMAX Large Scale RNA Production System (Promega, USA). .. After transcription, a single biotinylated nucleotide was attached to the 3′ terminus of the 5′ -Extreme RNA of RHDV using the RNA 3′ End Biotinylation Kit (Pierce, USA).

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture
    Article Snippet: RNA pull-down assay For RNA pull-down assay, L-pri-miR-183/96/182 and pri-miR-128-1 RNAs were in vitro transcribed using the pCMV backbone constructs as templates and MEGAscript T7 kit (Ambion). .. RNAs were 3′-end-biotinylated using the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) according to the manufacturer's instructions.

    Article Title: A novel CsrA titration mechanism regulates fimbrial gene expression in Salmonella typhimurium
    Article Snippet: The T7 promoter-driven wild-type, mutated fimA 5′-UTRs, and pefA 5′-UTRs were cut out of their respective vectors (pTS31, pTS3, pTS48 and pTS51-57) with Eco RI, gel purified and then used as templates for in vitro transcription. .. In all, 50 pmol of purified RNA was 3′-biotinylated using the RNA 3′ End Biotinylation kit (Pierce, Rockford, IL) according to the manufacturer's protocols.

    Produced:

    Article Title: Viral Genome-Linked Protein (VPg) Is Essential for Translation Initiation of Rabbit Hemorrhagic Disease Virus (RHDV)
    Article Snippet: Evaluation of the interaction between VPg protein and the 5′ -Extreme RNA of RHDV The 5′ -Extreme RNA of RHDV, including the 5′ UTR and NSP1-coding region of RHDV, was produced by in vitro transcription using the T7 RNA polymerase RiboMAX Large Scale RNA Production System (Promega, USA). .. After transcription, a single biotinylated nucleotide was attached to the 3′ terminus of the 5′ -Extreme RNA of RHDV using the RNA 3′ End Biotinylation Kit (Pierce, USA).

    Article Title: A novel CsrA titration mechanism regulates fimbrial gene expression in Salmonella typhimurium
    Article Snippet: DNA templates for generating phoB RNA transcript were produced by annealing primers , also described in . .. In all, 50 pmol of purified RNA was 3′-biotinylated using the RNA 3′ End Biotinylation kit (Pierce, Rockford, IL) according to the manufacturer's protocols.

    Concentration Assay:

    Article Title: Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1
    Article Snippet: The transcribed RNAs were biotinylated on their 3′ end using RNA 3′ End Biotinylation Kit (Thermo Scientific Pierce). .. Ribogreen assay (Life Technologies) was used to quantify concentration of RNA, and dot blot was performed to confirm the biotinylation efficiency.

    Staining:

    Article Title: Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria
    Article Snippet: RNAs were prepared with a T7 RiboMAX Express Large Scale RNA Production System (Promega) and their 3′ends were biotinylated with an RNA 3′ End Biotinylation Kit (Thermo Scientific). .. The beads were then washed with lysis buffer (20 mM Tris-HCl pH 7.9, 150 mM KCl, 1 mM MgCl2 ) and incubated with ∼400 μg of cell extract (prepared in the same way as for glycerol gradient ultracentrifugation) for 1 h at 4°C, washed 4× with lysis buffer, resuspended in SDS sample buffer, heated for 5 min at 95°C and the eluted proteins were detected by SDS-PAGE and Coomassie staining (SimplyBlue, Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher end biotinylation kit
    End Biotinylation Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/end biotinylation kit/product/Thermo Fisher
    Average 90 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    end biotinylation kit - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results