phusion taq dna polymerase  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Phusion High Fidelity DNA Polymerase 2 U µL
    Thermo Scientific Phusion High Fidelity DNA Polymerases set a gold standard for high performance PCR Featuring an error rate 50 fold lower than that of Taq and 6 fold lower than that of Pfu Phusion High Fidelity DNA Polymerase is excellent choice for cloning and other applications requiring high fidelity Phusion DNA Polymerases offer robust performance with short protocol times even in the presence of PCR inhibitors and generate higher yields with lower enzyme amounts than other DNA polymerase Highlights• High fidelity 52X Taq • Fast PCR due to short extension times 15 30 s kb • Robust performance minimal optimization needed• High yields of PCR products with minimal enzyme amounts• Available as a Green buffer format for direct loading of PCR products on gels F 534S or F 534L Applications• High fidelity PCR• Cloning• Template generation for sequencing• Amplification of difficult GC rich templates• Long range PCR up to 20 kb • Mutagenesis• High throughput PCR• MicroarrayUsing Phusion DNA Polymerases Annealing rules for Phusion DNA Polymerases are different from many common DNA polymerases such as Taq DNA polymerases For optimal results use our Tm calculator at www thermofisher com tmcalculator
    Catalog Number:
    High Fidelity PCR|PCR|PCR & Real-Time PCR
    Proteins Enzymes Peptides
    Buy from Supplier

    Structured Review

    Thermo Fisher phusion taq dna polymerase
    Thermo Scientific Phusion High Fidelity DNA Polymerases set a gold standard for high performance PCR Featuring an error rate 50 fold lower than that of Taq and 6 fold lower than that of Pfu Phusion High Fidelity DNA Polymerase is excellent choice for cloning and other applications requiring high fidelity Phusion DNA Polymerases offer robust performance with short protocol times even in the presence of PCR inhibitors and generate higher yields with lower enzyme amounts than other DNA polymerase Highlights• High fidelity 52X Taq • Fast PCR due to short extension times 15 30 s kb • Robust performance minimal optimization needed• High yields of PCR products with minimal enzyme amounts• Available as a Green buffer format for direct loading of PCR products on gels F 534S or F 534L Applications• High fidelity PCR• Cloning• Template generation for sequencing• Amplification of difficult GC rich templates• Long range PCR up to 20 kb • Mutagenesis• High throughput PCR• MicroarrayUsing Phusion DNA Polymerases Annealing rules for Phusion DNA Polymerases are different from many common DNA polymerases such as Taq DNA polymerases For optimal results use our Tm calculator at www thermofisher com tmcalculator taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    phusion taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: Paragraph title: Cloning and expression of the glutamyl-tRNA reductase gene ... The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL.

    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S). .. The amplified PCR product was then directionally cloned into a TOPO cloning vector, pENTR/D-TOPO (Invitrogen) according to the manufacturer’s instructions.

    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: In the next cloning step IRES (internal ribosome entry site)-HSV-tk (Herpes Simplex Virus-Thymidine Kinase) was PCR amplified from Addgene Plasmid 12243: pLOX-gfp-iresTK by utilizing the primers tcgagctcaagcttcgaatta and taaaggtaccgtcgagccaaa . .. Phusion high-fidelity polymerase (Finnzymes) was used for the amplification.


    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The resulting plasmid was transformed into Max Efficiency Stbl2 cells (Life Technologies), expanded and purified by double banded cesium chloride centrifugation.

    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: Nuclei were isolated by 15-min incubation in 1 × TE buffer (1 m m EDTA, 10 m m Tris-HCl (pH 8.0)) supplemented with 0.5% Triton X-100 at 37 °C, followed by 15 min of centrifugation at 3000 rpm and 4 °C. .. Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter.


    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The PCR programme was as follows: 30 s at 98 °C for pre-denaturation, 35 cycles of amplification step (10 s at 98 °C, 30 s at 55 °C and 45 s at 72 °C) followed by a final extension at 72 °C for 5 min. .. The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL.

    Article Title: AT1-receptor response to non-saturating Ang-II concentrations is amplified by calcium channel blockers
    Article Snippet: .. Primers for CaV 1.1, CaV 1.2 and CaV 1.4 were designed and used for PCR amplification (Phusion High-Fidelity DNA polymerase, Thermo Scientific). .. PCR amplification was run using the manufacturer’s protocols with the following program changes: 40 cycles with 10s extension time.

    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: .. In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S). .. The PCR primers used to amplify the five ecf genes are listed in .

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ]. .. The QIAquick PCR purification kit was then used as per manufacturer’s instructions (Qiagen, Valencia, CA) to purify the amplicon.

    Article Title: Immunological Analysis of a CCHFV mRNA Vaccine Candidate in Mouse Models
    Article Snippet: The amplified S segment was then exploited as a linear double-stranded DNA template for the mRNA vaccine creation. .. The PCR reaction was carried out by Phusion High Fidelity Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) from pCD-N1 as follows: initial denaturation at 98 °C for 30 s, and 30 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 20 s and extension at 72 °C for 40 s, followed by final extension at 72 °C for 5 min.

    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: .. Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter. .. The fragments were mixed in equimolar concentration, digested with Csp6I, purified using the Qiagen PCR purification kit, and ligated with T4 DNA ligase (New England Biolabs).

    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: .. Phusion high-fidelity polymerase (Finnzymes) was used for the amplification. .. The cycling parameters were: Initial denaturation: 98°C×30 sec; Denaturation: 98°C×5 sec, Extension: 72°C×60 sec, for 35 cycles; Final extension: 72°C×10 min; Hold: 4°C.


    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. Phire PCR cycling conditions were: initial denaturing at 98°C for 2 m, followed by 28 cycles of denaturing temperature at 98°C for 30 s, annealing temperature at 62°C for 30 s, and extension temperature at 72°C for 30 s; the program then ended with a single step of 72°C for 5 m. Phusion PCR cycling conditions were: initial denaturing at 98°C for 2 m, followed by various cycles ( ) of denaturing temperature at 98°C for 30 s, primer-specific annealing temperature ( ) for 30 s, and extension temperature at 72°C for 30 s; the program then ended with a single step of 72°C for 5 m. For RT-qPCR, RNA was extracted with Trizol (Invitrogen) and cDNA was synthesized with First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturers’ protocol. qPCR reactions were performed with Luminaris Color HiGreen High ROX qPCR Master Mix (Thermo Scientific) on Realplex4 with Mastercycler ep realplex software (Eppendorf). qPCR PCR cycling conditions were: initial denaturing at 95°C for 10 m, followed by 40 cycles of denaturing temperature at 95°C for 20 s, annealing temperature at 55°C for 30 s, and extension temperature at 72°C for 30 s. All primer sequences, annealing temperatures, and cycle numbers can be found in .

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The 1811 bp long DNA fragment including both the glutamyl-tRNA reductase gene and its upstream genetic elements was synthesized using designed primers (forward primer: 5′-GAATTCGTCACCACCGATCT-3′; reverse primer: 5′-GGCTCAGGTTCTCTTCCAAA-3′). .. The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL.


    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: .. PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. All PCR reactions were carried out on Mastercycler S (Eppendorf).

    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S). .. LR clonase II (Invitrogen) was used to carry out recombination between the pENTR construct and the Gateway destination vector, pLVC-D .

    Article Title: Immunological Analysis of a CCHFV mRNA Vaccine Candidate in Mouse Models
    Article Snippet: Paragraph title: 2.3. mRNA Vaccine Construct ... The PCR reaction was carried out by Phusion High Fidelity Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) from pCD-N1 as follows: initial denaturation at 98 °C for 30 s, and 30 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 20 s and extension at 72 °C for 40 s, followed by final extension at 72 °C for 5 min.

    Real-time Polymerase Chain Reaction:

    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: Paragraph title: Genotyping PCR, two-template PCR and quantitative-PCR (qPCR) ... PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template.

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: Laboratory methods All stool samples were tested for Cryptosporidium species by real-time polymerase chain reaction. .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ].


    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: Nuclei were isolated by 15-min incubation in 1 × TE buffer (1 m m EDTA, 10 m m Tris-HCl (pH 8.0)) supplemented with 0.5% Triton X-100 at 37 °C, followed by 15 min of centrifugation at 3000 rpm and 4 °C. .. Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter.


    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: Paragraph title: Cloning and expression of the glutamyl-tRNA reductase gene ... The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL.


    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: Construction of markerless ecf gene deletions in B728a Precise deletion mutants of five ECF σ factor genes, ecf5 (Psyr_1040), ecf7 (Psyr_1107), ecf6 (Psyr_4731), ecf11 (Psyr_0892), and ecf18 (Psyr_0362), were created in strain B728a using a modified , Red recombinase deletion method . .. In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S).

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: COWP positive samples were further genotyped by the polymorphic region within the gp60 gene using primers and conditions previously described [ , ] but with the modification that the amplifications were done using the MyFi (Bioline, Taunton, MA) with an activation 94°C for 5 min followed by 40 cycles in the primary PCR (94°C, 30 sec; 45°C, 55 sec; 72°C, 60 sec) with a final extension of 10min at 72°C. .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ].

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The GeneArt Seamless PLUS kit was then used to assemble the PCR fragments of the SIVmac239 genome bearing the newly modified nucleotides (Life Technologies).

    Transformation Assay:

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The resulting plasmid was transformed into Max Efficiency Stbl2 cells (Life Technologies), expanded and purified by double banded cesium chloride centrifugation.

    Gel Purification:

    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: .. PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. All PCR reactions were carried out on Mastercycler S (Eppendorf).


    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: The ligation resulted in a plasmid which was labeled as pMKOS-WPXL. .. Phusion high-fidelity polymerase (Finnzymes) was used for the amplification.

    Genomic Sequencing:

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. Full-length genomic sequencing was performed on the final plasmid preps to confirm point mutation generation and correct assembly of PCR fragments.


    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: .. Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The GeneArt Seamless PLUS kit was then used to assemble the PCR fragments of the SIVmac239 genome bearing the newly modified nucleotides (Life Technologies).


    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: .. Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter. .. The fragments were mixed in equimolar concentration, digested with Csp6I, purified using the Qiagen PCR purification kit, and ligated with T4 DNA ligase (New England Biolabs).


    Article Title: Protocol: a fast and simple in situ PCR method for localising gene expression in plant tissue
    Article Snippet: •HiFiPhusion polymerase (Thermo Scientific, 2 U μL−1 , cat. no. F-530S).


    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ]. .. As necessary for the Phusion enzyme the activation step was at 98°C, 20 sec was followed by 34 cycles (98°C, 10 sec; 60°C, 20 sec; 72°C, 20 sec) with a final extension of 10min at 72°C.

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: Paragraph title: Direct sanger sequencing ... The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific).

    Binding Assay:

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ]. .. As necessary for the Phusion enzyme the activation step was at 98°C, 20 sec was followed by 34 cycles (98°C, 10 sec; 60°C, 20 sec; 72°C, 20 sec) with a final extension of 10min at 72°C.

    DNA Extraction:

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: DNA Extraction was performed by a modified QiaAmp stool DNA extraction protocol which incorporates a three-minute bead-beating step to lyse Cryptosporidium oocysts (Qiagen, Valencia, CA) [ ]. .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ].


    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: .. PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. All PCR reactions were carried out on Mastercycler S (Eppendorf).

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: To include the DNA sequences 150 bp up- and down-stream of the identified PLA2G6 mutation, forward ( 5’-TCCAGCTTCTCATCGCCATC-3’ ) and reverse ( 5’-CACCCCACAAAGGGCTTTCA-3’ ) primers were designed using Primer-BLAST online software ( ). .. The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific).

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: .. Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The GeneArt Seamless PLUS kit was then used to assemble the PCR fragments of the SIVmac239 genome bearing the newly modified nucleotides (Life Technologies).


    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: Nuclei were isolated by 15-min incubation in 1 × TE buffer (1 m m EDTA, 10 m m Tris-HCl (pH 8.0)) supplemented with 0.5% Triton X-100 at 37 °C, followed by 15 min of centrifugation at 3000 rpm and 4 °C. .. Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter.

    Size-exclusion Chromatography:

    Article Title: Selection of efficient Taq DNA polymerase to optimize T-DNA genotyping method for rapid detection of mutant Arabidopsis thaliana plants
    Article Snippet: The following DNA polymerases were tested: Phusion High-Fidelity DNA polymerase (ThermoFisher Scientific, USA, cat #F530S), Ex-Taq DNA polymerase (Clontech, USA, cat #RR001A), Taq DNA polymerase (SibEnzyme, Russia, cat #E331), Emerald Amp GT PCR Master Mix (Clontech, USA, cat #RR310A). .. For all reactions the following PCR protocol was used: 2 min at 96°C, 35 cycles of 96°C (10 sec), 57°C (25 sec) and 72°C (1,5 min), followed by 5 min at 72°C.

    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: Phusion high-fidelity polymerase (Finnzymes) was used for the amplification. .. The cycling parameters were: Initial denaturation: 98°C×30 sec; Denaturation: 98°C×5 sec, Extension: 72°C×60 sec, for 35 cycles; Final extension: 72°C×10 min; Hold: 4°C.


    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: The ligation resulted in a plasmid which was labeled as pMKOS-WPXL. .. Phusion high-fidelity polymerase (Finnzymes) was used for the amplification.


    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL. .. The mixtures were then loaded into an agarose gel (1%) and purified using a gel extraction kit (Qiagen).

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ]. .. The QIAquick PCR purification kit was then used as per manufacturer’s instructions (Qiagen, Valencia, CA) to purify the amplicon.

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific). .. The DNA amplicons were purified using the QIAGEN DNA purification kit (QIAGEN), loaded onto a 1% agarose gel, and then electrophoresed for 25 minutes.

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The resulting plasmid was transformed into Max Efficiency Stbl2 cells (Life Technologies), expanded and purified by double banded cesium chloride centrifugation.

    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter. .. The fragments were mixed in equimolar concentration, digested with Csp6I, purified using the Qiagen PCR purification kit, and ligated with T4 DNA ligase (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: .. PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. All PCR reactions were carried out on Mastercycler S (Eppendorf).

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The PCR programme was as follows: 30 s at 98 °C for pre-denaturation, 35 cycles of amplification step (10 s at 98 °C, 30 s at 55 °C and 45 s at 72 °C) followed by a final extension at 72 °C for 5 min. .. The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL.

    Article Title: AT1-receptor response to non-saturating Ang-II concentrations is amplified by calcium channel blockers
    Article Snippet: .. Primers for CaV 1.1, CaV 1.2 and CaV 1.4 were designed and used for PCR amplification (Phusion High-Fidelity DNA polymerase, Thermo Scientific). .. PCR amplification was run using the manufacturer’s protocols with the following program changes: 40 cycles with 10s extension time.

    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: .. In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S). .. The PCR primers used to amplify the five ecf genes are listed in .

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ]. .. As necessary for the Phusion enzyme the activation step was at 98°C, 20 sec was followed by 34 cycles (98°C, 10 sec; 60°C, 20 sec; 72°C, 20 sec) with a final extension of 10min at 72°C.

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: .. The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific). ..

    Article Title: Immunological Analysis of a CCHFV mRNA Vaccine Candidate in Mouse Models
    Article Snippet: .. The PCR reaction was carried out by Phusion High Fidelity Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) from pCD-N1 as follows: initial denaturation at 98 °C for 30 s, and 30 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 20 s and extension at 72 °C for 40 s, followed by final extension at 72 °C for 5 min. .. The mRNAs were created from the gel-purified PCR products by mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer′s instruction.

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The GeneArt Seamless PLUS kit was then used to assemble the PCR fragments of the SIVmac239 genome bearing the newly modified nucleotides (Life Technologies).

    Article Title: Selection of efficient Taq DNA polymerase to optimize T-DNA genotyping method for rapid detection of mutant Arabidopsis thaliana plants
    Article Snippet: .. The following DNA polymerases were tested: Phusion High-Fidelity DNA polymerase (ThermoFisher Scientific, USA, cat #F530S), Ex-Taq DNA polymerase (Clontech, USA, cat #RR001A), Taq DNA polymerase (SibEnzyme, Russia, cat #E331), Emerald Amp GT PCR Master Mix (Clontech, USA, cat #RR310A). .. 10 ng of genomic DNA and 10 μM of each primer were used in all PCR reactions; all other components of PCR reactions were added according to the manufacturer’s suggested protocol for each individual polymerase.

    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: .. Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter. .. The fragments were mixed in equimolar concentration, digested with Csp6I, purified using the Qiagen PCR purification kit, and ligated with T4 DNA ligase (New England Biolabs).

    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: In the next cloning step IRES (internal ribosome entry site)-HSV-tk (Herpes Simplex Virus-Thymidine Kinase) was PCR amplified from Addgene Plasmid 12243: pLOX-gfp-iresTK by utilizing the primers tcgagctcaagcttcgaatta and taaaggtaccgtcgagccaaa . .. Phusion high-fidelity polymerase (Finnzymes) was used for the amplification.

    Quantitative RT-PCR:

    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. Phire PCR cycling conditions were: initial denaturing at 98°C for 2 m, followed by 28 cycles of denaturing temperature at 98°C for 30 s, annealing temperature at 62°C for 30 s, and extension temperature at 72°C for 30 s; the program then ended with a single step of 72°C for 5 m. Phusion PCR cycling conditions were: initial denaturing at 98°C for 2 m, followed by various cycles ( ) of denaturing temperature at 98°C for 30 s, primer-specific annealing temperature ( ) for 30 s, and extension temperature at 72°C for 30 s; the program then ended with a single step of 72°C for 5 m. For RT-qPCR, RNA was extracted with Trizol (Invitrogen) and cDNA was synthesized with First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturers’ protocol. qPCR reactions were performed with Luminaris Color HiGreen High ROX qPCR Master Mix (Thermo Scientific) on Realplex4 with Mastercycler ep realplex software (Eppendorf). qPCR PCR cycling conditions were: initial denaturing at 95°C for 10 m, followed by 40 cycles of denaturing temperature at 95°C for 20 s, annealing temperature at 55°C for 30 s, and extension temperature at 72°C for 30 s. All primer sequences, annealing temperatures, and cycle numbers can be found in .

    Polymerase Cycling Assembly:

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. Full-length genomic sequencing was performed on the final plasmid preps to confirm point mutation generation and correct assembly of PCR fragments.

    Plasmid Preparation:

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL. .. The PCR products became ready to ligate into the vector. pBBR1MCS2, which can replicate in R. sphaeroides , was used to clone and express the glutamyl-tRNA reductase gene.

    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S). .. The amplified PCR product was then directionally cloned into a TOPO cloning vector, pENTR/D-TOPO (Invitrogen) according to the manufacturer’s instructions.

    Article Title: Immunological Analysis of a CCHFV mRNA Vaccine Candidate in Mouse Models
    Article Snippet: 2.3. mRNA Vaccine Construct The pCD-N1 vector, previously created by insertion of the S segment of the Ank-2 strain of CCHFV into pCDNA3.1 myc/His A vector (Invitrogen, USA) [ ], was used for PCR amplification of the small (S) segment. .. The PCR reaction was carried out by Phusion High Fidelity Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) from pCD-N1 as follows: initial denaturation at 98 °C for 30 s, and 30 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 20 s and extension at 72 °C for 40 s, followed by final extension at 72 °C for 5 min.

    Article Title: Generation and characterization of a SIVmac239 clone corrected at four suboptimal nucleotides
    Article Snippet: Site directed mutagenesis Primers were designed to introduce the desired point mutations into the genome using site-directed mutagenesis utilizing Phusion high fidelity polymerase (Thermo Scientific). .. The resulting plasmid was transformed into Max Efficiency Stbl2 cells (Life Technologies), expanded and purified by double banded cesium chloride centrifugation.

    Article Title: A Robust Strategy for Negative Selection of Cre-LoxP Recombination-Based Excision of Transgenes in Induced Pluripotent Stem Cells
    Article Snippet: Paragraph title: Vector design and construction ... Phusion high-fidelity polymerase (Finnzymes) was used for the amplification.


    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template. .. Phire PCR cycling conditions were: initial denaturing at 98°C for 2 m, followed by 28 cycles of denaturing temperature at 98°C for 30 s, annealing temperature at 62°C for 30 s, and extension temperature at 72°C for 30 s; the program then ended with a single step of 72°C for 5 m. Phusion PCR cycling conditions were: initial denaturing at 98°C for 2 m, followed by various cycles ( ) of denaturing temperature at 98°C for 30 s, primer-specific annealing temperature ( ) for 30 s, and extension temperature at 72°C for 30 s; the program then ended with a single step of 72°C for 5 m. For RT-qPCR, RNA was extracted with Trizol (Invitrogen) and cDNA was synthesized with First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturers’ protocol. qPCR reactions were performed with Luminaris Color HiGreen High ROX qPCR Master Mix (Thermo Scientific) on Realplex4 with Mastercycler ep realplex software (Eppendorf). qPCR PCR cycling conditions were: initial denaturing at 95°C for 10 m, followed by 40 cycles of denaturing temperature at 95°C for 20 s, annealing temperature at 55°C for 30 s, and extension temperature at 72°C for 30 s. All primer sequences, annealing temperatures, and cycle numbers can be found in .

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: To include the DNA sequences 150 bp up- and down-stream of the identified PLA2G6 mutation, forward ( 5’-TCCAGCTTCTCATCGCCATC-3’ ) and reverse ( 5’-CACCCCACAAAGGGCTTTCA-3’ ) primers were designed using Primer-BLAST online software ( ). .. The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific).

    RNA Extraction:

    Article Title: AT1-receptor response to non-saturating Ang-II concentrations is amplified by calcium channel blockers
    Article Snippet: PCR Approximately 107 HEK cells were used for RNA extraction using manufacturer’s protocols (RNeasy Plus, Qiagen). cDNA was obtained using iScript cDNA kit (BioRad) following manufacturers protocols. .. Primers for CaV 1.1, CaV 1.2 and CaV 1.4 were designed and used for PCR amplification (Phusion High-Fidelity DNA polymerase, Thermo Scientific).

    Agarose Gel Electrophoresis:

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL. .. The mixtures were then loaded into an agarose gel (1%) and purified using a gel extraction kit (Qiagen).

    Article Title: AT1-receptor response to non-saturating Ang-II concentrations is amplified by calcium channel blockers
    Article Snippet: Primers for CaV 1.1, CaV 1.2 and CaV 1.4 were designed and used for PCR amplification (Phusion High-Fidelity DNA polymerase, Thermo Scientific). .. The product was run on a 2% Agarose gel (1:10,000 GelRed, Biotium) and imaged on a Li-Cor Oddyssey system.

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific). .. The DNA amplicons were purified using the QIAGEN DNA purification kit (QIAGEN), loaded onto a 1% agarose gel, and then electrophoresed for 25 minutes.

    In Vitro:

    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter. .. Serial dilutions (2, 4, 8, and 16 fg per reaction) of these in vitro -generated templates were used to evaluate the specificity of the 3C primers (sequences available upon request) in a background of 50 ng of Csp6I-digested 3T3-L1 genomic DNA.


    Article Title: Dual-Specificity Phosphatase 4 Regulates STAT5 Protein Stability and Helper T Cell Polarization*
    Article Snippet: Genotyping PCR, two-template PCR and quantitative-PCR (qPCR) Genotyping PCR for the DUSP4 knockout and FOXP3-GFP alleles was performed using extracted tail DNA with Phire polymerase (Thermo Scientific). .. PCR for generating the WT or mutant DUSP4 and STAT5 constructs, as well as ametrine, GFP and tdTomato inserts, was performed with Phusion high-fidelity polymerase (Thermo Scientific) according to the supplier’s suggestions; for secondary PCR in two-template PCR, 1 ng of primary PCR products extracted with illustra Gel Purification kit (GE Healthcare) was used as the template.

    Activation Assay:

    Article Title: Natural History of Cryptosporidiosis in a Longitudinal Study of Slum-Dwelling Bangladeshi Children: Association with Severe Malnutrition
    Article Snippet: COWP positive samples were further genotyped by the polymorphic region within the gp60 gene using primers and conditions previously described [ , ] but with the modification that the amplifications were done using the MyFi (Bioline, Taunton, MA) with an activation 94°C for 5 min followed by 40 cycles in the primary PCR (94°C, 30 sec; 45°C, 55 sec; 72°C, 60 sec) with a final extension of 10min at 72°C. .. Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in a final PCR to add sequencing primer binding sites [ ].


    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: No recombination proteins are produced when bacteria containing the defective λ prophage are kept at 32°C, but are produced after a brief (15–20 min) heat-shock at 42°C. .. In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S).

    Concentration Assay:

    Article Title: A Novel Intronic Peroxisome Proliferator-activated Receptor ? Enhancer in the Uncoupling Protein (UCP) 3 Gene as a Regulator of Both UCP2 and -3 Expression in Adipocytes *
    Article Snippet: Control fragments for the evaluation of 3C primers were generated by PCR amplification (Phusion hot start high-fidelity DNA polymerase, Finnzymes) of the regions flanking the Csp6I restriction sites at Ucp3 intron 1, the 5′-end of Ucp2 , and the regions upstream and downstream of the latter. .. The fragments were mixed in equimolar concentration, digested with Csp6I, purified using the Qiagen PCR purification kit, and ligated with T4 DNA ligase (New England Biolabs).

    DNA Purification:

    Article Title: Identification of the PLA2G6 c.1579G > A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis
    Article Snippet: The PCR reaction was conducted in a volume of 25 μl containing 10 ng of sample genomic DNA, 8 μl of 2.5 mM dNTP mixture (TaKaRa, Otsu, Japan), 10 pmol of the forward and reverse primers, 0.2 μl of Phusion High Fidelity (HF) DNA Polymerase (Thermo Scientific), and 5 μl of Phusion 5x HF buffer (Thermo Scientific). .. The DNA amplicons were purified using the QIAGEN DNA purification kit (QIAGEN), loaded onto a 1% agarose gel, and then electrophoresed for 25 minutes.

    Gel Extraction:

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production
    Article Snippet: The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL. .. The mixtures were then loaded into an agarose gel (1%) and purified using a gel extraction kit (Qiagen).

    Homologous Recombination:

    Article Title: Characterization of Five ECF Sigma Factors in the Genome of Pseudomonas syringae pv. syringae B728a
    Article Snippet: This procedure utilizes homologous recombination in E. coli SW105 ( ), which is mediated by recombination proteins provided from a defective λ prophage inserted into the SW105 genome . .. In this strategy, a genomic fragment containing the ecf gene-of-interest (GOI) along with 3–4 kb of flanking DNA was PCR amplified using a Phusion® long range proof-reading polymerase (ThermoScientific F-553S).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher phusion taq master mix
    Phusion Taq Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more taq master mix/product/Thermo Fisher
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    phusion taq master mix - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Thermo Fisher phusion taq polymerase
    Phusion Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    phusion taq polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results