Structured Review

Fisher Scientific phusion high fidelity dna polymerase
Phusion High Fidelity Dna Polymerase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phusion high fidelity dna polymerase/product/Fisher Scientific
Average 94 stars, based on 17 article reviews
Price from $9.99 to $1999.99
phusion high fidelity dna polymerase - by Bioz Stars, 2020-04
94/100 stars

Images

Related Articles

Clone Assay:

Article Title: Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve
Article Snippet: For the dsRNA-constructs, 200 bp fragments (electronic supplementary material, table S1) from the coding sequences of Pc8HGO and Pc8HGO-like were amplified by a Phusion high-fidelity DNA polymerase (Fisher Scientific—Germany GmbH, Schwerte, Germany). .. After purification with a PCR-purification kit (Roche, Basel, Switzerland), the resulting fragments were cloned into T7-promotor site free pIB/V5-HIS-TOPO vectors (Life Technologies, Carlsbad, CA, USA).

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: Plasmids from the resulting clones were analyzed by colony PCR using primers RH4 and RH11, and Nhe I restriction enzyme digests, and verified by DNA sequencing using primers RH1, RH2, RH3, RH4 and RH10. .. Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105.

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: Paragraph title: Cloning full-length rtn4a and rtn4b cDNAs ... All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland).

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: Paragraph title: Sl gasmin cloning and bioinformatics analysis ... Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: Connexin40 abnormalities and atrial fibrillation in the human heart
Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) to amplify the Cx40 coding region (within exon 2) or the regions flanking Cx40 promoters A and B. PCR primers are listed in . .. The coding region PCR products were subcloned into pCR-BluntII using the Zero Blunt® TOPO® PCR Cloning Kit (Life Technologies) and transformed into bacteria.

Article Title: Isolation of Lactococcus lactis Mutants Simultaneously Resistant to the Cell Wall-Active Bacteriocin Lcn972, Lysozyme, Nisin, and Bacteriophage c2
Article Snippet: .. For cloning purposes and PCRs expected to yield long products, the proofreading Phusion high-fidelity DNA polymerase (Fisher Scientific, Spain) was used. .. The bacteriocin Lcn972 was purified and quantified as described previously ( ).

Centrifugation:

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: DNA was extracted (12855-100 PowerLyzer PowerSoil DNA isolation kit; Mo Bio) from 250 mg feces according to the protocol provided by the manufacturer with minor modifications: bead beating was performed at 30 cycles/s for 10 min (Retsch MM 300 mixer mill), and the initial centrifugation steps were performed at 10,000 × g for 3 min, as recommended for clay matter. .. The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: 250 mg feces was applied and treated according to the protocol provided by the manufacturer (PowerLyzer® PowerSoil® DNA isolation kit, MoBio 12,855–100) with minor modifications: Bead beating was performed at 30 cycles/s for 10 min (Retsch MM 300 mixer mill) and the initial centrifugation steps were performed at 10,000 x g for 3 min, as recommended for clay matter. .. The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume.

Amplification:

Article Title: Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs: Apple chlorotic leaf spot virus as a case study
Article Snippet: .. The long fragment was amplified using the Advantage® GC Genomic LA Polymerase Mix kit while the two shorter ones were amplified with the Phusion® High Fidelity DNA Polymerase. .. After purification of all fragments using the MSB® Spin PCRapace kit, yeast cells were transformed with a total of about 3 μg of the four fragments in equimolecular amounts.

Article Title: Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve
Article Snippet: .. For the dsRNA-constructs, 200 bp fragments (electronic supplementary material, table S1) from the coding sequences of Pc8HGO and Pc8HGO-like were amplified by a Phusion high-fidelity DNA polymerase (Fisher Scientific—Germany GmbH, Schwerte, Germany). .. After purification with a PCR-purification kit (Roche, Basel, Switzerland), the resulting fragments were cloned into T7-promotor site free pIB/V5-HIS-TOPO vectors (Life Technologies, Carlsbad, CA, USA).

Article Title: Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs: Apple chlorotic leaf spot virus as a case study
Article Snippet: Paragraph title: Full-length ACLSV cDNA amplification using Long Distance (LD) RT-PCR ... Three commercial DNA polymerases or DNA polymerases mixes were compared for their efficiency in this study: the Advantage® GC Genomic LA Polymerase Mix (Clontech), the Expand High Fidelity PCR System (Roche) and the Phusion® High Fidelity DNA Polymerase (Finnzyme/Fischer Scientific, Illkirch, France).

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: .. The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume. .. Both primers include sequencing adaptors, and the forward primer additionally includes a unique 10- to 12-bp barcode (IonXpress barcode adapters).

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: The rtn4b cDNA was amplified with forward primer rtn4b -fw 5′-gtcctgagctgcgctatttc-3′ and reverse primer rtn4b -rv 5′-gttatttagtaggcagcggtgtg-3′ by RT-PCR from total RNA extracted from adult zebrafish optic nerve. .. All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland).

Article Title: Genomic GC-Content Affects the Accuracy of 16S rRNA Gene Sequencing Based Microbial Profiling due to PCR Bias
Article Snippet: .. Primers and PCR amplification The PCR amplification of the V3-region of the 16S rRNA gene was performed with 0.2 μl template DNA material (HM-276D), using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base),1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20 μl total reaction volume (primers were modified from Milani et al., ). .. Both the non-degenerative forward and reverse primers were identical to the corresponding region in all of the 20 different 16S rRNA genes represented in the multispecies mock community, ensuring that the primer choice did not contribute to PCR bias.

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: After amplification, the obtained PCR product was separated by gel electrophoresis and the visible band of the expected size was purified with a Quick gel extraction & PCR purification COMBO Kit (Invitrogen, Carlsbad, CA, USA). .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: .. The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume. .. Both primers included sequencing adaptors and the forward primer additionally a unique 10–12 bp barcode (Ion Xpress™ Barcode Adapters).

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: This protocol generated 40-µL long-term storage extracts with DNA concentrations of 20–40 ng/µL, sufficient for PCR amplification of multiple DNA target regions (rbcL , matK , and ITS2) ( ; ). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

Filtration:

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: DNA was isolated and purified through binding to glass fiber filtration columns ( ) on a Biomek FX Workstation (Beckman Coulter, Mississauga, Ontario, Canada). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

Synthesized:

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: First-strand cDNA was synthesized under standard conditions with the SuperScript First-Strand Synthesis System (Invitrogen) using an oligo(dT) primer. .. All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland).

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Construct:

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: The pANDA mini vector was obtained from Hiroyuki Tsuji (Nara Institute of Science and Technology, Nara, Japan), and used as a source for the Ub1 promoter-driven Gateway-compatible cloning RNAi construct. .. Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105.

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Electrophoresis:

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin. .. The length of PCR products was checked by electrophoresis on 1% agarose gels, before sequencing.

Incubation:

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: After transformation of One Shot TOP10 chemically competent E . coli cells (Invitrogen), the transformants were incubated overnight at 37°C on LB plates containing 50 μg/ml kanamycin. .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: Following disruption, cells were lysed with 250–400 µL of 2× cetyltrimethylammonium bromide (CTAB) buffer incubated at 65°C for 60–90 min. After incubation, 50 µL of lysate from each sample was transferred into 96-well microplates (250 µL, semiskirted; Eppendorf, Hamburg, Germany) using a Liquidator 96 (200 µL; Mettler Toledo, Mississauga, Ontario, Canada). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

Modification:

Article Title: Genomic GC-Content Affects the Accuracy of 16S rRNA Gene Sequencing Based Microbial Profiling due to PCR Bias
Article Snippet: .. Primers and PCR amplification The PCR amplification of the V3-region of the 16S rRNA gene was performed with 0.2 μl template DNA material (HM-276D), using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base),1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20 μl total reaction volume (primers were modified from Milani et al., ). .. Both the non-degenerative forward and reverse primers were identical to the corresponding region in all of the 20 different 16S rRNA genes represented in the multispecies mock community, ensuring that the primer choice did not contribute to PCR bias.

Transformation Assay:

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: After transformation of One Shot TOP10 chemically competent E . coli cells (Invitrogen), the transformants were incubated overnight at 37°C on LB plates containing 50 μg/ml kanamycin. .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: Connexin40 abnormalities and atrial fibrillation in the human heart
Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) to amplify the Cx40 coding region (within exon 2) or the regions flanking Cx40 promoters A and B. PCR primers are listed in . .. The coding region PCR products were subcloned into pCR-BluntII using the Zero Blunt® TOPO® PCR Cloning Kit (Life Technologies) and transformed into bacteria.

Ligation:

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105. .. The resulting clones were screened for ligation directionality using colony PCR with primers RH6 and RH105.

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany). .. Sometimes overlap extension PCR was used to combine them to larger constructs, but normally they were assembled by ligation assisted PCR.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs: Apple chlorotic leaf spot virus as a case study
Article Snippet: Paragraph title: Full-length ACLSV cDNA amplification using Long Distance (LD) RT-PCR ... Three commercial DNA polymerases or DNA polymerases mixes were compared for their efficiency in this study: the Advantage® GC Genomic LA Polymerase Mix (Clontech), the Expand High Fidelity PCR System (Roche) and the Phusion® High Fidelity DNA Polymerase (Finnzyme/Fischer Scientific, Illkirch, France).

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: The rtn4b cDNA was amplified with forward primer rtn4b -fw 5′-gtcctgagctgcgctatttc-3′ and reverse primer rtn4b -rv 5′-gttatttagtaggcagcggtgtg-3′ by RT-PCR from total RNA extracted from adult zebrafish optic nerve. .. All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland).

Generated:

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: This protocol generated 40-µL long-term storage extracts with DNA concentrations of 20–40 ng/µL, sufficient for PCR amplification of multiple DNA target regions (rbcL , matK , and ITS2) ( ; ). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

DNA Sequencing:

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: Plasmids from the resulting clones were analyzed by colony PCR using primers RH4 and RH11, and Nhe I restriction enzyme digests, and verified by DNA sequencing using primers RH1, RH2, RH3, RH4 and RH10. .. Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105.

Article Title: Connexin40 abnormalities and atrial fibrillation in the human heart
Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) to amplify the Cx40 coding region (within exon 2) or the regions flanking Cx40 promoters A and B. PCR primers are listed in . .. Individual colonies (≥20 per patient) were picked and their inserts were sequenced using SP6 forward and M13 reverse primers at the DNA Sequencing Facility and Genotyping Facility of the University of Chicago.

Sequencing:

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105. .. DNA sequencing using primers RH3, RH4, RH98 and RH99 was used to verify the sequence of the resulting vector (pPZP211b-RNAi).

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume. .. Both primers include sequencing adaptors, and the forward primer additionally includes a unique 10- to 12-bp barcode (IonXpress barcode adapters).

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: Cloning full-length rtn4a and rtn4b cDNAs The rtn4a full coding sequence was amplified by RT-PCR from 1-dpf zebrafish embryo total RNA with the following primers: forward rtn4a -fw 5′-atgcagccgcaggagtacat-3′ and reverse rtn4a -rv 5′-ggctgccgggtcacgact-3′. .. All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland).

Article Title: Genomic GC-Content Affects the Accuracy of 16S rRNA Gene Sequencing Based Microbial Profiling due to PCR Bias
Article Snippet: Primers and PCR amplification The PCR amplification of the V3-region of the 16S rRNA gene was performed with 0.2 μl template DNA material (HM-276D), using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base),1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20 μl total reaction volume (primers were modified from Milani et al., ). .. Both primers (TAG Copenhagen A/S) were linked to sequencing adaptors and the forward primer additionally contained a unique 10 bp barcode (Ion Xpress™ Barcode Adapters) for each sample.

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: Given the very high level of sequence identity to gasmin , a cDNA was obtained by PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific, Pittsburgh, PA, USA) and primers designed to amplify the whole gasmin ORF (gasmin ORF forward primer ATGTTGCCTATTACCATACTAACG, gasmin ORF reverse primer ATACTGGAATTGGACATATTTGAGC). .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume. .. Both primers included sequencing adaptors and the forward primer additionally a unique 10–12 bp barcode (Ion Xpress™ Barcode Adapters).

Article Title: Connexin40 abnormalities and atrial fibrillation in the human heart
Article Snippet: Paragraph title: 2.8. Isolation of genomic DNA and sequence analysis of the Cx40 promoter and coding regions ... PCR was performed using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) to amplify the Cx40 coding region (within exon 2) or the regions flanking Cx40 promoters A and B. PCR primers are listed in .

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: .. Given the very high level of sequence identity to gasmin , a cDNA was obtained by PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific, Pittsburgh, PA, USA) and primers designed to amplify the whole gasmin ORF (gasmin ORF forward primer ATGTTGCCTATTACCATACTAACG, gasmin ORF reverse primer ATACTGGAATTGGACATATTTGAGC). ..

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP. .. Owing to very low PCR success for species of Boraginaceae, a subset of specimens in this family were subjected to an additional round of DNA purification ( ) with the goal of removing secondary compounds that might inhibit PCR.

Binding Assay:

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: DNA was isolated and purified through binding to glass fiber filtration columns ( ) on a Biomek FX Workstation (Beckman Coulter, Mississauga, Ontario, Canada). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

DNA Extraction:

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: Paragraph title: Fecal samples, DNA extraction, and PCR amplification of the V3 region of the 16S rRNA gene. ... The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: Paragraph title: Fecal samples, DNA extraction and PCR amplification of theV3 region of the 16S rRNA gene ... The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume.

Nucleic Acid Electrophoresis:

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: After amplification, the obtained PCR product was separated by gel electrophoresis and the visible band of the expected size was purified with a Quick gel extraction & PCR purification COMBO Kit (Invitrogen, Carlsbad, CA, USA). .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Magnetic Beads:

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume. .. The PCR product was purified by use of HighPrep PCR magnetic beads (MagBio; AC-60005) with the 96-well magnet stand (MagBio; MyMag 96), according to the prescribed procedure.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume. .. PCR products were purified by use of HighPrep™ PCR Magnetic Beads (MAGBIO®, AC-60005) with the 96-well magnet stand (MAGBIO®, MyMag 96), according to the manufacturers recommendations.

Isolation:

Article Title: Connexin40 abnormalities and atrial fibrillation in the human heart
Article Snippet: Paragraph title: 2.8. Isolation of genomic DNA and sequence analysis of the Cx40 promoter and coding regions ... PCR was performed using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) to amplify the Cx40 coding region (within exon 2) or the regions flanking Cx40 promoters A and B. PCR primers are listed in .

Article Title: Isolation of Lactococcus lactis Mutants Simultaneously Resistant to the Cell Wall-Active Bacteriocin Lcn972, Lysozyme, Nisin, and Bacteriophage c2
Article Snippet: Chromosomal DNA was isolated with the GenElute bacterial genomic DNA kit (Sigma-Aldrich, Spain). .. For cloning purposes and PCRs expected to yield long products, the proofreading Phusion high-fidelity DNA polymerase (Fisher Scientific, Spain) was used.

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: DNA was isolated and purified through binding to glass fiber filtration columns ( ) on a Biomek FX Workstation (Beckman Coulter, Mississauga, Ontario, Canada). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

Purification:

Article Title: Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve
Article Snippet: For the dsRNA-constructs, 200 bp fragments (electronic supplementary material, table S1) from the coding sequences of Pc8HGO and Pc8HGO-like were amplified by a Phusion high-fidelity DNA polymerase (Fisher Scientific—Germany GmbH, Schwerte, Germany). .. After purification with a PCR-purification kit (Roche, Basel, Switzerland), the resulting fragments were cloned into T7-promotor site free pIB/V5-HIS-TOPO vectors (Life Technologies, Carlsbad, CA, USA).

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105. .. The purified PCR product was digested with Sac I and ligated directionally into the binary vector multiple cloning site Sac I site.

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume. .. The PCR product was purified by use of HighPrep PCR magnetic beads (MagBio; AC-60005) with the 96-well magnet stand (MagBio; MyMag 96), according to the prescribed procedure.

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: After amplification, the obtained PCR product was separated by gel electrophoresis and the visible band of the expected size was purified with a Quick gel extraction & PCR purification COMBO Kit (Invitrogen, Carlsbad, CA, USA). .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume. .. PCR products were purified by use of HighPrep™ PCR Magnetic Beads (MAGBIO®, AC-60005) with the 96-well magnet stand (MAGBIO®, MyMag 96), according to the manufacturers recommendations.

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: DNA was isolated and purified through binding to glass fiber filtration columns ( ) on a Biomek FX Workstation (Beckman Coulter, Mississauga, Ontario, Canada). .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP.

Polymerase Chain Reaction:

Article Title: Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve
Article Snippet: For the dsRNA-constructs, 200 bp fragments (electronic supplementary material, table S1) from the coding sequences of Pc8HGO and Pc8HGO-like were amplified by a Phusion high-fidelity DNA polymerase (Fisher Scientific—Germany GmbH, Schwerte, Germany). .. After purification with a PCR-purification kit (Roche, Basel, Switzerland), the resulting fragments were cloned into T7-promotor site free pIB/V5-HIS-TOPO vectors (Life Technologies, Carlsbad, CA, USA).

Article Title: Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs: Apple chlorotic leaf spot virus as a case study
Article Snippet: .. Three commercial DNA polymerases or DNA polymerases mixes were compared for their efficiency in this study: the Advantage® GC Genomic LA Polymerase Mix (Clontech), the Expand High Fidelity PCR System (Roche) and the Phusion® High Fidelity DNA Polymerase (Finnzyme/Fischer Scientific, Illkirch, France). ..

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: .. Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105. .. The purified PCR product was digested with Sac I and ligated directionally into the binary vector multiple cloning site Sac I site.

Article Title: Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity
Article Snippet: .. The PCR amplification of the V3 region of the 16S rRNA gene was performed with 5 ng community DNA as the template, using 0.2 µl Phusion high-fidelity (HF) DNA polymerase (Fisher Scientific; F-553L), 4 µl HF buffer, 0.4 µl deoxynucleoside triphosphate (dNTP) (10 mM of each base), 1 µM forward primer (PBU [primer bacterial universal] 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 µM reverse primer (PBR [primer bacterial reverse] 5′-trp1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20-µl total reaction volume. .. Both primers include sequencing adaptors, and the forward primer additionally includes a unique 10- to 12-bp barcode (IonXpress barcode adapters).

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: .. All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland). .. Full-length cDNAs were cloned into a PCR2.1 TOPO vector (Invitrogen) and sequenced.

Article Title: Genomic GC-Content Affects the Accuracy of 16S rRNA Gene Sequencing Based Microbial Profiling due to PCR Bias
Article Snippet: .. Primers and PCR amplification The PCR amplification of the V3-region of the 16S rRNA gene was performed with 0.2 μl template DNA material (HM-276D), using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base),1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in a 20 μl total reaction volume (primers were modified from Milani et al., ). .. Both the non-degenerative forward and reverse primers were identical to the corresponding region in all of the 20 different 16S rRNA genes represented in the multispecies mock community, ensuring that the primer choice did not contribute to PCR bias.

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin. .. The plasmid DNA was extracted from 4 ml of bacterial culture using a Charge Switch-Pro plasmid miniprep Kit (Invitrogen), as instructed by the manufacturer and sequenced.

Article Title: Administration of two probiotic strains during early childhood does not affect the endogenous gut microbiota composition despite probiotic proliferation
Article Snippet: .. The PCR amplification of the V3-region of the 16S rRNA gene was performed with 5 ng community DNA as template, using 0.2 μl Phusion High-Fidelity DNA polymerase (Fisher Scientific, F-553 L), 4 μl HF-buffer, 0.4 μl dNTP (10 mM of each base), 1 μM forward primer (PBU 5′-A-adapter-TCAG-barcode-CCTACGGGAGGCAGCAG-3′) and 1 μM reverse primer (PBR 5′-trP1-adapter-ATTACCGCGGCTGCTGG-3′) in 20 μl total reaction volume. .. Both primers included sequencing adaptors and the forward primer additionally a unique 10–12 bp barcode (Ion Xpress™ Barcode Adapters).

Article Title: Isolation of Lactococcus lactis Mutants Simultaneously Resistant to the Cell Wall-Active Bacteriocin Lcn972, Lysozyme, Nisin, and Bacteriophage c2
Article Snippet: .. PCR conditions were 98°C for 30 s; 35 cycles at 98°C for 10 s, 63°C for 30 s, and 72°C for 13 min; and 72°C for 10 min, and Phusion high-fidelity DNA polymerase was used. .. PCR products were purified with Illustra GFX PCR DNA and the gel band purification kit (GE Healthcare, United Kingdom) and sequenced.

Article Title: Connexin40 abnormalities and atrial fibrillation in the human heart
Article Snippet: .. PCR was performed using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) to amplify the Cx40 coding region (within exon 2) or the regions flanking Cx40 promoters A and B. PCR primers are listed in . ..

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: .. Given the very high level of sequence identity to gasmin , a cDNA was obtained by PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific, Pittsburgh, PA, USA) and primers designed to amplify the whole gasmin ORF (gasmin ORF forward primer ATGTTGCCTATTACCATACTAACG, gasmin ORF reverse primer ATACTGGAATTGGACATATTTGAGC). ..

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Article Title: Isolation of Lactococcus lactis Mutants Simultaneously Resistant to the Cell Wall-Active Bacteriocin Lcn972, Lysozyme, Nisin, and Bacteriophage c2
Article Snippet: Standard PCRs were carried out using Pure Taq Ready-to-Go PCR beads (GE Healthcare, United Kingdom). .. For cloning purposes and PCRs expected to yield long products, the proofreading Phusion high-fidelity DNA polymerase (Fisher Scientific, Spain) was used.

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: .. Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP. .. Owing to very low PCR success for species of Boraginaceae, a subset of specimens in this family were subjected to an additional round of DNA purification ( ) with the goal of removing secondary compounds that might inhibit PCR.

Plasmid Preparation:

Article Title: Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.
Article Snippet: Paragraph title: In planta RNAi vector construction ... Finally, a Nos transcriptional terminator flanked by Sac I sites was PCR-amplified using Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific Inc., Waltham, MA, USA) using primers RH104 and RH105.

Article Title: Essential roles of zebrafish rtn4/Nogo paralogues in embryonic development
Article Snippet: All of the above-mentioned PCR experiments were done with Phusion High-Fidelity DNA Polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland). .. Full-length cDNAs were cloned into a PCR2.1 TOPO vector (Invitrogen) and sequenced.

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: The PCR product was cloned into Zero-Blunt TOPO vector (Zero-Blunt TOPO PCR Cloning Kit, Invitrogen), according to the manufacturer’s instructions. .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
Article Snippet: Vector elements were either generated via PCR amplification or via artificially synthesized oligo duplices; all constructs were verified by sequencing and test digestion. .. PCRs were done with Phusion High-Fidelity DNA Polymerase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

Concentration Assay:

Article Title: Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve
Article Snippet: For the dsRNA-constructs, 200 bp fragments (electronic supplementary material, table S1) from the coding sequences of Pc8HGO and Pc8HGO-like were amplified by a Phusion high-fidelity DNA polymerase (Fisher Scientific—Germany GmbH, Schwerte, Germany). .. The concentration of dsRNA was adjusted to 1 μg μl−1 .

DNA Purification:

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP. .. Owing to very low PCR success for species of Boraginaceae, a subset of specimens in this family were subjected to an additional round of DNA purification ( ) with the goal of removing secondary compounds that might inhibit PCR.

Marker:

Article Title: Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada 1
Article Snippet: Initial PCR was performed with Phusion High-Fidelity DNA polymerase (Fisher Scientific, Hampton, New Hampshire, USA) using primers matK-xf and matK-MALP, and sequencing was done with the internal forward primer matK-1RKIM-f and matK-MALP. .. Amplification of rbcL was attempted on all 20,816 specimens, matK on 9412 specimens, and ITS2 on 13,233 specimens ( Appendix S3 ) (differences in sample size reflect fluctuations in funding linked to specific projects, but we made substantial effort to represent all species with at least one sample per marker, where feasible).

Gel Extraction:

Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp
Article Snippet: After amplification, the obtained PCR product was separated by gel electrophoresis and the visible band of the expected size was purified with a Quick gel extraction & PCR purification COMBO Kit (Invitrogen, Carlsbad, CA, USA). .. Bacterial colonies containing the fragment of the appropriate size were selected by colony PCR, using Phusion High-Fidelity DNA Polymerase (Fisher Scientific) and M13 Forward (-20)/M13 reverse primers (Invitrogen), and grown overnight in LB medium containing 50 μg/ml kanamycin.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Fisher Scientific phusion high fidelity dna polymerase
    Phusion High Fidelity Dna Polymerase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity dna polymerase/product/Fisher Scientific
    Average 94 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results