phusion dna polymerase master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Thermo Fisher phusion dna polymerase master mix
    Phusion Dna Polymerase Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion dna polymerase master mix/product/Thermo Fisher
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerase master mix - by Bioz Stars, 2020-04
    89/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: The P351Δ12 hAIPL1 mutation was introduced through amplification with reverse primer 5′ CAGCTCTGCAGATGGTGCTGTGGGTGGCTCTGTGGATGACTGTGC 3′, introducing a 12 bp deletion at nucleotide position 1053–1064, and also cloned under the mCrx promoter. .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females.

    Amplification:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: The P351Δ12 hAIPL1 mutation was introduced through amplification with reverse primer 5′ CAGCTCTGCAGATGGTGCTGTGGGTGGCTCTGTGGATGACTGTGC 3′, introducing a 12 bp deletion at nucleotide position 1053–1064, and also cloned under the mCrx promoter. .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females.

    FLAG-tag:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: Full-length hAIPL1 with an N-terminal Flag epitope tag was cloned under the 2.3 kb mCrx promoter ( ) using a mCrx-LacZ vector generously provided by Dr Takahisa Furukawa (Osaka Bioscience Institute, Osaka, Japan). .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females.

    Mutagenesis:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. WT and mutant P351Δ12 hAIPL1 transgenic founders were identified through PCR primers amplifying an 750 bp fragment spanning the 3′ region of the mCrx promoter and 5′ region of hAIPL1 , using forward primer 5′ CTGGTTGCAGGCAAGAGT 3′ and reverse primer 5′ GTCCGCTCCTCATCACATTT 3′.

    Knock-Out:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. Founders were backcrossed into WT 129sv mice to eliminate the Pde6brd1 mutation present in the FVB strain, and further backcrossed with Aipl1 knockout mice in a mixed C57Bl/129sv background described previously ( , ).

    Purification:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. WT and mutant P351Δ12 hAIPL1 transgenic founders were identified through PCR primers amplifying an 750 bp fragment spanning the 3′ region of the mCrx promoter and 5′ region of hAIPL1 , using forward primer 5′ CTGGTTGCAGGCAAGAGT 3′ and reverse primer 5′ GTCCGCTCCTCATCACATTT 3′.

    Transgenic Assay:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. WT and mutant P351Δ12 hAIPL1 transgenic founders were identified through PCR primers amplifying an 750 bp fragment spanning the 3′ region of the mCrx promoter and 5′ region of hAIPL1 , using forward primer 5′ CTGGTTGCAGGCAAGAGT 3′ and reverse primer 5′ GTCCGCTCCTCATCACATTT 3′.

    Polymerase Chain Reaction:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. WT and mutant P351Δ12 hAIPL1 transgenic founders were identified through PCR primers amplifying an 750 bp fragment spanning the 3′ region of the mCrx promoter and 5′ region of hAIPL1 , using forward primer 5′ CTGGTTGCAGGCAAGAGT 3′ and reverse primer 5′ GTCCGCTCCTCATCACATTT 3′.

    Sequencing:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. WT and mutant P351Δ12 hAIPL1 transgenic founders were identified through PCR primers amplifying an 750 bp fragment spanning the 3′ region of the mCrx promoter and 5′ region of hAIPL1 , using forward primer 5′ CTGGTTGCAGGCAAGAGT 3′ and reverse primer 5′ GTCCGCTCCTCATCACATTT 3′.

    Injection:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females. .. WT and mutant P351Δ12 hAIPL1 transgenic founders were identified through PCR primers amplifying an 750 bp fragment spanning the 3′ region of the mCrx promoter and 5′ region of hAIPL1 , using forward primer 5′ CTGGTTGCAGGCAAGAGT 3′ and reverse primer 5′ GTCCGCTCCTCATCACATTT 3′.

    Mouse Assay:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: Paragraph title: Generation of transgenic hAIPL1 mice ... All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females.

    Plasmid Preparation:

    Article Title: Viral-mediated vision rescue of a novel AIPL1 cone-rod dystrophy model
    Article Snippet: Full-length hAIPL1 with an N-terminal Flag epitope tag was cloned under the 2.3 kb mCrx promoter ( ) using a mCrx-LacZ vector generously provided by Dr Takahisa Furukawa (Osaka Bioscience Institute, Osaka, Japan). .. All polymerase chain reactions (PCR) were performed with Phusion DNA polymerase master mix (Thermo Scientific, Lafayette, CO, USA), following manufacturer instructions for cycling conditions and the sequence verified using Big Dye Terminator ready reaction kit (Perkin Elmer, Waltham, MA, USA). mCrx-hAIPL1 (WT) and mCrx- P351Δ12 hAIPL1 (mutant) were digested, purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA), and injected into the pronuclei of oocytes from superovulated FVB/N females (WVU Transgenic Animal Core Facilities) followed by implantation into pseudopregnant females.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 1x mix phusion high fidelity dna polymerase
    1x Mix Phusion High Fidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x mix phusion high fidelity dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    1x mix phusion high fidelity dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher taq dna polymerase
    Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5315 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 5315 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher phusion high fidelity pcr master mix
    Phusion High Fidelity Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 233 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 233 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity pcr master mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results