Structured Review

Amresco phenylmethyl sulfonyl fluoride
Phenylmethyl Sulfonyl Fluoride, supplied by Amresco, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phenylmethyl sulfonyl fluoride/product/Amresco
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
phenylmethyl sulfonyl fluoride - by Bioz Stars, 2021-04
86/100 stars

Images

Related Articles

Recombinant:

Article Title: Cryo-EM Structure of Human Dicer and Its Complexes with a Pre-miRNA Substrate.
Article Snippet: STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d KEY RESOURCES TABLE d CONTACT FOR REAGENT AND RESOURCE SHARING d EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell culture d METHOD DETAILS B Recombinant construct preparation and protein expression B Purification of Strep-tagged proteins B In vitro reconstitution of the hDicer-TRBP-pre-let-7 complex B Dicing-activity assay B Electrophoretic mobility shift assay (EMSA) B RNA-probing assay and RNase limited-diges- tion assay B Cryo-EM specimen preparation and data acquisition B Image processing of electron micrographs B Model building of the cryo-EM maps B Quantification and Statistical Analysis d DATA AND SOFTWARE AVAILABILITY B Data resources SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures, three tables, and two movies and can be found with this article online at https://doi.org/10.1016/j. cell.2018.03.080. .. KEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins SMM 293-TI Sino Biological Inc. Cat# M293TI Polyethylenimines Polysciences Cat# 23966-2 d-Desthiobiotin Sigma Cat# 2-1201 Protease Inhibitor Cocktail Tablets Roche Cat# 04693159001 Phenylmethyl sulfonyl fluoride AMRESCO Cat# 0754 Critical Commercial Assays Strep-Tactin @Sepharose IBA Life Science Cat# 2-1201 Superose 6 Increase 5/150 GL GE Healthcare Cat# 29-0915-97 Deposited Data icSHAPE this paper GEO: GSE110516 Coordinates of hDicer-TRBP this paper PDB: 5ZAK Cryo-EM map of hDicer-TRBP this paper EMDB: 6904 Coordinates of HDicer-TRBP-pre-let-7 (class I) this paper PDB: 5ZAL Cryo-EM map of hDicer-TRBP-pre-let-7 (class I) this paper EMDB: 6905 Coordinates of hDicer-TRBP-pre-let-7 (class II) this paper PDB: 5ZAM Cryo-EM map of hDicer-TRBP-pre-let-7 (class II) this paper EMDB: 6906 Coordinates of human MDA5 bound with dsRNA Wu et al., 2013 PDB: 4GL2 Coordinates of Arabidopsis thaliana DCL4 DUF283 Qin et al., 2010 PDB: 2KOU Coordinates of human DROSHA in complex with the C-terminal tail of DGCR8 Kwon et al., 2016 PDB: 5B16 Coordinates of RNase IIIb and dsRBD of mouse Dicer Du et al., 2008 PDB: 3C4T Coordinates of the human Dicer-TRBP interface Wilson et al., 2015 PDB: 4WYQ Coordinates of human Dicer Platform-PAZ-Connector Helix cassette bound with 12-mer siRNA Tian et al., 2014 PDB: 4NGD Coordinates of human Dicer Platform-PAZ-Connector Helix cassette bound with 16-mer dsRNA Tian et al., 2014 PDB: 4NHA Coordinates of duck RIG-I bound with 19-mer dsRNA Kowalinski et al., 2011 PDB: 4A36 Coordinates of duck RIG-I helicase domain Kowalinski et al., 2011 PDB: 4A2P Coordinates of Aquifex aeolicus RNase III (D44N) complexed with dsRNA Gan et al., 2006 PDB: 2EZ6 Coordinates of Giardia Dicer Macrae et al., 2006 PDB: 2FFL Coordinates of duck RIG-I helicase domain Kowalinski et al., 2011 PDB: 4A2P Experimental Models: Cell Lines FreeStyle 293-F Cells ThermoFisher Cat# R79007 Oligonucleotides Strep tagged hDicer forward primer: 50-GGGGTACCATGAAAAGCCCTGCTTTG-30 this paper N/A Strep tagged hDicer reverse primer: 50-CCGCTCGAGCGGTCAGCTATTGGGAACCTG-30 this paper N/A Vsv tagged hDicer forward primer: 50-CGAATTCGCGGCCGCTATGAAAAGCCCTGCTTTGCAACC-30 this paper N/A Vsv tagged hDicer reverse primer: 50-GCAAGCTTCTCGAGTCAGCTATTGGGAACCTGAG-30 this paper N/A (Continued on next page) e1 Cell 173, 1191–1203.e1–e5, May 17, 2018. .. ContinuedREAGENT or RESOURCE SOURCE IDENTIFIER TRBP forward primer: 50- CGACGCGTATGAGTGAAGAGGAGCAAGG-30 this paper N/A Strep tagged TRBP reverse primer: 50- AAGGAAAAAAGCGGCCGCAAAAGGAA AATCACTTGCTGCCTGCCATGATCTTGAGG this paper N/A Primers for truncated hDicer constructs, see Table S2 this paper N/A The pre-let-7 RNA (50- UGAGGUAGUAGGUUGUAUAGUUUUAGGGU CACACCCACCACUGGGAGA UAACUAUACAAUCUACUGUCUUACC-30 this paper N/A Recombinant DNA pCAG-50vsv-hDicer this paper N/A pCAG-30strep-TRBP this paper N/A pCAG-50strep-hDicerDHEL2i this paper N/A pCAG-50strep-hDicerDHEL2+2i, this paper N/A pCAG-50strep-hDicerDDExD/H-box helicase this paper N/A Software and Algorithms UCSFImage4 Li et al., 2015 http://cryoem.ucsf.edu/software/ UCSFimage.html AutoEMation written by Dr. Jianlin Lei jllei@tsinghua.edu.cn Motioncorr Li et al., 2013 http://cryoem.ucsf.edu/software/ driftcorr.html MotionCor2 Zheng et al., 2017 http://msg.ucsf.edu/em/software/ motioncor2.html RELION2.0 Kimanius et al., 2016 http://www2.mrc-lmb.cam.ac.uk/relion ResMap Kucukelbir et al., 2014 http://resmap.sourceforge.net CHIMERA Pettersen et al., 2004 http://www.cgl.ucsf.edu/chimera PHENIX Adams et al., 2010 https://www.phenix-online.org PyMOL Schrodinger LLC http://www.pymol.org COOT Emsley and Cowtan, 2004 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot CTFFIND4 Rohou and Grigorieff, 2015 http://grigoriefflab.janelia.org/ctffind4 GraphPad Prism GraphPad Software https://www.graphpad.com/ scientific-software/prism/ ImageJ 1.50i Schneider et al., 2012 https://imagej.nih.gov/ij/ Other R1.2/1.3 400 mesh Au holey carbon grids Quantifoil Cat#1210627.

Protease Inhibitor:

Article Title: Cryo-EM Structure of Human Dicer and Its Complexes with a Pre-miRNA Substrate.
Article Snippet: STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d KEY RESOURCES TABLE d CONTACT FOR REAGENT AND RESOURCE SHARING d EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell culture d METHOD DETAILS B Recombinant construct preparation and protein expression B Purification of Strep-tagged proteins B In vitro reconstitution of the hDicer-TRBP-pre-let-7 complex B Dicing-activity assay B Electrophoretic mobility shift assay (EMSA) B RNA-probing assay and RNase limited-diges- tion assay B Cryo-EM specimen preparation and data acquisition B Image processing of electron micrographs B Model building of the cryo-EM maps B Quantification and Statistical Analysis d DATA AND SOFTWARE AVAILABILITY B Data resources SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures, three tables, and two movies and can be found with this article online at https://doi.org/10.1016/j. cell.2018.03.080. .. KEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins SMM 293-TI Sino Biological Inc. Cat# M293TI Polyethylenimines Polysciences Cat# 23966-2 d-Desthiobiotin Sigma Cat# 2-1201 Protease Inhibitor Cocktail Tablets Roche Cat# 04693159001 Phenylmethyl sulfonyl fluoride AMRESCO Cat# 0754 Critical Commercial Assays Strep-Tactin @Sepharose IBA Life Science Cat# 2-1201 Superose 6 Increase 5/150 GL GE Healthcare Cat# 29-0915-97 Deposited Data icSHAPE this paper GEO: GSE110516 Coordinates of hDicer-TRBP this paper PDB: 5ZAK Cryo-EM map of hDicer-TRBP this paper EMDB: 6904 Coordinates of HDicer-TRBP-pre-let-7 (class I) this paper PDB: 5ZAL Cryo-EM map of hDicer-TRBP-pre-let-7 (class I) this paper EMDB: 6905 Coordinates of hDicer-TRBP-pre-let-7 (class II) this paper PDB: 5ZAM Cryo-EM map of hDicer-TRBP-pre-let-7 (class II) this paper EMDB: 6906 Coordinates of human MDA5 bound with dsRNA Wu et al., 2013 PDB: 4GL2 Coordinates of Arabidopsis thaliana DCL4 DUF283 Qin et al., 2010 PDB: 2KOU Coordinates of human DROSHA in complex with the C-terminal tail of DGCR8 Kwon et al., 2016 PDB: 5B16 Coordinates of RNase IIIb and dsRBD of mouse Dicer Du et al., 2008 PDB: 3C4T Coordinates of the human Dicer-TRBP interface Wilson et al., 2015 PDB: 4WYQ Coordinates of human Dicer Platform-PAZ-Connector Helix cassette bound with 12-mer siRNA Tian et al., 2014 PDB: 4NGD Coordinates of human Dicer Platform-PAZ-Connector Helix cassette bound with 16-mer dsRNA Tian et al., 2014 PDB: 4NHA Coordinates of duck RIG-I bound with 19-mer dsRNA Kowalinski et al., 2011 PDB: 4A36 Coordinates of duck RIG-I helicase domain Kowalinski et al., 2011 PDB: 4A2P Coordinates of Aquifex aeolicus RNase III (D44N) complexed with dsRNA Gan et al., 2006 PDB: 2EZ6 Coordinates of Giardia Dicer Macrae et al., 2006 PDB: 2FFL Coordinates of duck RIG-I helicase domain Kowalinski et al., 2011 PDB: 4A2P Experimental Models: Cell Lines FreeStyle 293-F Cells ThermoFisher Cat# R79007 Oligonucleotides Strep tagged hDicer forward primer: 50-GGGGTACCATGAAAAGCCCTGCTTTG-30 this paper N/A Strep tagged hDicer reverse primer: 50-CCGCTCGAGCGGTCAGCTATTGGGAACCTG-30 this paper N/A Vsv tagged hDicer forward primer: 50-CGAATTCGCGGCCGCTATGAAAAGCCCTGCTTTGCAACC-30 this paper N/A Vsv tagged hDicer reverse primer: 50-GCAAGCTTCTCGAGTCAGCTATTGGGAACCTGAG-30 this paper N/A (Continued on next page) e1 Cell 173, 1191–1203.e1–e5, May 17, 2018. .. ContinuedREAGENT or RESOURCE SOURCE IDENTIFIER TRBP forward primer: 50- CGACGCGTATGAGTGAAGAGGAGCAAGG-30 this paper N/A Strep tagged TRBP reverse primer: 50- AAGGAAAAAAGCGGCCGCAAAAGGAA AATCACTTGCTGCCTGCCATGATCTTGAGG this paper N/A Primers for truncated hDicer constructs, see Table S2 this paper N/A The pre-let-7 RNA (50- UGAGGUAGUAGGUUGUAUAGUUUUAGGGU CACACCCACCACUGGGAGA UAACUAUACAAUCUACUGUCUUACC-30 this paper N/A Recombinant DNA pCAG-50vsv-hDicer this paper N/A pCAG-30strep-TRBP this paper N/A pCAG-50strep-hDicerDHEL2i this paper N/A pCAG-50strep-hDicerDHEL2+2i, this paper N/A pCAG-50strep-hDicerDDExD/H-box helicase this paper N/A Software and Algorithms UCSFImage4 Li et al., 2015 http://cryoem.ucsf.edu/software/ UCSFimage.html AutoEMation written by Dr. Jianlin Lei jllei@tsinghua.edu.cn Motioncorr Li et al., 2013 http://cryoem.ucsf.edu/software/ driftcorr.html MotionCor2 Zheng et al., 2017 http://msg.ucsf.edu/em/software/ motioncor2.html RELION2.0 Kimanius et al., 2016 http://www2.mrc-lmb.cam.ac.uk/relion ResMap Kucukelbir et al., 2014 http://resmap.sourceforge.net CHIMERA Pettersen et al., 2004 http://www.cgl.ucsf.edu/chimera PHENIX Adams et al., 2010 https://www.phenix-online.org PyMOL Schrodinger LLC http://www.pymol.org COOT Emsley and Cowtan, 2004 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot CTFFIND4 Rohou and Grigorieff, 2015 http://grigoriefflab.janelia.org/ctffind4 GraphPad Prism GraphPad Software https://www.graphpad.com/ scientific-software/prism/ ImageJ 1.50i Schneider et al., 2012 https://imagej.nih.gov/ij/ Other R1.2/1.3 400 mesh Au holey carbon grids Quantifoil Cat#1210627.

Article Title: Plant phosphomannose isomerase as a selectable marker for rice transformation
Article Snippet: Then, induction with isopropyl-β-D-1-thiogalactopyranoside (IPTG) was performed at a final concentration of 1 mM. .. The cell pellet was suspended, washed and re-suspended with 10 mL of PBS buffer (pH 7.4) containing 1 mM phenylmethyl sulfonyl fluoride (PMSF), 1 mg/mL lysozyme and 1% protease inhibitor cocktails (AMRESCO, USA). ..

Polyacrylamide Gel Electrophoresis:

Article Title: Cryo-EM Structure of Human Dicer and Its Complexes with a Pre-miRNA Substrate.
Article Snippet: STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d KEY RESOURCES TABLE d CONTACT FOR REAGENT AND RESOURCE SHARING d EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell culture d METHOD DETAILS B Recombinant construct preparation and protein expression B Purification of Strep-tagged proteins B In vitro reconstitution of the hDicer-TRBP-pre-let-7 complex B Dicing-activity assay B Electrophoretic mobility shift assay (EMSA) B RNA-probing assay and RNase limited-diges- tion assay B Cryo-EM specimen preparation and data acquisition B Image processing of electron micrographs B Model building of the cryo-EM maps B Quantification and Statistical Analysis d DATA AND SOFTWARE AVAILABILITY B Data resources SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures, three tables, and two movies and can be found with this article online at https://doi.org/10.1016/j. cell.2018.03.080. .. KEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins SMM 293-TI Sino Biological Inc. Cat# M293TI Polyethylenimines Polysciences Cat# 23966-2 d-Desthiobiotin Sigma Cat# 2-1201 Protease Inhibitor Cocktail Tablets Roche Cat# 04693159001 Phenylmethyl sulfonyl fluoride AMRESCO Cat# 0754 Critical Commercial Assays Strep-Tactin @Sepharose IBA Life Science Cat# 2-1201 Superose 6 Increase 5/150 GL GE Healthcare Cat# 29-0915-97 Deposited Data icSHAPE this paper GEO: GSE110516 Coordinates of hDicer-TRBP this paper PDB: 5ZAK Cryo-EM map of hDicer-TRBP this paper EMDB: 6904 Coordinates of HDicer-TRBP-pre-let-7 (class I) this paper PDB: 5ZAL Cryo-EM map of hDicer-TRBP-pre-let-7 (class I) this paper EMDB: 6905 Coordinates of hDicer-TRBP-pre-let-7 (class II) this paper PDB: 5ZAM Cryo-EM map of hDicer-TRBP-pre-let-7 (class II) this paper EMDB: 6906 Coordinates of human MDA5 bound with dsRNA Wu et al., 2013 PDB: 4GL2 Coordinates of Arabidopsis thaliana DCL4 DUF283 Qin et al., 2010 PDB: 2KOU Coordinates of human DROSHA in complex with the C-terminal tail of DGCR8 Kwon et al., 2016 PDB: 5B16 Coordinates of RNase IIIb and dsRBD of mouse Dicer Du et al., 2008 PDB: 3C4T Coordinates of the human Dicer-TRBP interface Wilson et al., 2015 PDB: 4WYQ Coordinates of human Dicer Platform-PAZ-Connector Helix cassette bound with 12-mer siRNA Tian et al., 2014 PDB: 4NGD Coordinates of human Dicer Platform-PAZ-Connector Helix cassette bound with 16-mer dsRNA Tian et al., 2014 PDB: 4NHA Coordinates of duck RIG-I bound with 19-mer dsRNA Kowalinski et al., 2011 PDB: 4A36 Coordinates of duck RIG-I helicase domain Kowalinski et al., 2011 PDB: 4A2P Coordinates of Aquifex aeolicus RNase III (D44N) complexed with dsRNA Gan et al., 2006 PDB: 2EZ6 Coordinates of Giardia Dicer Macrae et al., 2006 PDB: 2FFL Coordinates of duck RIG-I helicase domain Kowalinski et al., 2011 PDB: 4A2P Experimental Models: Cell Lines FreeStyle 293-F Cells ThermoFisher Cat# R79007 Oligonucleotides Strep tagged hDicer forward primer: 50-GGGGTACCATGAAAAGCCCTGCTTTG-30 this paper N/A Strep tagged hDicer reverse primer: 50-CCGCTCGAGCGGTCAGCTATTGGGAACCTG-30 this paper N/A Vsv tagged hDicer forward primer: 50-CGAATTCGCGGCCGCTATGAAAAGCCCTGCTTTGCAACC-30 this paper N/A Vsv tagged hDicer reverse primer: 50-GCAAGCTTCTCGAGTCAGCTATTGGGAACCTGAG-30 this paper N/A (Continued on next page) e1 Cell 173, 1191–1203.e1–e5, May 17, 2018. .. ContinuedREAGENT or RESOURCE SOURCE IDENTIFIER TRBP forward primer: 50- CGACGCGTATGAGTGAAGAGGAGCAAGG-30 this paper N/A Strep tagged TRBP reverse primer: 50- AAGGAAAAAAGCGGCCGCAAAAGGAA AATCACTTGCTGCCTGCCATGATCTTGAGG this paper N/A Primers for truncated hDicer constructs, see Table S2 this paper N/A The pre-let-7 RNA (50- UGAGGUAGUAGGUUGUAUAGUUUUAGGGU CACACCCACCACUGGGAGA UAACUAUACAAUCUACUGUCUUACC-30 this paper N/A Recombinant DNA pCAG-50vsv-hDicer this paper N/A pCAG-30strep-TRBP this paper N/A pCAG-50strep-hDicerDHEL2i this paper N/A pCAG-50strep-hDicerDHEL2+2i, this paper N/A pCAG-50strep-hDicerDDExD/H-box helicase this paper N/A Software and Algorithms UCSFImage4 Li et al., 2015 http://cryoem.ucsf.edu/software/ UCSFimage.html AutoEMation written by Dr. Jianlin Lei jllei@tsinghua.edu.cn Motioncorr Li et al., 2013 http://cryoem.ucsf.edu/software/ driftcorr.html MotionCor2 Zheng et al., 2017 http://msg.ucsf.edu/em/software/ motioncor2.html RELION2.0 Kimanius et al., 2016 http://www2.mrc-lmb.cam.ac.uk/relion ResMap Kucukelbir et al., 2014 http://resmap.sourceforge.net CHIMERA Pettersen et al., 2004 http://www.cgl.ucsf.edu/chimera PHENIX Adams et al., 2010 https://www.phenix-online.org PyMOL Schrodinger LLC http://www.pymol.org COOT Emsley and Cowtan, 2004 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot CTFFIND4 Rohou and Grigorieff, 2015 http://grigoriefflab.janelia.org/ctffind4 GraphPad Prism GraphPad Software https://www.graphpad.com/ scientific-software/prism/ ImageJ 1.50i Schneider et al., 2012 https://imagej.nih.gov/ij/ Other R1.2/1.3 400 mesh Au holey carbon grids Quantifoil Cat#1210627.

Protein Extraction:

Article Title: iTRAQ-based proteomic profiling reveals protein alterations after traumatic brain injury and supports thyroxine as a potential treatment
Article Snippet: .. Protein extraction Cortical samples were transferred into low protein binding tubes (1.5 mL, Eppendorf, Hamburg, Germany) and lysed with 300 µL of lysis buffer (Beyotime, Shanghai, China) and 1 mM phenylmethyl sulfonyl fluoride (PMSF, Amresco, Solon, Ohio, USA). ..

Low Protein Binding:

Article Title: iTRAQ-based proteomic profiling reveals protein alterations after traumatic brain injury and supports thyroxine as a potential treatment
Article Snippet: .. Protein extraction Cortical samples were transferred into low protein binding tubes (1.5 mL, Eppendorf, Hamburg, Germany) and lysed with 300 µL of lysis buffer (Beyotime, Shanghai, China) and 1 mM phenylmethyl sulfonyl fluoride (PMSF, Amresco, Solon, Ohio, USA). ..

Lysis:

Article Title: iTRAQ-based proteomic profiling reveals protein alterations after traumatic brain injury and supports thyroxine as a potential treatment
Article Snippet: .. Protein extraction Cortical samples were transferred into low protein binding tubes (1.5 mL, Eppendorf, Hamburg, Germany) and lysed with 300 µL of lysis buffer (Beyotime, Shanghai, China) and 1 mM phenylmethyl sulfonyl fluoride (PMSF, Amresco, Solon, Ohio, USA). ..

Article Title: A pseudo-receiver domain in Atg32 is required for mitophagy
Article Snippet: .. Cells were resuspended in lysis buffer (20 mM PIPES [Sigma, P6757], pH 6.8, 0.5% [v:v] Triton X-100 [Alfa Aesar, ], 50 mM KCl, 100 mM potassium acetate, 10 mM MgSO4 , 10 μM ZnSO4 , 1 mM phenylmethyl sulfonyl fluoride [PMSF; Amresco, 0754–256]), and lysed by bead beating [Biospec Products mini bead beater-16, model # 607] for 30 sec repeated 5 times with 30 sec breaks between runs. .. Lysate (20 μl) was added to 80 μl of pre-warmed reaction buffer (250 mM Tris, pH 8.5, 0.4% [v:v] Triton X-100, 10 mM MgSO4 , 10 μM ZnSO4 ) containing the phosphatase substrate p-nitrophenyl phosphate (pNPP; Sigma, S0942) and incubated in 37°C for 30 min.

Article Title: Characterization of a Chinese KCNQ1 mutation (R259H) that shortens repolarization and causes short QT syndrome 2
Article Snippet: .. 2.5 Western blotting The HEK-293 cells were lysed in RIPA lysis buffer supplemented with 1 mmol/L phenylmethyl sulfonyl fluoride (PMSF, Amresco, USA) after transient transfection (48 h). .. After the proteins were transferred to polyvinylidene difluoride membranes, the membranes were blocked with 5% milk and incubated overnight with a primary antibody against KCNQ1 at a density of 5 µg/mL (Abcam, USA).

Size-exclusion Chromatography:

Article Title: A pseudo-receiver domain in Atg32 is required for mitophagy
Article Snippet: .. Cells were resuspended in lysis buffer (20 mM PIPES [Sigma, P6757], pH 6.8, 0.5% [v:v] Triton X-100 [Alfa Aesar, ], 50 mM KCl, 100 mM potassium acetate, 10 mM MgSO4 , 10 μM ZnSO4 , 1 mM phenylmethyl sulfonyl fluoride [PMSF; Amresco, 0754–256]), and lysed by bead beating [Biospec Products mini bead beater-16, model # 607] for 30 sec repeated 5 times with 30 sec breaks between runs. .. Lysate (20 μl) was added to 80 μl of pre-warmed reaction buffer (250 mM Tris, pH 8.5, 0.4% [v:v] Triton X-100, 10 mM MgSO4 , 10 μM ZnSO4 ) containing the phosphatase substrate p-nitrophenyl phosphate (pNPP; Sigma, S0942) and incubated in 37°C for 30 min.

Western Blot:

Article Title: Characterization of a Chinese KCNQ1 mutation (R259H) that shortens repolarization and causes short QT syndrome 2
Article Snippet: .. 2.5 Western blotting The HEK-293 cells were lysed in RIPA lysis buffer supplemented with 1 mmol/L phenylmethyl sulfonyl fluoride (PMSF, Amresco, USA) after transient transfection (48 h). .. After the proteins were transferred to polyvinylidene difluoride membranes, the membranes were blocked with 5% milk and incubated overnight with a primary antibody against KCNQ1 at a density of 5 µg/mL (Abcam, USA).

Transfection:

Article Title: Characterization of a Chinese KCNQ1 mutation (R259H) that shortens repolarization and causes short QT syndrome 2
Article Snippet: .. 2.5 Western blotting The HEK-293 cells were lysed in RIPA lysis buffer supplemented with 1 mmol/L phenylmethyl sulfonyl fluoride (PMSF, Amresco, USA) after transient transfection (48 h). .. After the proteins were transferred to polyvinylidene difluoride membranes, the membranes were blocked with 5% milk and incubated overnight with a primary antibody against KCNQ1 at a density of 5 µg/mL (Abcam, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Amresco phenylmethyl sulfonyl fluoride
    Phenylmethyl Sulfonyl Fluoride, supplied by Amresco, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phenylmethyl sulfonyl fluoride/product/Amresco
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phenylmethyl sulfonyl fluoride - by Bioz Stars, 2021-04
    86/100 stars
      Buy from Supplier

    86
    Amresco phenylmethyl sulfonyl fluoride pmsf
    Phenylmethyl Sulfonyl Fluoride Pmsf, supplied by Amresco, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phenylmethyl sulfonyl fluoride pmsf/product/Amresco
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phenylmethyl sulfonyl fluoride pmsf - by Bioz Stars, 2021-04
    86/100 stars
      Buy from Supplier

    Image Search Results