Structured Review

New England Biolabs ph7 9
Ph7 9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ph7 9/product/New England Biolabs
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
ph7 9 - by Bioz Stars, 2019-12
99/100 stars

Images

Related Articles

Methylation Sequencing:

Article Title: Epigenomic map of human liver reveals principles of zonated morphogenic and metabolic control
Article Snippet: Reduced representation bisulfite sequencing (RRBS) of micro-dissected cells was performed as previously described with modifications. .. Restriction was performed using the CpG methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 h. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′exo−, 5 U per µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1:ACACTCTTTCCCTACACGACGCTCTTCCGATCT, adapter 2:GATCGGAAGAGCAC ACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U per µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 h. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo).

Clone Assay:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: Paragraph title: General USER cloning ... For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs).

Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
Article Snippet: PCR products were purified (QIAquick PCR Purification Kit, Qiagen) and blunt end cloned with Zero Blunt PCR cloning kit (Invitrogen). .. PCR-blunt cloned products and lentiCas9-Blast (Addgene plasmid ID 52962) were separately digested with BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) in 1× Buffer CutSmart at 37°C (New England Biolabs). .. Digest of lentiCas9-Blast was performed to remove the blasticidin cassette.

Centrifugation:

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: Cell lysis was performed by adding 1 ml of cell lysis buffer (10 mM Tris‐HCl, pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 1 × protein inhibitor) and incubating for 30 min on ice. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS. .. Then, 2% Triton X‐100 was added and incubated for an hour.

Amplification:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
Article Snippet: Paragraph title: Methylation-sensitive amplification polymorphism (MSAP) assay ... The ligation reaction contained 15 μl digestion product, 5 pmol EcoR I adapter (Supplemental Table ), 50 pmol Hpa II/Msp I (H/M) adapter (Supplemental Table ), 1.5 U T4 ligase (NEB, U.S.), 3 μl ATP (NEB, U.S.), 1.5 μl Cutsmart buffer (NEB, U.S.), and ddH2 O to a final volume of 30 μl.

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: After reverse transcription, the cDNA was PCR amplified and RNA-seq library was generated according to the Smart-seq 2 protocol . .. We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation.

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: The PCR products were digested by the restriction enzyme MboII , HphI , and XhoI (New England BioLabs, Frankfurt am Main, Germany) for PTH1R , TRAFD1 , and STC1 , respectively. .. Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
Article Snippet: Venus template was PCR amplified to add BamHI-HF (5′) and EcoRI-HF (3′) restriction sites for cloning purposes using the following conditions: KOD buffer (1×), MgSO4 (1.5 mM), dNTPs (0.2 mM each), forward primer (0.3 μM; GGCCGGCCggatccGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGA AGAGAATCCTGGACCGATGGTGAGCAAGGGCGAGGA), reverse primer (0.3 μM; GGCCGGCCgaattcTTACTTGTACAGCTCGTCCA), and KOD Hot Start DNA Polymerase (0.02 U/μL) (Millipore). .. PCR-blunt cloned products and lentiCas9-Blast (Addgene plasmid ID 52962) were separately digested with BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) in 1× Buffer CutSmart at 37°C (New England Biolabs).

Article Title: A novel RFLP-ARMS TaqMan PCR-based method for detecting the BRAF V600E mutation in melanoma
Article Snippet: This method involved a first PCR amplification step, enzymatic digestion (to remove the wild-type DNA), a second PCR step for mutant enrichment and a final sequencing step. .. Following the first round of PCR, digestion of the wild-type product was performed in a 50 µl volume containing 10 µl first-round PCR product, 5 µl 10X CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA, USA) and 5 IU TspRI (New England Biolabs, Inc.) at 65°C for 30 min. All of the obtained second-round PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

DNA Ligation:

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: RRBS library was generated as reported previously with modifications . .. We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation. .. To minimize DNA loss, DNA purification step was eliminated after each enzymatic reaction.

Construct:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs). .. The reactions were incubated at 37 °C for 45 min, followed by heating to 80 °C and slow cooling to 22 °C at 0.1 °C/s in a temperature-controlled block.

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: We newly constructed a flexible ddRAD-seq library preparation protocol to facilitate high-throughput ddRAD-seq analyses at low cost. .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions.

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Double-digest restriction site-associated DNA libraries were constructed from two populations at a time, in batches of twelve mosquitoes, with six individuals from each population per batch. .. A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI.

Incubation:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: After cooling the reactions to room temperature, 3 μl of a premade adapter mix was added to the digested DNA, and incubated at room temperature for 10 min. .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Article Title: Fabrication of molecular tension probes
Article Snippet: A double digestion is convenient with the Cutsmart buffer of New England Biolab. .. A double digestion is convenient with the Cutsmart buffer of New England Biolab.

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: Adherent cultured cells were made single‐cell suspension and fixed by adding formaldehyde to a final concentration of 2% followed by incubation for 10 min at room temperature. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

Article Title: Deciphering TAL effectors for 5-methylcytosine and 5-hydroxymethylcytosine recognition
Article Snippet: For MspI protection assay: each 10 μL reaction contains 1 nM labeled DNA, 1 μL 10× CutSmart Buffer (NEB) and100 nM NaCl. .. TALE proteins was added to a final concentration between 10 nM and 8 μM.

Article Title: GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris
Article Snippet: BB3 plasmids for CRISPR/Cas9-mediated genome editing were assembled as usual recipient BB3, consisting of resistance cassette, Ori, CEN/ARS locus and a linker containing fusion sites FsA-FsC for integration of two transcription units (Additional file and Fig. ). .. One μL Bsa I or Bpi I (10 U), 40 U T4 Ligase (0.1 μL), 2 μL CutSmart™ Buffer (10×, NEB), 2 μL ATP (10 mM, NEB) and 40 nM dilutions of PCR fragments and/or carrier and recipient backbone were diluted in 20 μL total volume and incubated as follows: 8 to 50 cycles (depending on insert number) of each 2 min at 37 °C and 16 °C, followed by 10 min at 37 °C, 30 min at 55 °C and 10 min at 80 °C (final ligation, digestion and heat inactivation). .. For evaluation of promoter and terminator function (screening), P. pastoris transformants were cultivated at 25 °C on a rotary shaker at 280 rpm.

Article Title: Chromatin-enriched lncRNAs can act as cell-type specific activators of proximal gene transcription
Article Snippet: Triton X-100 was added to 1% (v/v) final and samples were incubated at 37°C (1 hour, 900 rpm in Eppendorf Thermomixer). .. The pellet and remaining volume of supernatant were resuspended in 0.25 mL final of 0.5× Buffer A + 1× CutSmart Buffer (NEB) with the concentration of protease inhibitor adjusted to 1× final.

Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
Article Snippet: After incubation at 37°C for 6 h, 5 μl digestion product was assessed with 0.5% agarose gels to ensure that the genomic DNA was completely digested (Supplemental Figure ). .. The ligation reaction contained 15 μl digestion product, 5 pmol EcoR I adapter (Supplemental Table ), 50 pmol Hpa II/Msp I (H/M) adapter (Supplemental Table ), 1.5 U T4 ligase (NEB, U.S.), 3 μl ATP (NEB, U.S.), 1.5 μl Cutsmart buffer (NEB, U.S.), and ddH2 O to a final volume of 30 μl.

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation. .. We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation.

Article Title: Quantitative profiling of BATF family proteins/JUNB/IRF hetero-trimers using Spec-seq
Article Snippet: Because any unextended single-stranded DNA (ssDNA) could contaminate the unbound band, the reaction mix was digested by 1 ml NEB Exo I exo-nuclease (New England Biolabs) for 30 min. All final dsDNA products were purified by PCR purification columns (QIAGEN) and eluted in MilliQ water (Millipore). .. All binding reactions were done in a 10 µl reaction volume using 100 nM BATF proteins-JUNB heterodimers, 150 nM IRF proteins if needed, 1μM of dsDNA library in 1× NEB Cutsmart buffer (50 mM Potassium Acetate; 20 mM Tris–acetate; 10 mM Magnesium Acetate; 100 μg/ml BSA, pH 7.9 @25 °C) supplemented with 10% glycerol and were incubated for 30 min on ice. .. Electrophoresis mobility shift assays (EMSA) were done using native 9% PAGE prepared as Tris/Glycine (25 mM Tris pH 8.3; 192 mM glycine) mini-gels (Bio-Rad).

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: In addition, we designed 96 sets of indexed and forked sequencing adaptors compatible with Illumina platform sequencers (Supplementary Data ). .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions. .. Library DNA fragments ranging from 300 to 500 bp were size-selected with Pippin Prep (Sage Science).

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI. .. A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI.

Luciferase:

Article Title: Fabrication of molecular tension probes
Article Snippet: The C-terminal domain of firefly luciferase (FLuc) is rotated to release luciferin in the light-emitting process , which is hampered by the molecular tension in the probe. .. A double digestion is convenient with the Cutsmart buffer of New England Biolab.

Activity Assay:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Barcoded adapters were designed such that adapter–genomic DNA ligations did not reconstitute RE sites, while residual RE activity limited concatemerization of genomic fragments. .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Infection:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs). .. For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs).

Acrylamide Gel Assay:

Article Title: Quantitative profiling of BATF family proteins/JUNB/IRF hetero-trimers using Spec-seq
Article Snippet: All binding reactions were done in a 10 µl reaction volume using 100 nM BATF proteins-JUNB heterodimers, 150 nM IRF proteins if needed, 1μM of dsDNA library in 1× NEB Cutsmart buffer (50 mM Potassium Acetate; 20 mM Tris–acetate; 10 mM Magnesium Acetate; 100 μg/ml BSA, pH 7.9 @25 °C) supplemented with 10% glycerol and were incubated for 30 min on ice. .. After EMSA, the gels were stained with ethidium bromide and visualized using Bio-Rad gel imager.

Western Blot:

Article Title: Elevated LRRK2 autophosphorylation in brain-derived and peripheral exosomes in LRRK2 mutation carriers
Article Snippet: The following antibodies were used: N241A/34 anti-LRRK2 (Antibodies Inc), MJFF2 c41-2 anti-LRRK2 (Abcam), UDD3 anti-LRRK2 (Abcam), UDD2-10 anti-pS935 LRRK2 (Abcam), MJFR-19-7-8 anti-pS1292-LRRK2, UDD3 anti-LRRK2 (Abcam), D2V7J anti-flotillin-1 (Cell Signaling), and polyclonal antibodies to phospho-threonine (P-Thr-Poly 9381, Cell Signaling) and Tsg101 (ab30871, Abcam). .. For some immunoblots, after transfer of protein was completed, membranes were blocked with 3% BSA (Jackson ImmunoResearch) in TBS-T and treated with or without 250 units mL-1 calf intestinal alkaline phosphatase (CIP, New England BioLabs) in CutSmart buffer (New England BioLabs) for 2 hours at 37 0 C. Quantification of proteins on the membranes then proceeded as described above. .. All samples were assayed and quantified in randomized order and group assignments were made after final data curation.

Transformation Assay:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs). .. The reactions were incubated at 37 °C for 45 min, followed by heating to 80 °C and slow cooling to 22 °C at 0.1 °C/s in a temperature-controlled block.

Gel Purification:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Ligation:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: P1 and P2 adapter included an inline five- or seven-base barcode for sample identification. .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. The ligated samples were then heat-denatured at 65° for 20 min, cooled, and combined into a single pool.

Article Title: GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris
Article Snippet: BB3 plasmids for CRISPR/Cas9-mediated genome editing were assembled as usual recipient BB3, consisting of resistance cassette, Ori, CEN/ARS locus and a linker containing fusion sites FsA-FsC for integration of two transcription units (Additional file and Fig. ). .. One μL Bsa I or Bpi I (10 U), 40 U T4 Ligase (0.1 μL), 2 μL CutSmart™ Buffer (10×, NEB), 2 μL ATP (10 mM, NEB) and 40 nM dilutions of PCR fragments and/or carrier and recipient backbone were diluted in 20 μL total volume and incubated as follows: 8 to 50 cycles (depending on insert number) of each 2 min at 37 °C and 16 °C, followed by 10 min at 37 °C, 30 min at 55 °C and 10 min at 80 °C (final ligation, digestion and heat inactivation). .. For evaluation of promoter and terminator function (screening), P. pastoris transformants were cultivated at 25 °C on a rotary shaker at 280 rpm.

Article Title: Chromatin-enriched lncRNAs can act as cell-type specific activators of proximal gene transcription
Article Snippet: The pellet and remaining volume of supernatant were resuspended in 0.25 mL final of 0.5× Buffer A + 1× CutSmart Buffer (NEB) with the concentration of protease inhibitor adjusted to 1× final. .. The pellet and remaining volume of supernatant were resuspended in 0.25 mL final of 0.5× Buffer A + 1× CutSmart Buffer (NEB) with the concentration of protease inhibitor adjusted to 1× final.

Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
Article Snippet: After incubation at 37°C for 6 h, 5 μl digestion product was assessed with 0.5% agarose gels to ensure that the genomic DNA was completely digested (Supplemental Figure ). .. The ligation reaction contained 15 μl digestion product, 5 pmol EcoR I adapter (Supplemental Table ), 50 pmol Hpa II/Msp I (H/M) adapter (Supplemental Table ), 1.5 U T4 ligase (NEB, U.S.), 3 μl ATP (NEB, U.S.), 1.5 μl Cutsmart buffer (NEB, U.S.), and ddH2 O to a final volume of 30 μl. .. The ligation product was diluted 20-fold before pre-amplification.

Article Title: Global delay in nascent strand DNA methylation
Article Snippet: Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs Cat#B7204S) per well (480 cells total). .. The digested DNA was end-repaired and adenylated by adding to each sample 2 μl of a mixture containing 2.5 U Klenow fragment (3′-5′exo-, NEB), 0.4 μl of dNTP mixture (10 mM dATP, 1 mM dCTP and 1 mM dGTP) and 1x CutSmart buffer and incubating at 30 °C for 25 min followed by 37 °C for another 30 min. After heat inactivation at 70°C for 10 min, adenylated DNA fragments were ligated with 5mC substituted indexed adapters overnight at 16 °C through distributing to each well 3 μl of reaction containing 800 U of T4 ligase (NEB), 0.1 μl of 100mM ATP (Roche), 1.5 μl of 0.1μM methylated indexed adapter and 1x CutSmart buffer.

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Library construction was similar to the ‘optimized protocol’ of Hoffberg et al. [ ], although pooling occurred prior to size selection, rather than after adaptor ligation. .. A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI.

Gel Extraction:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Protease Inhibitor:

Article Title: Chromatin-enriched lncRNAs can act as cell-type specific activators of proximal gene transcription
Article Snippet: Nuclei were pelleted (500 rcf, 10 min, room temperature), and 0.4 mL of the supernatant was removed. .. The pellet and remaining volume of supernatant were resuspended in 0.25 mL final of 0.5× Buffer A + 1× CutSmart Buffer (NEB) with the concentration of protease inhibitor adjusted to 1× final. .. DNA digestion was performed at 37°C (12 hours, 900 rpm) with initially 100 units of NspI (NEB), plus 20 more units after 1.5 hours.

Methylation:

Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
Article Snippet: Paragraph title: Methylation-sensitive amplification polymorphism (MSAP) assay ... The ligation reaction contained 15 μl digestion product, 5 pmol EcoR I adapter (Supplemental Table ), 50 pmol Hpa II/Msp I (H/M) adapter (Supplemental Table ), 1.5 U T4 ligase (NEB, U.S.), 3 μl ATP (NEB, U.S.), 1.5 μl Cutsmart buffer (NEB, U.S.), and ddH2 O to a final volume of 30 μl.

Article Title: Epigenomic map of human liver reveals principles of zonated morphogenic and metabolic control
Article Snippet: Briefly, cell lysis of micro-dissected material was performed directly in the caps of the capturing tubes by treatment with 8 µl lysis buffer (10 mM Tris-HCl, 5 mM EDTA) and 2 µl proteinase K (1 mg per ml, NEB) at 55 °C for 3 h. For proteinase inactivation, 0.5 µl Pefabloc (21 mM, Sigma) was added for 1 h at room temperature. .. Restriction was performed using the CpG methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 h. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′exo−, 5 U per µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1:ACACTCTTTCCCTACACGACGCTCTTCCGATCT, adapter 2:GATCGGAAGAGCAC ACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U per µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 h. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo). .. Adapter ligated fragments were amplified by PCR using 0.5 µl each of indexed TruSeq primers (10 µM, Primer I5: AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTC CCTACACGACGCTCTTCCGAT, Primer I7:GATCGGAAGAGCACACGTCTGAACTC CAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG), 3 µl PCR Buffer (10X, Qiagen), 1.2 µl MgCl2 (25 mM), 2.4 µl dNTPs (10 mM) and 0.5 µl Hot Start Taq (5 U per µl, Qiagen) in a 30 µl reaction with 95 °C for 15 min, 22 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min and final elongation at 72 °C for 7 min. After purification with 0.8 X Ampure XP Beads (Beckman Coulter) libraries were sequenced on a HiSeq2500 (Illumina) using TruSeq SBS Kit v3 – HS chemistry in a single read run with 90 bp read length.

Article Title: Global delay in nascent strand DNA methylation
Article Snippet: Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs Cat#B7204S) per well (480 cells total). .. After heat-inactivation of proteinase K at 75 °C for 30 min, we added 2 μl of digestion buffer consisting of 1xCutSmart buffer and 0.5 μl MspI (20 U/μl, New England Biolabs) directly to each cell lysis reaction.

Cell Culture:

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: Adherent cultured cells were made single‐cell suspension and fixed by adding formaldehyde to a final concentration of 2% followed by incubation for 10 min at room temperature. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

Generated:

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: RRBS library was generated as reported previously with modifications . .. We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation.

CpG Methylation Assay:

Article Title: Fetal Aneuploidy Detection by Cell-Free DNA Sequencing for Multiple Pregnancies and Quality Issues with Vanishing Twins
Article Snippet: A measurement of the cell-free fetal DNA in relation to total cell-free DNA is required to determine the fetal fraction as a quality control. .. From the eluted cell-free DNA 11 μL were digested with the CpG methylation sensitive enzymes Hha1 (0.4 U/μL), HpaII (0.3 U/μL) and BstUI (0.3 U/μL) in a 22 μL reaction using CutSmart™ Buffer (New England Biolabs, Frankfurt am Main, Germany). .. For a duplicate measurement, two times 10 μL out of the digestion reaction were used as template DNA for quantitative PCR.

Article Title: Epigenomic map of human liver reveals principles of zonated morphogenic and metabolic control
Article Snippet: Briefly, cell lysis of micro-dissected material was performed directly in the caps of the capturing tubes by treatment with 8 µl lysis buffer (10 mM Tris-HCl, 5 mM EDTA) and 2 µl proteinase K (1 mg per ml, NEB) at 55 °C for 3 h. For proteinase inactivation, 0.5 µl Pefabloc (21 mM, Sigma) was added for 1 h at room temperature. .. Restriction was performed using the CpG methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 h. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′exo−, 5 U per µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1:ACACTCTTTCCCTACACGACGCTCTTCCGATCT, adapter 2:GATCGGAAGAGCAC ACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U per µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 h. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo). .. Adapter ligated fragments were amplified by PCR using 0.5 µl each of indexed TruSeq primers (10 µM, Primer I5: AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTC CCTACACGACGCTCTTCCGAT, Primer I7:GATCGGAAGAGCACACGTCTGAACTC CAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG), 3 µl PCR Buffer (10X, Qiagen), 1.2 µl MgCl2 (25 mM), 2.4 µl dNTPs (10 mM) and 0.5 µl Hot Start Taq (5 U per µl, Qiagen) in a 30 µl reaction with 95 °C for 15 min, 22 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min and final elongation at 72 °C for 7 min. After purification with 0.8 X Ampure XP Beads (Beckman Coulter) libraries were sequenced on a HiSeq2500 (Illumina) using TruSeq SBS Kit v3 – HS chemistry in a single read run with 90 bp read length.

DNA Sequencing:

Article Title: A novel RFLP-ARMS TaqMan PCR-based method for detecting the BRAF V600E mutation in melanoma
Article Snippet: Paragraph title: Genotyping by DNA sequencing ... Following the first round of PCR, digestion of the wild-type product was performed in a 50 µl volume containing 10 µl first-round PCR product, 5 µl 10X CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA, USA) and 5 IU TspRI (New England Biolabs, Inc.) at 65°C for 30 min. All of the obtained second-round PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

Sequencing:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Paragraph title: ddRAD library preparation and sequencing ... Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: In addition, we designed 96 sets of indexed and forked sequencing adaptors compatible with Illumina platform sequencers (Supplementary Data ). .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions.

Article Title: Epigenomic map of human liver reveals principles of zonated morphogenic and metabolic control
Article Snippet: Briefly, cell lysis of micro-dissected material was performed directly in the caps of the capturing tubes by treatment with 8 µl lysis buffer (10 mM Tris-HCl, 5 mM EDTA) and 2 µl proteinase K (1 mg per ml, NEB) at 55 °C for 3 h. For proteinase inactivation, 0.5 µl Pefabloc (21 mM, Sigma) was added for 1 h at room temperature. .. Restriction was performed using the CpG methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 h. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′exo−, 5 U per µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1:ACACTCTTTCCCTACACGACGCTCTTCCGATCT, adapter 2:GATCGGAAGAGCAC ACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U per µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 h. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo). .. Adapter ligated fragments were amplified by PCR using 0.5 µl each of indexed TruSeq primers (10 µM, Primer I5: AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTC CCTACACGACGCTCTTCCGAT, Primer I7:GATCGGAAGAGCACACGTCTGAACTC CAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG), 3 µl PCR Buffer (10X, Qiagen), 1.2 µl MgCl2 (25 mM), 2.4 µl dNTPs (10 mM) and 0.5 µl Hot Start Taq (5 U per µl, Qiagen) in a 30 µl reaction with 95 °C for 15 min, 22 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min and final elongation at 72 °C for 7 min. After purification with 0.8 X Ampure XP Beads (Beckman Coulter) libraries were sequenced on a HiSeq2500 (Illumina) using TruSeq SBS Kit v3 – HS chemistry in a single read run with 90 bp read length.

Article Title: A novel RFLP-ARMS TaqMan PCR-based method for detecting the BRAF V600E mutation in melanoma
Article Snippet: This method involved a first PCR amplification step, enzymatic digestion (to remove the wild-type DNA), a second PCR step for mutant enrichment and a final sequencing step. .. Following the first round of PCR, digestion of the wild-type product was performed in a 50 µl volume containing 10 µl first-round PCR product, 5 µl 10X CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA, USA) and 5 IU TspRI (New England Biolabs, Inc.) at 65°C for 30 min. All of the obtained second-round PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

Binding Assay:

Article Title: Deciphering TAL effectors for 5-methylcytosine and 5-hydroxymethylcytosine recognition
Article Snippet: For MspI protection assay: each 10 μL reaction contains 1 nM labeled DNA, 1 μL 10× CutSmart Buffer (NEB) and100 nM NaCl. .. TALE proteins was added to a final concentration between 10 nM and 8 μM.

Article Title: Quantitative profiling of BATF family proteins/JUNB/IRF hetero-trimers using Spec-seq
Article Snippet: Because any unextended single-stranded DNA (ssDNA) could contaminate the unbound band, the reaction mix was digested by 1 ml NEB Exo I exo-nuclease (New England Biolabs) for 30 min. All final dsDNA products were purified by PCR purification columns (QIAGEN) and eluted in MilliQ water (Millipore). .. All binding reactions were done in a 10 µl reaction volume using 100 nM BATF proteins-JUNB heterodimers, 150 nM IRF proteins if needed, 1μM of dsDNA library in 1× NEB Cutsmart buffer (50 mM Potassium Acetate; 20 mM Tris–acetate; 10 mM Magnesium Acetate; 100 μg/ml BSA, pH 7.9 @25 °C) supplemented with 10% glycerol and were incubated for 30 min on ice. .. Electrophoresis mobility shift assays (EMSA) were done using native 9% PAGE prepared as Tris/Glycine (25 mM Tris pH 8.3; 192 mM glycine) mini-gels (Bio-Rad).

Marker:

Article Title: Fetal Aneuploidy Detection by Cell-Free DNA Sequencing for Multiple Pregnancies and Quality Issues with Vanishing Twins
Article Snippet: From the eluted cell-free DNA 11 μL were digested with the CpG methylation sensitive enzymes Hha1 (0.4 U/μL), HpaII (0.3 U/μL) and BstUI (0.3 U/μL) in a 22 μL reaction using CutSmart™ Buffer (New England Biolabs, Frankfurt am Main, Germany). .. Primers that span CpG methylation sensitive restriction enzyme sites are used in combination with FAM-labelled probes and primers that do not span the relevant restriction sites are used in combination with VIC-labelled probes (for primer sequences see and for thermocycler profiles see ).

RNA Sequencing Assay:

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: Paragraph title: Dual RRBS and RNA-seq profiling ... We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation.

Magnetic Beads:

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI. .. A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI.

Mutagenesis:

Article Title: A novel RFLP-ARMS TaqMan PCR-based method for detecting the BRAF V600E mutation in melanoma
Article Snippet: This method involved a first PCR amplification step, enzymatic digestion (to remove the wild-type DNA), a second PCR step for mutant enrichment and a final sequencing step. .. Following the first round of PCR, digestion of the wild-type product was performed in a 50 µl volume containing 10 µl first-round PCR product, 5 µl 10X CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA, USA) and 5 IU TspRI (New England Biolabs, Inc.) at 65°C for 30 min. All of the obtained second-round PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

Isolation:

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: Genomic DNA was isolated utilizing 1× Agencourt AMPure beads (Beckman Coulter) and was eluted to 15 μl of low TE buffer. .. We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation.

Multiplex Assay:

Article Title: Fetal Aneuploidy Detection by Cell-Free DNA Sequencing for Multiple Pregnancies and Quality Issues with Vanishing Twins
Article Snippet: From the eluted cell-free DNA 11 μL were digested with the CpG methylation sensitive enzymes Hha1 (0.4 U/μL), HpaII (0.3 U/μL) and BstUI (0.3 U/μL) in a 22 μL reaction using CutSmart™ Buffer (New England Biolabs, Frankfurt am Main, Germany). .. For a duplicate measurement, two times 10 μL out of the digestion reaction were used as template DNA for quantitative PCR.

Labeling:

Article Title: Deciphering TAL effectors for 5-methylcytosine and 5-hydroxymethylcytosine recognition
Article Snippet: Reporters are PCR amplified linear dsDNA using chemical synthesized primers consisted of TALE-(XX′)3 -binding sites 5′-CTGGCCNNNTACGTA-3′, in which N represents 5mC or 5hmC, was located immediately upstream of a minimal CMV promoter (PminCMV) and its downstream EGFP gene. .. For MspI protection assay: each 10 μL reaction contains 1 nM labeled DNA, 1 μL 10× CutSmart Buffer (NEB) and100 nM NaCl. .. TALE proteins was added to a final concentration between 10 nM and 8 μM.

Purification:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: All PCR products were purified using MinElute PCR Purification Kit (Qiagen) to 10 μL final volume and quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific). .. For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs).

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: In addition, we designed 96 sets of indexed and forked sequencing adaptors compatible with Illumina platform sequencers (Supplementary Data ). .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions. .. Library DNA fragments ranging from 300 to 500 bp were size-selected with Pippin Prep (Sage Science).

Article Title: Global delay in nascent strand DNA methylation
Article Snippet: Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs Cat#B7204S) per well (480 cells total). .. The digested DNA was end-repaired and adenylated by adding to each sample 2 μl of a mixture containing 2.5 U Klenow fragment (3′-5′exo-, NEB), 0.4 μl of dNTP mixture (10 mM dATP, 1 mM dCTP and 1 mM dGTP) and 1x CutSmart buffer and incubating at 30 °C for 25 min followed by 37 °C for another 30 min. After heat inactivation at 70°C for 10 min, adenylated DNA fragments were ligated with 5mC substituted indexed adapters overnight at 16 °C through distributing to each well 3 μl of reaction containing 800 U of T4 ligase (NEB), 0.1 μl of 100mM ATP (Roche), 1.5 μl of 0.1μM methylated indexed adapter and 1x CutSmart buffer.

Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
Article Snippet: PCR products were purified (QIAquick PCR Purification Kit, Qiagen) and blunt end cloned with Zero Blunt PCR cloning kit (Invitrogen). .. PCR-blunt cloned products and lentiCas9-Blast (Addgene plasmid ID 52962) were separately digested with BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) in 1× Buffer CutSmart at 37°C (New England Biolabs).

Polymerase Chain Reaction:

Article Title: Fetal Aneuploidy Detection by Cell-Free DNA Sequencing for Multiple Pregnancies and Quality Issues with Vanishing Twins
Article Snippet: From the eluted cell-free DNA 11 μL were digested with the CpG methylation sensitive enzymes Hha1 (0.4 U/μL), HpaII (0.3 U/μL) and BstUI (0.3 U/μL) in a 22 μL reaction using CutSmart™ Buffer (New England Biolabs, Frankfurt am Main, Germany). .. For a duplicate measurement, two times 10 μL out of the digestion reaction were used as template DNA for quantitative PCR.

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB).

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: All PCR products were purified using MinElute PCR Purification Kit (Qiagen) to 10 μL final volume and quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific). .. For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs).

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

Article Title: GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris
Article Snippet: BB3 plasmids for CRISPR/Cas9-mediated genome editing were assembled as usual recipient BB3, consisting of resistance cassette, Ori, CEN/ARS locus and a linker containing fusion sites FsA-FsC for integration of two transcription units (Additional file and Fig. ). .. One μL Bsa I or Bpi I (10 U), 40 U T4 Ligase (0.1 μL), 2 μL CutSmart™ Buffer (10×, NEB), 2 μL ATP (10 mM, NEB) and 40 nM dilutions of PCR fragments and/or carrier and recipient backbone were diluted in 20 μL total volume and incubated as follows: 8 to 50 cycles (depending on insert number) of each 2 min at 37 °C and 16 °C, followed by 10 min at 37 °C, 30 min at 55 °C and 10 min at 80 °C (final ligation, digestion and heat inactivation). .. For evaluation of promoter and terminator function (screening), P. pastoris transformants were cultivated at 25 °C on a rotary shaker at 280 rpm.

Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
Article Snippet: The ligation reaction contained 15 μl digestion product, 5 pmol EcoR I adapter (Supplemental Table ), 50 pmol Hpa II/Msp I (H/M) adapter (Supplemental Table ), 1.5 U T4 ligase (NEB, U.S.), 3 μl ATP (NEB, U.S.), 1.5 μl Cutsmart buffer (NEB, U.S.), and ddH2 O to a final volume of 30 μl. .. The ligation product was diluted 20-fold before pre-amplification.

Article Title: Epigenetic restriction of extraembryonic lineages mirrors the somatic transition to cancer
Article Snippet: After reverse transcription, the cDNA was PCR amplified and RNA-seq library was generated according to the Smart-seq 2 protocol . .. We utilized the CutSmart buffer (New England Biolabs) for all three enzymatic reactions including MspI digestion, end-repair/A-tailing and T4 DNA ligation.

Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
Article Snippet: The PCR products were digested by the restriction enzyme MboII , HphI , and XhoI (New England BioLabs, Frankfurt am Main, Germany) for PTH1R , TRAFD1 , and STC1 , respectively. .. Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
Article Snippet: PCR products were purified (QIAquick PCR Purification Kit, Qiagen) and blunt end cloned with Zero Blunt PCR cloning kit (Invitrogen). .. PCR-blunt cloned products and lentiCas9-Blast (Addgene plasmid ID 52962) were separately digested with BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) in 1× Buffer CutSmart at 37°C (New England Biolabs). .. Digest of lentiCas9-Blast was performed to remove the blasticidin cassette.

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI. .. A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI.

Article Title: A novel RFLP-ARMS TaqMan PCR-based method for detecting the BRAF V600E mutation in melanoma
Article Snippet: The cycling conditions consisted of 95°C for 10 min, followed by 20 (round 1) or 35 (round 2) cycles of 95°C for 15 sec, 58°C for 20 sec and 72°C for 30 sec, with a final extension at 72°C for 7 min and a final hold at 4°C. .. Following the first round of PCR, digestion of the wild-type product was performed in a 50 µl volume containing 10 µl first-round PCR product, 5 µl 10X CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA, USA) and 5 IU TspRI (New England Biolabs, Inc.) at 65°C for 30 min. All of the obtained second-round PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). .. The sequencing machine used was ABl-PRISM 3730 (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the analysis software was DNASTAR (v.5.0; DNASTAR, Inc.).

Lysis:

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: Cell lysis was performed by adding 1 ml of cell lysis buffer (10 mM Tris‐HCl, pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 1 × protein inhibitor) and incubating for 30 min on ice. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

Article Title: Epigenomic map of human liver reveals principles of zonated morphogenic and metabolic control
Article Snippet: Briefly, cell lysis of micro-dissected material was performed directly in the caps of the capturing tubes by treatment with 8 µl lysis buffer (10 mM Tris-HCl, 5 mM EDTA) and 2 µl proteinase K (1 mg per ml, NEB) at 55 °C for 3 h. For proteinase inactivation, 0.5 µl Pefabloc (21 mM, Sigma) was added for 1 h at room temperature. .. Restriction was performed using the CpG methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 h. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′exo−, 5 U per µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1:ACACTCTTTCCCTACACGACGCTCTTCCGATCT, adapter 2:GATCGGAAGAGCAC ACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U per µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 h. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo).

Article Title: Global delay in nascent strand DNA methylation
Article Snippet: Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs Cat#B7204S) per well (480 cells total). .. Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs Cat#B7204S) per well (480 cells total).

Chloramphenicol Acetyltransferase Assay:

Article Title: Global delay in nascent strand DNA methylation
Article Snippet: ESCs were collected, fixed in 75% ethanol and stained with PI. .. Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs CatB7204S) per well (480 cells total). .. Sorted cells were lysed at 50 °C for 2 h in a reaction containing 0.2 U proteinase K (New England Biolabs), 0.2% Triton X-100 (EMD Millipore) and 1x CutSmart buffer.

Polymerase Cycling Assembly:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: All PCR products were purified using MinElute PCR Purification Kit (Qiagen) to 10 μL final volume and quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific). .. For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs). .. The reactions were incubated at 37 °C for 45 min, followed by heating to 80 °C and slow cooling to 22 °C at 0.1 °C/s in a temperature-controlled block.

Plasmid Preparation:

Article Title: Fabrication of molecular tension probes
Article Snippet: A double digestion is convenient with the Cutsmart buffer of New England Biolab. .. A double digestion is convenient with the Cutsmart buffer of New England Biolab.

Article Title: Targeted DNA methylation in human cells using engineered dCas9-methyltransferases
Article Snippet: Band patterns were visualized under UV light and imaged with Carestream Gel Logic 112. .. Plasmid DNA (5 μg) was linearized using 80 units SacI-HF in 40 µl Cutsmart Buffer for 5 h at 37 °C. .. DNA was purified with Purelink Gel Extraction Protocol and eluted in TE Buffer to obtain a final concentration of 10–20 ng/μL.

Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
Article Snippet: PCR products were purified (QIAquick PCR Purification Kit, Qiagen) and blunt end cloned with Zero Blunt PCR cloning kit (Invitrogen). .. PCR-blunt cloned products and lentiCas9-Blast (Addgene plasmid ID 52962) were separately digested with BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) in 1× Buffer CutSmart at 37°C (New England Biolabs). .. Digest of lentiCas9-Blast was performed to remove the blasticidin cassette.

Functional Assay:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs). .. For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs).

Selection:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. The pooled sample was column-purified (MinElute PCR Purification Kit, Qiagen, UK), and eluted in 100 μl EB buffer (Qiagen, UK).

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Library construction was similar to the ‘optimized protocol’ of Hoffberg et al. [ ], although pooling occurred prior to size selection, rather than after adaptor ligation. .. A total of 200 ng of genomic DNA from each sample was digested for 3 hours at 37°C in a 25 μl reaction with 1X CutSmart Buffer (New England Biolabs), 10 units of DdeI, and 10 units of MspI.

Agarose Gel Electrophoresis:

Article Title: Exploring a Nonmodel Teleost Genome Through RAD Sequencing—Linkage Mapping in Common Pandora, Pagellus erythrinus and Comparative Genomic Analysis
Article Snippet: Ligation was performed over 3 hr at 22° by addition of a further 3 µl of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer (NEB). .. The pooled sample was column-purified (MinElute PCR Purification Kit, Qiagen, UK), and eluted in 100 μl EB buffer (Qiagen, UK).

Size-exclusion Chromatography:

Article Title: A novel RFLP-ARMS TaqMan PCR-based method for detecting the BRAF V600E mutation in melanoma
Article Snippet: The cycling conditions consisted of 95°C for 10 min, followed by 20 (round 1) or 35 (round 2) cycles of 95°C for 15 sec, 58°C for 20 sec and 72°C for 30 sec, with a final extension at 72°C for 7 min and a final hold at 4°C. .. Following the first round of PCR, digestion of the wild-type product was performed in a 50 µl volume containing 10 µl first-round PCR product, 5 µl 10X CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA, USA) and 5 IU TspRI (New England Biolabs, Inc.) at 65°C for 30 min. All of the obtained second-round PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

Spectrophotometry:

Article Title: Continuous evolution of B. thuringiensis toxins overcomes insect resistance
Article Snippet: All PCR products were purified using MinElute PCR Purification Kit (Qiagen) to 10 μL final volume and quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific). .. For assembly, PCR products carrying complementary USER junctions were mixed in an equimolar ratio (up to 1 pmol each) in a 10 μL reaction containing 15 units Dpn I (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent) enzyme (Endonuclease VIII and Uracil-DNA Glycosylase, NEB), 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg/ml BSA at pH 7.9 (1x CutSmart Buffer, New England Biolabs).

DNA Methylation Assay:

Article Title: Epigenomic map of human liver reveals principles of zonated morphogenic and metabolic control
Article Snippet: Briefly, cell lysis of micro-dissected material was performed directly in the caps of the capturing tubes by treatment with 8 µl lysis buffer (10 mM Tris-HCl, 5 mM EDTA) and 2 µl proteinase K (1 mg per ml, NEB) at 55 °C for 3 h. For proteinase inactivation, 0.5 µl Pefabloc (21 mM, Sigma) was added for 1 h at room temperature. .. Restriction was performed using the CpG methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 h. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′exo−, 5 U per µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1:ACACTCTTTCCCTACACGACGCTCTTCCGATCT, adapter 2:GATCGGAAGAGCAC ACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U per µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 h. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo). .. Adapter ligated fragments were amplified by PCR using 0.5 µl each of indexed TruSeq primers (10 µM, Primer I5: AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTC CCTACACGACGCTCTTCCGAT, Primer I7:GATCGGAAGAGCACACGTCTGAACTC CAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG), 3 µl PCR Buffer (10X, Qiagen), 1.2 µl MgCl2 (25 mM), 2.4 µl dNTPs (10 mM) and 0.5 µl Hot Start Taq (5 U per µl, Qiagen) in a 30 µl reaction with 95 °C for 15 min, 22 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min and final elongation at 72 °C for 7 min. After purification with 0.8 X Ampure XP Beads (Beckman Coulter) libraries were sequenced on a HiSeq2500 (Illumina) using TruSeq SBS Kit v3 – HS chemistry in a single read run with 90 bp read length.

Concentration Assay:

Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
Article Snippet: Cross‐linking was stopped by adding glycine to a final concentration of 1 M and incubating at room temperature for 5 min. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

Article Title: Chromatin-enriched lncRNAs can act as cell-type specific activators of proximal gene transcription
Article Snippet: Nuclei were pelleted (500 rcf, 10 min, room temperature), and 0.4 mL of the supernatant was removed. .. The pellet and remaining volume of supernatant were resuspended in 0.25 mL final of 0.5× Buffer A + 1× CutSmart Buffer (NEB) with the concentration of protease inhibitor adjusted to 1× final. .. DNA digestion was performed at 37°C (12 hours, 900 rpm) with initially 100 units of NspI (NEB), plus 20 more units after 1.5 hours.

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions. .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions.

DNA Purification:

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions. .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions.

High Throughput Screening Assay:

Article Title: Repeated inversions within a pannier intron drive diversification of intraspecific colour patterns of ladybird beetles
Article Snippet: We newly constructed a flexible ddRAD-seq library preparation protocol to facilitate high-throughput ddRAD-seq analyses at low cost. .. Briefly, 100 ng of genomic DNA was first double-digested with 15 U of Eco RI-HF and 15 U of Hin dIII-HF in 20 µl of NEB CutSmart Buffer (New England Biolabs) at 37 °C for 2 h. Fifteen microlitres of the digested DNA, 4 pmol of adaptor DNA, 10 µmol of ATP, 400 U of T4 DNA ligase were mixed in 20 µl, incubated at 22 °C for 2 h, and denatured at 65 °C for 10 min. Ligated library DNA fragments were purified with Agencourt AMPureXP (Beckman Coulter) according to the manufacturer’s instructions.

Staining:

Article Title: Quantitative profiling of BATF family proteins/JUNB/IRF hetero-trimers using Spec-seq
Article Snippet: All binding reactions were done in a 10 µl reaction volume using 100 nM BATF proteins-JUNB heterodimers, 150 nM IRF proteins if needed, 1μM of dsDNA library in 1× NEB Cutsmart buffer (50 mM Potassium Acetate; 20 mM Tris–acetate; 10 mM Magnesium Acetate; 100 μg/ml BSA, pH 7.9 @25 °C) supplemented with 10% glycerol and were incubated for 30 min on ice. .. All binding reactions were done in a 10 µl reaction volume using 100 nM BATF proteins-JUNB heterodimers, 150 nM IRF proteins if needed, 1μM of dsDNA library in 1× NEB Cutsmart buffer (50 mM Potassium Acetate; 20 mM Tris–acetate; 10 mM Magnesium Acetate; 100 μg/ml BSA, pH 7.9 @25 °C) supplemented with 10% glycerol and were incubated for 30 min on ice.

Article Title: Global delay in nascent strand DNA methylation
Article Snippet: ESCs were collected, fixed in 75% ethanol and stained with PI. .. Cells were then sorted by cell cycle phase into G1 , early S, mid S, late S and G2 -M phase to obtain 1 cell per well in a 96-well plate containing 5 μl 0.1X CutSmart buffer (New England BioLabs Cat#B7204S) per well (480 cells total).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ph7 9
    Ph7 9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ph7 9/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ph7 9 - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs buffer 2
    Buffer 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/buffer 2/product/New England Biolabs
    Average 99 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    buffer 2 - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    92
    New England Biolabs 1x neb buffer 2
    1x Neb Buffer 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x neb buffer 2/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1x neb buffer 2 - by Bioz Stars, 2019-12
    92/100 stars
      Buy from Supplier

    Image Search Results