pgem t easy vector system kit  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    pGEM T Easy Vector Systems
    Description:
    PCR cloning vectors with 3 options for insert excision
    Catalog Number:
    a1360
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR PCR Cloning
    Buy from Supplier


    Structured Review

    Promega pgem t easy vector system kit
    PCR cloning vectors with 3 options for insert excision
    https://www.bioz.com/result/pgem t easy vector system kit/product/Promega
    Average 90 stars, based on 108 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector system kit - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Expression, purification and functionality of bioactive recombinant human vascular endothelial growth factor VEGF165 in E. coli
    Article Snippet: .. The PCR product mixture obtained after amplification of the MCF7 cDNA was ligated into pGEMT easy vector and cloned in E. coli Top10. ..

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: .. The cloning of MPT83 gene into pGEM-T Easy vector results in recombinant plasmid with the size of 3678 bp. .. Based on the order of amino acid encoding protein in recombinant plasmid, pGEM-T Easy-Mpt83 was subcloned and expressed into E coli BL-21 cell in order to produce protein recombinant using 48 kDa molecules as GST-MPT83 fusion protein.

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: .. To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced. .. The indels of the CXCR4 gene were identified by comparison with the wild-type CXCR4 sequence.

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: The pELMO vector (3306 bp) was constructed for the efficient and reliable cloning of PCR products; it contains two selection systems: the most common ampicillin-resistance marker generally used in basic research groups and the ccdB gene encoding a 101 amino acid toxic protein expressed by the lac promoter. .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Article Title: Natural and induced loss of function mutations in SlMBP21 MADS-box gene led to jointless-2 phenotype in tomato
    Article Snippet: .. Amplified fragment was subsequently cloned into the pGEM-T Easy vector (Promega) and subjected to sequence analysis. ..

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene CsLOB1 promoter in citrus
    Article Snippet: .. The PCR products were cloned into the pGEM® ‐T Easy vector for sequencing. .. The sequence chromatograms were analysed with SnapGene Viewer software.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA). ..

    Amplification:

    Article Title: Expression, purification and functionality of bioactive recombinant human vascular endothelial growth factor VEGF165 in E. coli
    Article Snippet: .. The PCR product mixture obtained after amplification of the MCF7 cDNA was ligated into pGEMT easy vector and cloned in E. coli Top10. ..

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells
    Article Snippet: M-MLV reverse transcriptase (RT), T7 RNA polymerase, GoTaq® DNA polymerase, pGEM®-T Easy vector, RNAsin® inhibitor, RNase-free DNase RQ1, and other molecular biology reagents were purchased from Promega (Madison, WI). .. RNase-free Deoxyribonuclease I (DNase I) Amplification Grade, the pcDNA3.1(+) vector, and oligonucleotides were obtained from Invitrogen (Carlsbad, CA).

    Article Title: Natural and induced loss of function mutations in SlMBP21 MADS-box gene led to jointless-2 phenotype in tomato
    Article Snippet: .. Amplified fragment was subsequently cloned into the pGEM-T Easy vector (Promega) and subjected to sequence analysis. ..

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: The first mutant referent to NMB0065 sequence mutants was the strain M2, this mutant had the NMB0065 sequence from N. meningitidis C2135 amplified using 03.12-3 and 03.12-4 oligonucleotides (Table ). .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: The partial coding sequences of AnrasA and AnrasB were PCR amplified using respective gene-specific primers ( ) from A. nidulans cDNA. .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: Comparing pELMO cloning efficiency with that of a commercial vector Neospora caninum nc5 gene (350 bp) and Plasmodium vivax apical rhoptry neck protein (arnp -597 bp) and rhoptry neck protein 4 gene (ron4 -2.3 kb) PCR amplification products were cloned in pGEM-T Easy (Promega) system and pELMO to compare their cloning efficiency (Table lists the corresponding primers). .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA).

    Construct:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: This latter mechanism allows direct selection of positive recombinants by disrupting lethal genes, as shown in similarly constructed vectors (Bernard ; Gabant et al. ). ccdB expression thus results in the death of cells containing a non-recombinant vector, offering a highly efficient, positive selection system, even being comparable with white/blue selection systems based on the LacZ operon, one of the most used for this purpose (Bernard ; Messing et al. ). .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA). .. The resulting constructs were transformed in E. coli JM109 competent cells (Promega).

    Incubation:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA). .. Clones from each plate were randomly chosen and analysed by colony PCR after 15 h incubation at 37 °C with Np21+/Np6+, PvARNP-D/PvARNP-R and Pvron4intdir/Pvron4intrev primer sets (Table ).

    Activity Assay:

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: We used \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{Indel}}\,(\%)= \left( {1 - \sqrt {1 - {\text{cut}}/{\text{uncut}} + {\text{cut}}} } \right) \times 100\%$$\end{document} Indel ( % ) = 1 - 1 - cut / uncut + cut × 100 % formulas to get the efficiency of cleavage activity. .. To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced.

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    In Silico:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: Paragraph title: In silico analysis and cloning of AnrasA and AnrasB partial genes ... The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing.

    Expressing:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: This latter mechanism allows direct selection of positive recombinants by disrupting lethal genes, as shown in similarly constructed vectors (Bernard ; Gabant et al. ). ccdB expression thus results in the death of cells containing a non-recombinant vector, offering a highly efficient, positive selection system, even being comparable with white/blue selection systems based on the LacZ operon, one of the most used for this purpose (Bernard ; Messing et al. ). .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Transformation Assay:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA). .. This strain lacks the F plasmid which encodes the CCDA protein; this product acts as inhibitor of ccdB function (Van Melderen et al. ). pELMO vector transformation efficiency was ascertained by cloning csp , msp1 and eba -175 PCR products through blunt-end ligation into pELMO.

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: The KAPA HiFi Ready Mix system was used for amplifying inserts, using the following thermal profile: initial denaturation at 95 °C for 5 min, followed by 35 cycles each of 98 °C for 30 s, the corresponding primer’s Tm (Table ) for 20 s, 72 °C for 2 min and a final extension of 72 °C for 5 min. PCR products were ligated into pELMO after purification, as shown before, and transformed into TOP10 chemically competent E. coli cells (Invitrogen). .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA).

    Ligation:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA). .. This strain lacks the F plasmid which encodes the CCDA protein; this product acts as inhibitor of ccdB function (Van Melderen et al. ). pELMO vector transformation efficiency was ascertained by cloning csp , msp1 and eba -175 PCR products through blunt-end ligation into pELMO.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA). ..

    Cell Culture:

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells
    Article Snippet: Waymouth MB752/1 cell culture media, Opti-MEM and LipofectamineTM 2000 were obtained from Gibco-Life Technologies Inc. (Carlsbad, CA). .. M-MLV reverse transcriptase (RT), T7 RNA polymerase, GoTaq® DNA polymerase, pGEM®-T Easy vector, RNAsin® inhibitor, RNase-free DNase RQ1, and other molecular biology reagents were purchased from Promega (Madison, WI).

    DNA Sequencing:

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: Paragraph title: T7 endonuclease 1 (T7E1) cleavage assay and DNA sequencing ... To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Polymerase Chain Reaction:

    Article Title: Expression, purification and functionality of bioactive recombinant human vascular endothelial growth factor VEGF165 in E. coli
    Article Snippet: .. The PCR product mixture obtained after amplification of the MCF7 cDNA was ligated into pGEMT easy vector and cloned in E. coli Top10. ..

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: .. To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced. .. The indels of the CXCR4 gene were identified by comparison with the wild-type CXCR4 sequence.

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: A primer set was designed (ccdBSec-Dir/ccdBSec-Rev) for sequencing plasmid inserts. pELMO digestion with the Sma I enzyme produced a blunt-ended vector; this bypassed the A-tailing reaction step for PCR fragments obtained by high fidelity polymerases. .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: All the mutants obtained by homologous recombination were checked by PCR analysis using a oligonucleotide harboring the target gene and another harboring the cassette. .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene CsLOB1 promoter in citrus
    Article Snippet: .. The PCR products were cloned into the pGEM® ‐T Easy vector for sequencing. .. The sequence chromatograms were analysed with SnapGene Viewer software.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: The KAPA HiFi Ready Mix system was used for amplifying inserts, using the following thermal profile: initial denaturation at 95 °C for 5 min, followed by 35 cycles each of 98 °C for 30 s, the corresponding primer’s Tm (Table ) for 20 s, 72 °C for 2 min and a final extension of 72 °C for 5 min. PCR products were ligated into pELMO after purification, as shown before, and transformed into TOP10 chemically competent E. coli cells (Invitrogen). .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA).

    Recombinant:

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: .. The cloning of MPT83 gene into pGEM-T Easy vector results in recombinant plasmid with the size of 3678 bp. .. Based on the order of amino acid encoding protein in recombinant plasmid, pGEM-T Easy-Mpt83 was subcloned and expressed into E coli BL-21 cell in order to produce protein recombinant using 48 kDa molecules as GST-MPT83 fusion protein.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The white colonies containing recombinant plasmid were selected [ ] for plasmid extraction and PCR screening [ ].

    Cleavage Assay:

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: Paragraph title: T7 endonuclease 1 (T7E1) cleavage assay and DNA sequencing ... To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced.

    Mutagenesis:

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: The first mutant referent to NMB0065 sequence mutants was the strain M2, this mutant had the NMB0065 sequence from N. meningitidis C2135 amplified using 03.12-3 and 03.12-4 oligonucleotides (Table ). .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6.

    Isolation:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: Total RNA was isolated from A. nidulans sub-merged culture using fungal RNA isolation kit (Himedia, India) and cDNA was prepared using Superscript (Invitrogen, USA) according to manufacturer's instructions. .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing.

    Purification:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: The KAPA HiFi Ready Mix system was used for amplifying inserts, using the following thermal profile: initial denaturation at 95 °C for 5 min, followed by 35 cycles each of 98 °C for 30 s, the corresponding primer’s Tm (Table ) for 20 s, 72 °C for 2 min and a final extension of 72 °C for 5 min. PCR products were ligated into pELMO after purification, as shown before, and transformed into TOP10 chemically competent E. coli cells (Invitrogen). .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA).

    Sequencing:

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced. .. The indels of the CXCR4 gene were identified by comparison with the wild-type CXCR4 sequence.

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: A primer set was designed (ccdBSec-Dir/ccdBSec-Rev) for sequencing plasmid inserts. pELMO digestion with the Sma I enzyme produced a blunt-ended vector; this bypassed the A-tailing reaction step for PCR fragments obtained by high fidelity polymerases. .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Article Title: Natural and induced loss of function mutations in SlMBP21 MADS-box gene led to jointless-2 phenotype in tomato
    Article Snippet: .. Amplified fragment was subsequently cloned into the pGEM-T Easy vector (Promega) and subjected to sequence analysis. ..

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: The first mutant referent to NMB0065 sequence mutants was the strain M2, this mutant had the NMB0065 sequence from N. meningitidis C2135 amplified using 03.12-3 and 03.12-4 oligonucleotides (Table ). .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6.

    Article Title: Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene CsLOB1 promoter in citrus
    Article Snippet: .. The PCR products were cloned into the pGEM® ‐T Easy vector for sequencing. .. The sequence chromatograms were analysed with SnapGene Viewer software.

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    Plasmid Preparation:

    Article Title: Expression, purification and functionality of bioactive recombinant human vascular endothelial growth factor VEGF165 in E. coli
    Article Snippet: .. The PCR product mixture obtained after amplification of the MCF7 cDNA was ligated into pGEMT easy vector and cloned in E. coli Top10. ..

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: .. The cloning of MPT83 gene into pGEM-T Easy vector results in recombinant plasmid with the size of 3678 bp. .. Based on the order of amino acid encoding protein in recombinant plasmid, pGEM-T Easy-Mpt83 was subcloned and expressed into E coli BL-21 cell in order to produce protein recombinant using 48 kDa molecules as GST-MPT83 fusion protein.

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: .. To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced. .. The indels of the CXCR4 gene were identified by comparison with the wild-type CXCR4 sequence.

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA). .. The results indicated that pELMO is suitable for cloning in the E. coli TOP10 strain as it does not carry the lacI q repressor, therefore granting constitutive expression of ccdB product without the need for IPTG (isopropyl-β-d -thiogalactopyranoside) induction.

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells
    Article Snippet: .. M-MLV reverse transcriptase (RT), T7 RNA polymerase, GoTaq® DNA polymerase, pGEM®-T Easy vector, RNAsin® inhibitor, RNase-free DNase RQ1, and other molecular biology reagents were purchased from Promega (Madison, WI). .. RNase-free Deoxyribonuclease I (DNase I) Amplification Grade, the pcDNA3.1(+) vector, and oligonucleotides were obtained from Invitrogen (Carlsbad, CA).

    Article Title: Yersinia enterocolitica palearctica serobiotype O:3/4 - a successful group of emerging zoonotic pathogens
    Article Snippet: N-acetyl-galactosamine experiments The 8.4 kbp aga -operon (Y11_11961-Y11_12031) has been subcloned into pGEM-T Easy (Promega) using the following oligonucleotides: JB506 cagcgtcgtacttgatgatttgc and JB507 ATCATCTGTTGGGCGACACG. .. The aga -supplemented serobiotype O:8/1B strain was grown in the presence of carbenicillin (300 μg/ml) to maintain the plasmid, serobiotype O:3/4 and O:8/1B wild type strains were cultivated without antibiotics.

    Article Title: Natural and induced loss of function mutations in SlMBP21 MADS-box gene led to jointless-2 phenotype in tomato
    Article Snippet: .. Amplified fragment was subsequently cloned into the pGEM-T Easy vector (Promega) and subjected to sequence analysis. ..

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene CsLOB1 promoter in citrus
    Article Snippet: .. The PCR products were cloned into the pGEM® ‐T Easy vector for sequencing. .. The sequence chromatograms were analysed with SnapGene Viewer software.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: .. Alternatively, each aforementioned insert was subjected to 3′ end-adenine addition through Taq polymerase (Bioline) for ligation at pGEM-T Easy vector multiple cloning site (Promega, WI, USA). ..

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    Selection:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: This latter mechanism allows direct selection of positive recombinants by disrupting lethal genes, as shown in similarly constructed vectors (Bernard ; Gabant et al. ). ccdB expression thus results in the death of cells containing a non-recombinant vector, offering a highly efficient, positive selection system, even being comparable with white/blue selection systems based on the LacZ operon, one of the most used for this purpose (Bernard ; Messing et al. ). .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Agarose Gel Electrophoresis:

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection
    Article Snippet: The PCR products were digested with T7 endonuclease 1 (NEB) and resolved by 1.5% agarose gel electrophoresis. .. To further analyze CXCR4 gene disruption, the above PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced.

    In Vitro:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: Several positive selection system-based vectors have been considered efficient tools to date for simplifying in vitro DNA recombination procedures (Liu et al. ). .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Produced:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: A primer set was designed (ccdBSec-Dir/ccdBSec-Rev) for sequencing plasmid inserts. pELMO digestion with the Sma I enzyme produced a blunt-ended vector; this bypassed the A-tailing reaction step for PCR fragments obtained by high fidelity polymerases. .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Marker:

    Article Title: pELMO, an optimised in-house cloning vector
    Article Snippet: The pELMO vector (3306 bp) was constructed for the efficient and reliable cloning of PCR products; it contains two selection systems: the most common ampicillin-resistance marker generally used in basic research groups and the ccdB gene encoding a 101 amino acid toxic protein expressed by the lac promoter. .. Such step is essential for plasmids having T-overhangs, like pGEM-T Easy Vector Systems (Promega Corporation MD, USA).

    Homologous Recombination:

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: All the mutants obtained by homologous recombination were checked by PCR analysis using a oligonucleotide harboring the target gene and another harboring the cassette. .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Promega pgem t easy pcr ligation kit
    Pgem T Easy Pcr Ligation Kit, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy pcr ligation kit/product/Promega
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgem t easy pcr ligation kit - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    90
    Promega pgem t easy vector systems
    Pgem T Easy Vector Systems, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 445 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector systems/product/Promega
    Average 90 stars, based on 445 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector systems - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results