pgem t easy vector  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pGEM T Easy Vector Systems
    Description:
    PCR cloning vectors with 3 options for insert excision
    Catalog Number:
    a1360
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR PCR Cloning
    Buy from Supplier


    Structured Review

    Promega pgem t easy vector
    Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of <t>vlhA</t> promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of <t>pGEM-T</t> Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.
    PCR cloning vectors with 3 options for insert excision
    https://www.bioz.com/result/pgem t easy vector/product/Promega
    Average 99 stars, based on 6915 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics"

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0194528

    Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of vlhA promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of pGEM-T Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.
    Figure Legend Snippet: Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of vlhA promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of pGEM-T Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.

    Techniques Used: Plasmid Preparation, Binding Assay, Overlap Extension Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Molecular Weight, Marker, Clone Assay

    2) Product Images from "Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans"

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075443

    Strategies for generation of dsRNAs and d-siRNAs. (A) PCR template strategy was utilized for obtaining s GFP , An rasA and An ras B dsRNA in a single T7 transcription reaction. T7 promoter sequence was added to both forward and reverse gene specific primers of s GFP , An rasA and An rasB , and then PCR amplification was performed in order to generate templates for dsRNA synthesis. (B) For generation of template DNA for unrelated MiAchE , PCR amplification was performed on pGEM T- MiAchE vector using M13 primers. This amplification includes the T7 promoter to one end and SP6 promoter to another end of MiAchE . (C) PCR templates for transcription of respective target genes. M. ladder; B. blank; s GFP , An rasA , An rasB and MiAchE target gene templates. (D) Synthesis of dsRNAs with T7 or SP6 in vitro transcription reactions. M. Ladder; s GFP , An rasA , An rasB and MiAchE dsRNAs. (E) 20% PAGE analysis of purified diced siRNAs. M-Ladder, s GFP , An rasA , An rasB and MiAchE d-siRNAs. The d-siRNAs of all target genes were generated by cleaving respective dsRNAs with RNase III at 37°C for 30 mins, followed by subsequent purifications and finally dissolved in nuclease free water.
    Figure Legend Snippet: Strategies for generation of dsRNAs and d-siRNAs. (A) PCR template strategy was utilized for obtaining s GFP , An rasA and An ras B dsRNA in a single T7 transcription reaction. T7 promoter sequence was added to both forward and reverse gene specific primers of s GFP , An rasA and An rasB , and then PCR amplification was performed in order to generate templates for dsRNA synthesis. (B) For generation of template DNA for unrelated MiAchE , PCR amplification was performed on pGEM T- MiAchE vector using M13 primers. This amplification includes the T7 promoter to one end and SP6 promoter to another end of MiAchE . (C) PCR templates for transcription of respective target genes. M. ladder; B. blank; s GFP , An rasA , An rasB and MiAchE target gene templates. (D) Synthesis of dsRNAs with T7 or SP6 in vitro transcription reactions. M. Ladder; s GFP , An rasA , An rasB and MiAchE dsRNAs. (E) 20% PAGE analysis of purified diced siRNAs. M-Ladder, s GFP , An rasA , An rasB and MiAchE d-siRNAs. The d-siRNAs of all target genes were generated by cleaving respective dsRNAs with RNase III at 37°C for 30 mins, followed by subsequent purifications and finally dissolved in nuclease free water.

    Techniques Used: Polymerase Chain Reaction, Sequencing, Amplification, Plasmid Preparation, In Vitro, Polyacrylamide Gel Electrophoresis, Purification, Generated

    3) Product Images from "Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum"

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum

    Journal: Enzyme Research

    doi: 10.4061/2011/970983

    Cloning of Li-P4 nuclease gene in pGEM-t vector. Lane 1: undigested recombinant plasmid, Lane 2: Eco RI-digested recombinant plasmid, Lane 3: 1 kb DNA ladder.
    Figure Legend Snippet: Cloning of Li-P4 nuclease gene in pGEM-t vector. Lane 1: undigested recombinant plasmid, Lane 2: Eco RI-digested recombinant plasmid, Lane 3: 1 kb DNA ladder.

    Techniques Used: Clone Assay, Plasmid Preparation, Recombinant

    4) Product Images from "The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction"

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction

    Journal: Journal of Medical Genetics

    doi: 10.1136/jmg.2007.049635

    Figure 1 Sequence analysis of exon 6 of IFNGR1 . (A) The genomic DNA of IFNGR1 exon 6 from the patient was amplified by PCR, and the sequence was analysed by direct sequencing. The PCR product was cloned into the pGEM‐T Easy vector. Sequencing
    Figure Legend Snippet: Figure 1 Sequence analysis of exon 6 of IFNGR1 . (A) The genomic DNA of IFNGR1 exon 6 from the patient was amplified by PCR, and the sequence was analysed by direct sequencing. The PCR product was cloned into the pGEM‐T Easy vector. Sequencing

    Techniques Used: Sequencing, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation

    5) Product Images from "Natural and induced loss of function mutations in SlMBP21 MADS-box gene led to jointless-2 phenotype in tomato"

    Article Title: Natural and induced loss of function mutations in SlMBP21 MADS-box gene led to jointless-2 phenotype in tomato

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-04556-1

    Mutations found in the j-2 mutants (LA0315 and LA3899). (a ) Insertion of a Transposable Element ( Rider ) in LA3899 and base substitution introducing a stop codon in LA0315. ( b ) Size of the fragments (5460- and 587-bp) amplified between the first exon and the first intron in j-2 (LA3899) and WT genomic DNA (compared to 1 kb DNA Ladder). The largest band was extracted and cloned in the pGEM-T Easy vector for sequencing. ( c ) Sequencing results of WT and j-2 (LA0315) PCR products amplifying the second exon of the gene.
    Figure Legend Snippet: Mutations found in the j-2 mutants (LA0315 and LA3899). (a ) Insertion of a Transposable Element ( Rider ) in LA3899 and base substitution introducing a stop codon in LA0315. ( b ) Size of the fragments (5460- and 587-bp) amplified between the first exon and the first intron in j-2 (LA3899) and WT genomic DNA (compared to 1 kb DNA Ladder). The largest band was extracted and cloned in the pGEM-T Easy vector for sequencing. ( c ) Sequencing results of WT and j-2 (LA0315) PCR products amplifying the second exon of the gene.

    Techniques Used: Amplification, Clone Assay, Plasmid Preparation, Sequencing, Polymerase Chain Reaction

    6) Product Images from "A novel Sugarcane bacilliform virus promoter confers gene expression preferentially in the vascular bundle and storage parenchyma of the sugarcane culm"

    Article Title: A novel Sugarcane bacilliform virus promoter confers gene expression preferentially in the vascular bundle and storage parenchyma of the sugarcane culm

    Journal: Biotechnology for Biofuels

    doi: 10.1186/s13068-017-0850-9

    Transient EYFP gene expression as directed by SCBV21 and its deletions in sugarcane. a Schematic map of full-length SCBV21 [1816 base pair (bp)] and its deletions. Nucleotide (nt) 1 is the first nt at the 5′ end of SCBV21 . Deletions are indicated by dotted lines and their nt position of each deletion is indicated above the dotted line . The region between SCBV21 and EYFP , marked with an asterisk (*) in deletion A, is derived from the multicloning site of pGEM T-Easy vector and is removed from all deletion fragments. In deletions C and D, the guanine base (G) at nt 1816 was deleted during cloning. Three important restriction enzyme sites, Xho I, Stu I, and Nco I used for deletions are marked in deletion A. The two potential promoter regions (PPR1 and PPR2) of SCBV21, which are 632 bp apart from each other, are shown with unfilled square boxes . The approximate position of primers used to generate deletions is indicated with filled arrowheads . b , c Monitoring of transient EYFP expression as directed by SCBV21 and its deletions in sugarcane young leaf segments. Representative images were collected with a stereomicroscope (Olympus SZX7, Olympus) fitted with YFPHQ filters (excitation of 490–500 nm and emission of 515–560 nm) and a DP71 digital camera (Olympus) (×15 magnification) for 48 h post-DNA bombardment ( scale bar 2.0 mm). EYFP expression levels were scored as high (+++), medium (++), low (+), and none (−), based on the EYFP focus count and EYFP expression level (mean gray value × pixels)
    Figure Legend Snippet: Transient EYFP gene expression as directed by SCBV21 and its deletions in sugarcane. a Schematic map of full-length SCBV21 [1816 base pair (bp)] and its deletions. Nucleotide (nt) 1 is the first nt at the 5′ end of SCBV21 . Deletions are indicated by dotted lines and their nt position of each deletion is indicated above the dotted line . The region between SCBV21 and EYFP , marked with an asterisk (*) in deletion A, is derived from the multicloning site of pGEM T-Easy vector and is removed from all deletion fragments. In deletions C and D, the guanine base (G) at nt 1816 was deleted during cloning. Three important restriction enzyme sites, Xho I, Stu I, and Nco I used for deletions are marked in deletion A. The two potential promoter regions (PPR1 and PPR2) of SCBV21, which are 632 bp apart from each other, are shown with unfilled square boxes . The approximate position of primers used to generate deletions is indicated with filled arrowheads . b , c Monitoring of transient EYFP expression as directed by SCBV21 and its deletions in sugarcane young leaf segments. Representative images were collected with a stereomicroscope (Olympus SZX7, Olympus) fitted with YFPHQ filters (excitation of 490–500 nm and emission of 515–560 nm) and a DP71 digital camera (Olympus) (×15 magnification) for 48 h post-DNA bombardment ( scale bar 2.0 mm). EYFP expression levels were scored as high (+++), medium (++), low (+), and none (−), based on the EYFP focus count and EYFP expression level (mean gray value × pixels)

    Techniques Used: Expressing, Derivative Assay, Plasmid Preparation, Clone Assay

    7) Product Images from "Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells"

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0022822

    Star natural antisense transcript screening in MA-10 cells. Total RNA was extracted from MA-10 cells and treated with DNase I. 5′ RACE was performed using three different sets of three sequence-specific primers for RT, PCR, and nested PCR. Following agarose gel electrophoresis, bands were eluted, and cloned into the pGEM®-T Easy vector for sequencing. The results were analyzed by BLAST and Vector NTITM Suite 8 software. A . Upper panel. Schematic diagram showing the relative location of the three groups of primers (G1, G2, and G3) used. Lower panels. Representative images of the nested PCR products generated by amplification with each primer group (lane 2). Lane 1 shows the DNA molecular weight ladder. Arrows indicate the apparent sizes (in base pairs, or bp) of the eluted bands. B . Schematic diagram showing the representative sequences of the resultant products. Sizes are indicated in bp. Complementarity and relative location of these sequences with the Star transcript sequence is indicated.
    Figure Legend Snippet: Star natural antisense transcript screening in MA-10 cells. Total RNA was extracted from MA-10 cells and treated with DNase I. 5′ RACE was performed using three different sets of three sequence-specific primers for RT, PCR, and nested PCR. Following agarose gel electrophoresis, bands were eluted, and cloned into the pGEM®-T Easy vector for sequencing. The results were analyzed by BLAST and Vector NTITM Suite 8 software. A . Upper panel. Schematic diagram showing the relative location of the three groups of primers (G1, G2, and G3) used. Lower panels. Representative images of the nested PCR products generated by amplification with each primer group (lane 2). Lane 1 shows the DNA molecular weight ladder. Arrows indicate the apparent sizes (in base pairs, or bp) of the eluted bands. B . Schematic diagram showing the representative sequences of the resultant products. Sizes are indicated in bp. Complementarity and relative location of these sequences with the Star transcript sequence is indicated.

    Techniques Used: Sequencing, Reverse Transcription Polymerase Chain Reaction, Nested PCR, Agarose Gel Electrophoresis, Clone Assay, Plasmid Preparation, Software, Generated, Amplification, Molecular Weight

    Star NAT 3′ end characterization. A . Total RNA was isolated from MA-10 cells and treated with DNase I. 3′ RACE was performed using two sequence-specific primers for PCR and nested PCR amplifications. Following agarose gel electrophoresis, bands were eluted, and cloned into the pGEM®-T Easy vector for sequencing. The results were analyzed by BLAST and Vector NTITM Suite 8 software. Left panel. Schematic diagram showing the relative location of the sequence-specific primers used. Right panel. Representative image of the nested PCR product generated. MW, DNA molecular weight ladder: -RT, no reverse transcriptase RT-PCR control. Arrows indicate the apparent sizes in bp. B . Total RNA extracted from MA-10 cells was treated with DNase or RNase prior to sequence-specific reverse transcription, followed by PCR/nested PCR and sequencing. Upper panel. Schematic diagram showing the RT primer (Rv.RT), PCR primers (Fw.1 and Rv.1), and nested PCR primers (Fw.2 and Rv.2) used in these experiments. A schematic representation of the full Star NAT sequence obtained after sequencing the PCR product is shown. Lower panel. Representative image of the RT-nested PCR product. +R, RNase-treated RNA control; -RT, no reverse transcriptase RT-PCR control; -p, RT reaction in the absence of primer; pi, RT reaction in the presence of a non-specific primer; MW, DNA molecular weight ladder. Arrows indicate apparent sizes in bp.
    Figure Legend Snippet: Star NAT 3′ end characterization. A . Total RNA was isolated from MA-10 cells and treated with DNase I. 3′ RACE was performed using two sequence-specific primers for PCR and nested PCR amplifications. Following agarose gel electrophoresis, bands were eluted, and cloned into the pGEM®-T Easy vector for sequencing. The results were analyzed by BLAST and Vector NTITM Suite 8 software. Left panel. Schematic diagram showing the relative location of the sequence-specific primers used. Right panel. Representative image of the nested PCR product generated. MW, DNA molecular weight ladder: -RT, no reverse transcriptase RT-PCR control. Arrows indicate the apparent sizes in bp. B . Total RNA extracted from MA-10 cells was treated with DNase or RNase prior to sequence-specific reverse transcription, followed by PCR/nested PCR and sequencing. Upper panel. Schematic diagram showing the RT primer (Rv.RT), PCR primers (Fw.1 and Rv.1), and nested PCR primers (Fw.2 and Rv.2) used in these experiments. A schematic representation of the full Star NAT sequence obtained after sequencing the PCR product is shown. Lower panel. Representative image of the RT-nested PCR product. +R, RNase-treated RNA control; -RT, no reverse transcriptase RT-PCR control; -p, RT reaction in the absence of primer; pi, RT reaction in the presence of a non-specific primer; MW, DNA molecular weight ladder. Arrows indicate apparent sizes in bp.

    Techniques Used: Isolation, Sequencing, Polymerase Chain Reaction, Nested PCR, Agarose Gel Electrophoresis, Clone Assay, Plasmid Preparation, Software, Generated, Molecular Weight, Reverse Transcription Polymerase Chain Reaction

    8) Product Images from "Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene CsLOB1 promoter in citrus"

    Article Title: Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene CsLOB1 promoter in citrus

    Journal: Plant Biotechnology Journal

    doi: 10.1111/pbi.12733

    Expression characteristics of Cs LOB 1 in Wanjincheng orange ( Citrus sinensis Osbeck) mutants. (a) Expression of Cs LOB 1 in mutant plants after Xanthomonas citri subsp. citri ( Xcc ) inoculation. At 1 day postinoculation (dpi), Cs LOB 1 transcripts in leaves were analysed by quantitative real‐time PCR ( qPCR ). (b) Time course of Cs LOB 1 expression in mutants after Xcc inoculation. Transcript levels of Cs LOB 1 in leaves were determined by qPCR at 1, 3, 5, 7 and 9 dpi. (c) Statistical analysis of transcripts of Cs LOB 1 G and Cs LOB 1 − in citrus mutants. At 5 dpi, Cs LOB 1 cDNA from infected leaves was amplified by PCR , cloned into the pGEM ® ‐T Easy vector and sequenced. Twenty clones per mutant line were sequenced. Frequency (%) indicates the percentage of each Cs LOB 1 mRNA out of the total mRNA s tested. Relative expression level of Cs LOB 1 was determined by comparing the Cs LOB 1 transcript levels after Xcc inoculation with that after water inoculation. Error bars (a and b) indicate standard deviation of three independent tests.
    Figure Legend Snippet: Expression characteristics of Cs LOB 1 in Wanjincheng orange ( Citrus sinensis Osbeck) mutants. (a) Expression of Cs LOB 1 in mutant plants after Xanthomonas citri subsp. citri ( Xcc ) inoculation. At 1 day postinoculation (dpi), Cs LOB 1 transcripts in leaves were analysed by quantitative real‐time PCR ( qPCR ). (b) Time course of Cs LOB 1 expression in mutants after Xcc inoculation. Transcript levels of Cs LOB 1 in leaves were determined by qPCR at 1, 3, 5, 7 and 9 dpi. (c) Statistical analysis of transcripts of Cs LOB 1 G and Cs LOB 1 − in citrus mutants. At 5 dpi, Cs LOB 1 cDNA from infected leaves was amplified by PCR , cloned into the pGEM ® ‐T Easy vector and sequenced. Twenty clones per mutant line were sequenced. Frequency (%) indicates the percentage of each Cs LOB 1 mRNA out of the total mRNA s tested. Relative expression level of Cs LOB 1 was determined by comparing the Cs LOB 1 transcript levels after Xcc inoculation with that after water inoculation. Error bars (a and b) indicate standard deviation of three independent tests.

    Techniques Used: Expressing, Mutagenesis, Real-time Polymerase Chain Reaction, Infection, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Standard Deviation

    9) Product Images from "Expression of ?-Expansins Is Correlated with Internodal Elongation in Deepwater Rice 1"

    Article Title: Expression of ?-Expansins Is Correlated with Internodal Elongation in Deepwater Rice 1

    Journal: Plant Physiology

    doi:

    DNA gel- and dot-blot analyses showing the specificity of the gene-specific probes. A, Genomic DNA was digested with Eco RI (E), Xba I (X), Hin dIII (H), Sac I (S), Eco RI and Xba I (E + X), or with Hin dIII and Sac I (H + S). The digested DNA was separated by gel electrophoresis, blotted onto Hybond-N+ membrane, and hybridized under the same conditions as described for RNA gel-blot analysis, using the gene-specific probes indicated under each blot. B, Gene-specific DNA fragments cloned in the pGEM-T Easy vector were digested with Eco RI or Not I and purified by gel electrophoresis. The inserts were blotted onto Hybond-N+ membrane and hybridized under the same conditions as employed for RNA gel-blot analysis, using the gene-specific probes indicated at left.
    Figure Legend Snippet: DNA gel- and dot-blot analyses showing the specificity of the gene-specific probes. A, Genomic DNA was digested with Eco RI (E), Xba I (X), Hin dIII (H), Sac I (S), Eco RI and Xba I (E + X), or with Hin dIII and Sac I (H + S). The digested DNA was separated by gel electrophoresis, blotted onto Hybond-N+ membrane, and hybridized under the same conditions as described for RNA gel-blot analysis, using the gene-specific probes indicated under each blot. B, Gene-specific DNA fragments cloned in the pGEM-T Easy vector were digested with Eco RI or Not I and purified by gel electrophoresis. The inserts were blotted onto Hybond-N+ membrane and hybridized under the same conditions as employed for RNA gel-blot analysis, using the gene-specific probes indicated at left.

    Techniques Used: Dot Blot, Nucleic Acid Electrophoresis, Western Blot, Clone Assay, Plasmid Preparation, Purification

    10) Product Images from "Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study"

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study

    Journal: Journal of Genetic Engineering & Biotechnology

    doi: 10.1016/j.jgeb.2018.04.001

    Electrophoresis result of recombinant plasmid pGEM-T Easy-Mpt83 (P1-P6).
    Figure Legend Snippet: Electrophoresis result of recombinant plasmid pGEM-T Easy-Mpt83 (P1-P6).

    Techniques Used: Electrophoresis, Recombinant, Plasmid Preparation

    E. coli growth pattern in LB-Amp plus IPTG and X-Gal Plate containing pGEM-T Easy-Mpt83 recombinant plasmid.
    Figure Legend Snippet: E. coli growth pattern in LB-Amp plus IPTG and X-Gal Plate containing pGEM-T Easy-Mpt83 recombinant plasmid.

    Techniques Used: Recombinant, Plasmid Preparation

    11) Product Images from "Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection"

    Article Title: Genome modification of CXCR4 by Staphylococcus aureus Cas9 renders cells resistance to HIV-1 infection

    Journal: Retrovirology

    doi: 10.1186/s12977-017-0375-0

    CXCR4 gene silencing by lentivirus mediated CRISPR/SaCas9 delivery protects GHOST-X4 cells from HIV-1 infection. a A schematic diagram of lentiviral transfer vectors containing CRISPR/SaCas9 components. LentiCRISPR v2 plasmid was modified by replacing the SpCas9 with SaCas9. Then, based on the SaCas9 PAM sequence 5′-NNGRRT-3′, we designed, synthesized and cloned the CXCR4 sgRNAs into the vector using the Bsmb1 . b CXCR4 gene disruption analysis in GHOST-X4 cells by the T7E1 cleavage assay. GHOST-X4 cells were transduced with lentiviruses (MOI of 40) in the presence of polybrene for 12 h, and the genomic DNA was extracted and used as template to amplify a CXCR4 fragment (1100 bp). Con: lentiviral vectors expressing SaCas9 only, #8 and #9: lentiviral vectors expressing SaCas9/sgRNA #8 and #9. c Flow cytometry analysis of CXCR4 expression in lentivirus transduced GHOST-X4 cells. Neg, unstained cells. Con, #8 and #9 as samples described in ( b ) stained with anti-CXCR4-PE. d DNA sequences of CXCR4 of the transduced GHOST-X4 cells. PCR products were cloned into pGEM-T Easy vector and sequenced. The PAM sequences are lined and highlighted in red; the target sequences were shown in blue; deletions are indicated with (−) and insertions with (+). N/N indicates ratio of WT or mutations to total sequenced clones. e Flow cytometry analysis of transduced GHOST-X4 cells on GFP expression 3 days post HIV-1 NL4-3 infection. Neg, no HIV-1 infection. f HIV-1 NL4-3 infection was determined by p24 level. The cultured supernatants were collected at the indicated days post infection, and HIV-1 p24 level was determined using a p24 ELISA kit. For ( c and e ), one representative out of three independent experiments is shown. For ( f ), the graph represents 3 independent infection experiments and error bars represent SEM. Statistical analysis determined using unpaired t-test (*** P
    Figure Legend Snippet: CXCR4 gene silencing by lentivirus mediated CRISPR/SaCas9 delivery protects GHOST-X4 cells from HIV-1 infection. a A schematic diagram of lentiviral transfer vectors containing CRISPR/SaCas9 components. LentiCRISPR v2 plasmid was modified by replacing the SpCas9 with SaCas9. Then, based on the SaCas9 PAM sequence 5′-NNGRRT-3′, we designed, synthesized and cloned the CXCR4 sgRNAs into the vector using the Bsmb1 . b CXCR4 gene disruption analysis in GHOST-X4 cells by the T7E1 cleavage assay. GHOST-X4 cells were transduced with lentiviruses (MOI of 40) in the presence of polybrene for 12 h, and the genomic DNA was extracted and used as template to amplify a CXCR4 fragment (1100 bp). Con: lentiviral vectors expressing SaCas9 only, #8 and #9: lentiviral vectors expressing SaCas9/sgRNA #8 and #9. c Flow cytometry analysis of CXCR4 expression in lentivirus transduced GHOST-X4 cells. Neg, unstained cells. Con, #8 and #9 as samples described in ( b ) stained with anti-CXCR4-PE. d DNA sequences of CXCR4 of the transduced GHOST-X4 cells. PCR products were cloned into pGEM-T Easy vector and sequenced. The PAM sequences are lined and highlighted in red; the target sequences were shown in blue; deletions are indicated with (−) and insertions with (+). N/N indicates ratio of WT or mutations to total sequenced clones. e Flow cytometry analysis of transduced GHOST-X4 cells on GFP expression 3 days post HIV-1 NL4-3 infection. Neg, no HIV-1 infection. f HIV-1 NL4-3 infection was determined by p24 level. The cultured supernatants were collected at the indicated days post infection, and HIV-1 p24 level was determined using a p24 ELISA kit. For ( c and e ), one representative out of three independent experiments is shown. For ( f ), the graph represents 3 independent infection experiments and error bars represent SEM. Statistical analysis determined using unpaired t-test (*** P

    Techniques Used: CRISPR, Infection, Plasmid Preparation, Modification, Sequencing, Synthesized, Clone Assay, Cleavage Assay, Transduction, Expressing, Flow Cytometry, Cytometry, Staining, Polymerase Chain Reaction, Cell Culture, Enzyme-linked Immunosorbent Assay

    12) Product Images from "A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield"

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield

    Journal: Iranian Biomedical Journal

    doi: 10.6091/ibj.1165.2014

    Agarose gel electrophoresis for detection of amplified DNA bands. A) Purification of amplified ctx B fragment from agarose gel. Lane 1, ctxB gene amplified w i th PCR from Vibrio cho l erae and purified from agarose gel and lane 2, 100 bp DNA marker. B) Digested pGEM-T- ctx B plasmid with Eco RI restriction enzyme. Lane 1, 1 kb DNA size marker; lane 2, undigested pGEM-T containing ct x B fragment and lane 3, digested pGEM-T- ctx B plasmid with Eco RI restriction enzyme. C) pGEM-T- ctx B plasmid. Lane 1, 1 kb DNA size marker; lane 2, undigested pGEM-T- ctx B; lane 3, digested pGEM-T- ctx B with Xho I; lane 4, double digested pGEM-T- ctx B with Xho I and Bsp HI, single 390 bp band corresponded to ctx B gene and lane 5, 100 bp DNA marker.
    Figure Legend Snippet: Agarose gel electrophoresis for detection of amplified DNA bands. A) Purification of amplified ctx B fragment from agarose gel. Lane 1, ctxB gene amplified w i th PCR from Vibrio cho l erae and purified from agarose gel and lane 2, 100 bp DNA marker. B) Digested pGEM-T- ctx B plasmid with Eco RI restriction enzyme. Lane 1, 1 kb DNA size marker; lane 2, undigested pGEM-T containing ct x B fragment and lane 3, digested pGEM-T- ctx B plasmid with Eco RI restriction enzyme. C) pGEM-T- ctx B plasmid. Lane 1, 1 kb DNA size marker; lane 2, undigested pGEM-T- ctx B; lane 3, digested pGEM-T- ctx B with Xho I; lane 4, double digested pGEM-T- ctx B with Xho I and Bsp HI, single 390 bp band corresponded to ctx B gene and lane 5, 100 bp DNA marker.

    Techniques Used: Agarose Gel Electrophoresis, Amplification, Purification, Polymerase Chain Reaction, Marker, Plasmid Preparation

    13) Product Images from "Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data"

    Article Title: Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1361

    In vitro transcription analysis of upstream deleted Alu loci. In vitro transcription reactions were performed in HeLa nuclear extract using 0.5 μg of the indicated Alu templates (lanes 5–10, 15–20, 25–30). A previously characterized Alu producing a 372-nt RNA (lanes 2, 12, 22) and a human tRNA Val gene producing a known transcript pattern due to heterogeneous transcription termination (lanes 3, 13, 23) ( 25 ) were used as positive controls for in vitro transcription and, at the same time, as a source of RNA size markers. Negative control reactions contained either empty pGEM®-T Easy vector (lanes 1, 11, 21) or no template DNA (no-template control (NTC), lanes 4, 14, 24). For each Alu , both the wild-type and a mutant version lacking most of the native 5′-flanking region ( 5 ′ del ) were tested. For each of the nine Alu s subjected to 5′-flank deletion, the extent of reduction of transcription activity, observed with respect to the corresponding wild-type Alu , is reported below the lanes corresponding to each wt-mutant pair. The values represent the average of two independent transcription experiments that differed by no more than 20% of the mean.
    Figure Legend Snippet: In vitro transcription analysis of upstream deleted Alu loci. In vitro transcription reactions were performed in HeLa nuclear extract using 0.5 μg of the indicated Alu templates (lanes 5–10, 15–20, 25–30). A previously characterized Alu producing a 372-nt RNA (lanes 2, 12, 22) and a human tRNA Val gene producing a known transcript pattern due to heterogeneous transcription termination (lanes 3, 13, 23) ( 25 ) were used as positive controls for in vitro transcription and, at the same time, as a source of RNA size markers. Negative control reactions contained either empty pGEM®-T Easy vector (lanes 1, 11, 21) or no template DNA (no-template control (NTC), lanes 4, 14, 24). For each Alu , both the wild-type and a mutant version lacking most of the native 5′-flanking region ( 5 ′ del ) were tested. For each of the nine Alu s subjected to 5′-flank deletion, the extent of reduction of transcription activity, observed with respect to the corresponding wild-type Alu , is reported below the lanes corresponding to each wt-mutant pair. The values represent the average of two independent transcription experiments that differed by no more than 20% of the mean.

    Techniques Used: In Vitro, Negative Control, Plasmid Preparation, Mutagenesis, Activity Assay

    In vitro transcription analysis of wild type and B box-mutated Alu loci. In vitro transcription reactions were performed in HeLa nuclear extract using 0.5 μg of the indicated. Alu templates (lanes 5–10, 15–20, 25–30). A previously characterized Alu producing a 372-nt RNA (lanes 2, 12, 22) and a human tRNA Val gene producing a known transcript pattern due to heterogeneous transcription termination (lanes 3, 13, 23) ( 25 ) were used as positive controls for in vitro transcription and, at the same time, as a source of RNA size markers. Negative control reactions contained either empty pGEM®-T Easy vector (lanes 1, 11, 21) or no template DNA (no-template control (NTC), lanes 4, 14, 24). For each Alu , both the wild-type and a B box-mutated ( Bmut ) version were tested.
    Figure Legend Snippet: In vitro transcription analysis of wild type and B box-mutated Alu loci. In vitro transcription reactions were performed in HeLa nuclear extract using 0.5 μg of the indicated. Alu templates (lanes 5–10, 15–20, 25–30). A previously characterized Alu producing a 372-nt RNA (lanes 2, 12, 22) and a human tRNA Val gene producing a known transcript pattern due to heterogeneous transcription termination (lanes 3, 13, 23) ( 25 ) were used as positive controls for in vitro transcription and, at the same time, as a source of RNA size markers. Negative control reactions contained either empty pGEM®-T Easy vector (lanes 1, 11, 21) or no template DNA (no-template control (NTC), lanes 4, 14, 24). For each Alu , both the wild-type and a B box-mutated ( Bmut ) version were tested.

    Techniques Used: In Vitro, Negative Control, Plasmid Preparation

    14) Product Images from "Cloning, purification, and functional characterization of Carocin S2, a ribonuclease bacteriocin produced by Pectobacterium carotovorum"

    Article Title: Cloning, purification, and functional characterization of Carocin S2, a ribonuclease bacteriocin produced by Pectobacterium carotovorum

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-11-99

    Recovery and immunity activity of carocin S2 . (A) Antibacterial activity of carocin S2 from different strains. The indicator was Pcc strain SP33. Strain number: 1, F-rif-18; 2, TF1-2; 3, TF1-2/pMS2KI; 4, DH5α/pMS2KI; 5, DH5α. (B) Assay for caroS2I . The colony and inoculated strains were F-rif-18. The indicator strains were: 1, SP33; 2, SP33/pGEM-T easy; 3, SP33/pGS2I.
    Figure Legend Snippet: Recovery and immunity activity of carocin S2 . (A) Antibacterial activity of carocin S2 from different strains. The indicator was Pcc strain SP33. Strain number: 1, F-rif-18; 2, TF1-2; 3, TF1-2/pMS2KI; 4, DH5α/pMS2KI; 5, DH5α. (B) Assay for caroS2I . The colony and inoculated strains were F-rif-18. The indicator strains were: 1, SP33; 2, SP33/pGEM-T easy; 3, SP33/pGS2I.

    Techniques Used: Activity Assay, Periodic Counter-current Chromatography

    15) Product Images from "A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3′end using CRISPR-Cas9 genome editing technique"

    Article Title: A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3′end using CRISPR-Cas9 genome editing technique

    Journal: Scientific Reports

    doi: 10.1038/srep45883

    293T- SNCA -3′NL cells having the NanoLuc integration can be used to model deregulated SNCA as seen in sporadic PD. ( a ) 293T- SNCA -3′NL cells treated with 10 μM 5-AzadC for 72 hours which induced a significant increase in the NanoLuc activity as compared to the control. The NanoLuc activity was corroborated by increase in α-SYN transcript as shown in the RT-PCR. ( b ) Methylation status of 23 CpG sites on the SNCA intron1 was determined by bisulfite sequencing. Amplified PCR products were cloned into pGEM-T Easy vector and 10 clones were sequenced. (Left) Comparison of vehicle and 5-AzadC treatment (10 μM, 72 hours) showing unmethylated (open circles) and methylated (closed circles) cytosines for all 10 clones (y-axis) at each of the 23 CpGs in intron1 (x-axis). (Right) Scatter plot showing overall decrease in methylation by 31.7% compared to the control. ( c ) Similarly, 293T- SNCA -3′NL cells treated with dopamine at 100 μM concentration for 48 hours, increased NanoLuc activity significantly. Increase in the NanoLuc activity was confirmed by RT-PCR after dopamine treatment. ( d ) Following HDAC inhibitor (sodium butyrate) treatment at concentrations of 2.5 mM and 5.0 mM for 24 hours, the 293T- SNCA -3′NL cells showed a significant dose dependent increase in the NanoLuc activity. This dose-dependent increase in the NanoLuc activity was also confirmed by RT-PCR following same treatment paradigm. β-actin amplification was used as an internal control for all the PCRs. Error bars show the mean from three technical repeats. p values are given for t-test (5-AzadC, dopamine), one-way ANOVA (Sodium butyrate) where *represents p
    Figure Legend Snippet: 293T- SNCA -3′NL cells having the NanoLuc integration can be used to model deregulated SNCA as seen in sporadic PD. ( a ) 293T- SNCA -3′NL cells treated with 10 μM 5-AzadC for 72 hours which induced a significant increase in the NanoLuc activity as compared to the control. The NanoLuc activity was corroborated by increase in α-SYN transcript as shown in the RT-PCR. ( b ) Methylation status of 23 CpG sites on the SNCA intron1 was determined by bisulfite sequencing. Amplified PCR products were cloned into pGEM-T Easy vector and 10 clones were sequenced. (Left) Comparison of vehicle and 5-AzadC treatment (10 μM, 72 hours) showing unmethylated (open circles) and methylated (closed circles) cytosines for all 10 clones (y-axis) at each of the 23 CpGs in intron1 (x-axis). (Right) Scatter plot showing overall decrease in methylation by 31.7% compared to the control. ( c ) Similarly, 293T- SNCA -3′NL cells treated with dopamine at 100 μM concentration for 48 hours, increased NanoLuc activity significantly. Increase in the NanoLuc activity was confirmed by RT-PCR after dopamine treatment. ( d ) Following HDAC inhibitor (sodium butyrate) treatment at concentrations of 2.5 mM and 5.0 mM for 24 hours, the 293T- SNCA -3′NL cells showed a significant dose dependent increase in the NanoLuc activity. This dose-dependent increase in the NanoLuc activity was also confirmed by RT-PCR following same treatment paradigm. β-actin amplification was used as an internal control for all the PCRs. Error bars show the mean from three technical repeats. p values are given for t-test (5-AzadC, dopamine), one-way ANOVA (Sodium butyrate) where *represents p

    Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Methylation, Methylation Sequencing, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Concentration Assay

    16) Product Images from "Producing Recombinant mTEX101; a Murine Testis Specific Protein"

    Article Title: Producing Recombinant mTEX101; a Murine Testis Specific Protein

    Journal: Journal of Reproduction & Infertility

    doi:

    Double digestion of pGEM-T easy vector containing mTEX101 fragment with EcoRI and NotI restriction enzymes. 1: digested vector with mTEX101 750 bp insert cut out of the vector, 2: DNA ladder VIII.
    Figure Legend Snippet: Double digestion of pGEM-T easy vector containing mTEX101 fragment with EcoRI and NotI restriction enzymes. 1: digested vector with mTEX101 750 bp insert cut out of the vector, 2: DNA ladder VIII.

    Techniques Used: Plasmid Preparation

    Coloy PCR on transformed JM109 clones by pGEM-T Easy vector carrying mTEX101 gene. 1-5: 5 selected white colonies, 6: negative control (blue colony), 7: positive control (PCR product on testis cDNA), 8: DNA ladder VIII (Roche).
    Figure Legend Snippet: Coloy PCR on transformed JM109 clones by pGEM-T Easy vector carrying mTEX101 gene. 1-5: 5 selected white colonies, 6: negative control (blue colony), 7: positive control (PCR product on testis cDNA), 8: DNA ladder VIII (Roche).

    Techniques Used: Polymerase Chain Reaction, Transformation Assay, Clone Assay, Plasmid Preparation, Negative Control, Positive Control

    17) Product Images from "Producing Recombinant mTEX101; a Murine Testis Specific Protein"

    Article Title: Producing Recombinant mTEX101; a Murine Testis Specific Protein

    Journal: Journal of Reproduction & Infertility

    doi:

    Double digestion of pGEM-T easy vector containing mTEX101 fragment with EcoRI and NotI restriction enzymes. 1: digested vector with mTEX101 750 bp insert cut out of the vector, 2: DNA ladder VIII.
    Figure Legend Snippet: Double digestion of pGEM-T easy vector containing mTEX101 fragment with EcoRI and NotI restriction enzymes. 1: digested vector with mTEX101 750 bp insert cut out of the vector, 2: DNA ladder VIII.

    Techniques Used: Plasmid Preparation

    Coloy PCR on transformed JM109 clones by pGEM-T Easy vector carrying mTEX101 gene. 1-5: 5 selected white colonies, 6: negative control (blue colony), 7: positive control (PCR product on testis cDNA), 8: DNA ladder VIII (Roche).
    Figure Legend Snippet: Coloy PCR on transformed JM109 clones by pGEM-T Easy vector carrying mTEX101 gene. 1-5: 5 selected white colonies, 6: negative control (blue colony), 7: positive control (PCR product on testis cDNA), 8: DNA ladder VIII (Roche).

    Techniques Used: Polymerase Chain Reaction, Transformation Assay, Clone Assay, Plasmid Preparation, Negative Control, Positive Control

    18) Product Images from "The construction and characterization of a novel adenovirus vector of artificial microRNA targeting EGFR"

    Article Title: The construction and characterization of a novel adenovirus vector of artificial microRNA targeting EGFR

    Journal: International Journal of Clinical and Experimental Pathology

    doi:

    Macrorestriction map of pGEM-T Easy-EGFRamiR. 1.1 kb Plus DNA Marker; 2. Restriction map of pGEM-T Easy-EGFRamiR by BamH I/BglII.
    Figure Legend Snippet: Macrorestriction map of pGEM-T Easy-EGFRamiR. 1.1 kb Plus DNA Marker; 2. Restriction map of pGEM-T Easy-EGFRamiR by BamH I/BglII.

    Techniques Used: Marker

    19) Product Images from "Gene Disruption through Homologous Recombination in Spiroplasma citri: an scm1-Disrupted Motility Mutant Is Pathogenic"

    Article Title: Gene Disruption through Homologous Recombination in Spiroplasma citri: an scm1-Disrupted Motility Mutant Is Pathogenic

    Journal: Journal of Bacteriology

    doi:

    Schematic representation of pCJ32 integration by recombination at the oriC region. Regions ori 1 and ori 2 represent sequences of the oriC fragment upstream (ori 1) and downstream (ori 2) of the Bgl ). Δ scm1 , 0.9-kbp internal fragment of the scm1 gene obtained by PCR with primer pair CJ6-CJ17; tetM , tetracycline resistance gene of Tn 916 . The black regions represent pGEM-T Easy vector sequences flanking the scm1 gene fragment. Bg, Bgl II; E, Eco RI; P, Pst I; wt. DNA, wild-type DNA. The maps are not to scale. The size of pCJ32 is 11.55 kbp. (A) Integration into the ori 1 region; (B) integration into the ori 2 region.
    Figure Legend Snippet: Schematic representation of pCJ32 integration by recombination at the oriC region. Regions ori 1 and ori 2 represent sequences of the oriC fragment upstream (ori 1) and downstream (ori 2) of the Bgl ). Δ scm1 , 0.9-kbp internal fragment of the scm1 gene obtained by PCR with primer pair CJ6-CJ17; tetM , tetracycline resistance gene of Tn 916 . The black regions represent pGEM-T Easy vector sequences flanking the scm1 gene fragment. Bg, Bgl II; E, Eco RI; P, Pst I; wt. DNA, wild-type DNA. The maps are not to scale. The size of pCJ32 is 11.55 kbp. (A) Integration into the ori 1 region; (B) integration into the ori 2 region.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation

    20) Product Images from "A Novel Mutation in the HSD17B10 Gene of a 10-Year-Old Boy with Refractory Epilepsy, Choreoathetosis and Learning Disability"

    Article Title: A Novel Mutation in the HSD17B10 Gene of a 10-Year-Old Boy with Refractory Epilepsy, Choreoathetosis and Learning Disability

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027348

    Detection of the c.194T > C variant in the HSD17B10 gene by RFLP analysis. The pGEM-T Easy vectors harboring the HSD17B10 gene cloned from genomic DNA of a normal control [ C1–3 ] (lanes 1–3), the patient's sister [ S1–6 ] (lanes 4–9), the patient [ P1–3 ] (lanes10–12), and the patient's mother [ M1–6 ] (lanes 13–18) were digested by BstE II and then separated on a 1% agarose gel. Amounts of DNA loaded were 1 mg on lanes 1 and 2, 0.75 mg on lanes 3 and 6, and 0.5 mg on all the other lanes. A 2.2 kb fragment (indicated by an arrowhead) results from an allele carrying this variant. For a wild-type allele, this fragment is chopped into two shorter fragments (1.3 kb and 0.9 kb) as indicated by arrows. The vector is in the largest band indicated by an empty arrowhead.
    Figure Legend Snippet: Detection of the c.194T > C variant in the HSD17B10 gene by RFLP analysis. The pGEM-T Easy vectors harboring the HSD17B10 gene cloned from genomic DNA of a normal control [ C1–3 ] (lanes 1–3), the patient's sister [ S1–6 ] (lanes 4–9), the patient [ P1–3 ] (lanes10–12), and the patient's mother [ M1–6 ] (lanes 13–18) were digested by BstE II and then separated on a 1% agarose gel. Amounts of DNA loaded were 1 mg on lanes 1 and 2, 0.75 mg on lanes 3 and 6, and 0.5 mg on all the other lanes. A 2.2 kb fragment (indicated by an arrowhead) results from an allele carrying this variant. For a wild-type allele, this fragment is chopped into two shorter fragments (1.3 kb and 0.9 kb) as indicated by arrows. The vector is in the largest band indicated by an empty arrowhead.

    Techniques Used: Variant Assay, Clone Assay, Agarose Gel Electrophoresis, Plasmid Preparation

    21) Product Images from "Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans"

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075443

    Strategies for generation of dsRNAs and d-siRNAs. (A) PCR template strategy was utilized for obtaining s GFP , An rasA and An ras B dsRNA in a single T7 transcription reaction. T7 promoter sequence was added to both forward and reverse gene specific primers of s GFP , An rasA and An rasB , and then PCR amplification was performed in order to generate templates for dsRNA synthesis. (B) For generation of template DNA for unrelated MiAchE , PCR amplification was performed on pGEM T- MiAchE vector using M13 primers. This amplification includes the T7 promoter to one end and SP6 promoter to another end of MiAchE . (C) PCR templates for transcription of respective target genes. M. ladder; B. blank; s GFP , An rasA , An rasB and MiAchE target gene templates. (D) Synthesis of dsRNAs with T7 or SP6 in vitro transcription reactions. M. Ladder; s GFP , An rasA , An rasB and MiAchE dsRNAs. (E) 20% PAGE analysis of purified diced siRNAs. M-Ladder, s GFP , An rasA , An rasB and MiAchE d-siRNAs. The d-siRNAs of all target genes were generated by cleaving respective dsRNAs with RNase III at 37°C for 30 mins, followed by subsequent purifications and finally dissolved in nuclease free water.
    Figure Legend Snippet: Strategies for generation of dsRNAs and d-siRNAs. (A) PCR template strategy was utilized for obtaining s GFP , An rasA and An ras B dsRNA in a single T7 transcription reaction. T7 promoter sequence was added to both forward and reverse gene specific primers of s GFP , An rasA and An rasB , and then PCR amplification was performed in order to generate templates for dsRNA synthesis. (B) For generation of template DNA for unrelated MiAchE , PCR amplification was performed on pGEM T- MiAchE vector using M13 primers. This amplification includes the T7 promoter to one end and SP6 promoter to another end of MiAchE . (C) PCR templates for transcription of respective target genes. M. ladder; B. blank; s GFP , An rasA , An rasB and MiAchE target gene templates. (D) Synthesis of dsRNAs with T7 or SP6 in vitro transcription reactions. M. Ladder; s GFP , An rasA , An rasB and MiAchE dsRNAs. (E) 20% PAGE analysis of purified diced siRNAs. M-Ladder, s GFP , An rasA , An rasB and MiAchE d-siRNAs. The d-siRNAs of all target genes were generated by cleaving respective dsRNAs with RNase III at 37°C for 30 mins, followed by subsequent purifications and finally dissolved in nuclease free water.

    Techniques Used: Polymerase Chain Reaction, Sequencing, Amplification, Plasmid Preparation, In Vitro, Polyacrylamide Gel Electrophoresis, Purification, Generated

    22) Product Images from "Whole-genome expression analysis of mammalian-wide interspersed repeat elements in human cell lines"

    Article Title: Whole-genome expression analysis of mammalian-wide interspersed repeat elements in human cell lines

    Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

    doi: 10.1093/dnares/dsw048

    In vitro transcription for selected expression-positive MIRs. In vitro transcription reactions were performed in HeLa nuclear extract using 0.5 μg of the indicated MIR templates (lanes 4–9, 13–18). A previously characterized Alu producing a 355-nt RNA (lanes 2, 11) and a human tRNA Val gene producing a known transcript pattern due to heterogeneous transcription termination (lanes 3, 12) 19 were used as positive controls for in vitro transcription and, at the same time, as a source of RNA size markers. Negative control reactions contained empty pGEM®-T Easy vector (lanes 1, 10). For each MIR, both the wild type, B box-mutated ( Bmut ) and 5′-flanking region ( 5′ del ) version were tested. Indicated by arrows on the gel image are the migration positions (with lengths) of bands corresponding to the expected transcripts in Table 3 .
    Figure Legend Snippet: In vitro transcription for selected expression-positive MIRs. In vitro transcription reactions were performed in HeLa nuclear extract using 0.5 μg of the indicated MIR templates (lanes 4–9, 13–18). A previously characterized Alu producing a 355-nt RNA (lanes 2, 11) and a human tRNA Val gene producing a known transcript pattern due to heterogeneous transcription termination (lanes 3, 12) 19 were used as positive controls for in vitro transcription and, at the same time, as a source of RNA size markers. Negative control reactions contained empty pGEM®-T Easy vector (lanes 1, 10). For each MIR, both the wild type, B box-mutated ( Bmut ) and 5′-flanking region ( 5′ del ) version were tested. Indicated by arrows on the gel image are the migration positions (with lengths) of bands corresponding to the expected transcripts in Table 3 .

    Techniques Used: In Vitro, Expressing, Negative Control, Plasmid Preparation, Migration

    23) Product Images from "A novel assay to detect calreticulin mutations in myeloproliferative neoplasms"

    Article Title: A novel assay to detect calreticulin mutations in myeloproliferative neoplasms

    Journal: Oncotarget

    doi: 10.18632/oncotarget.14113

    Detection analysis by PNA directed PCR clamping of CALR type-1 (DEL) and type-2 (INS) mutations ( A ) Step I: cDNA amplification of patients with CALR wild-type (WT), type-1 (DEL) and type-2 (INS) mutations. pGEM-T- CALR wild-type (WT), pGEM-T- CALR type-1 mut (DEL), pGEM-T- CALR type-1 mut 50% vs. wild-type (DEL 50%) and pGEM- CALR type-2 mut (INS) were used as PCR positive control. 5 μL of each amplifier were loaded on 1% Agarose-TBE 1x gel with 5 μg/mL ethidium bromide (EtBr) and run at 120 V for 30 minutes. ( B ) Step II: PCR amplification of a small area of CALR gene, containing type-1 and type-2 mutations, was carried-out in absence (−) or in presence (+) of PNA probe. The plasmids amplified in the step I were used, in a dilution of 1:100, in the step II in order to interpret the results, 10 μL of each amplifier were loaded on 2% Agarose-TBE 1x gel with 5μg/mL EtBr and run at 100 V for 30 minutes and than at 65 V for 15 minutes. The arrow indicates the non-specific band present in the amplified of patients.
    Figure Legend Snippet: Detection analysis by PNA directed PCR clamping of CALR type-1 (DEL) and type-2 (INS) mutations ( A ) Step I: cDNA amplification of patients with CALR wild-type (WT), type-1 (DEL) and type-2 (INS) mutations. pGEM-T- CALR wild-type (WT), pGEM-T- CALR type-1 mut (DEL), pGEM-T- CALR type-1 mut 50% vs. wild-type (DEL 50%) and pGEM- CALR type-2 mut (INS) were used as PCR positive control. 5 μL of each amplifier were loaded on 1% Agarose-TBE 1x gel with 5 μg/mL ethidium bromide (EtBr) and run at 120 V for 30 minutes. ( B ) Step II: PCR amplification of a small area of CALR gene, containing type-1 and type-2 mutations, was carried-out in absence (−) or in presence (+) of PNA probe. The plasmids amplified in the step I were used, in a dilution of 1:100, in the step II in order to interpret the results, 10 μL of each amplifier were loaded on 2% Agarose-TBE 1x gel with 5μg/mL EtBr and run at 100 V for 30 minutes and than at 65 V for 15 minutes. The arrow indicates the non-specific band present in the amplified of patients.

    Techniques Used: Polymerase Chain Reaction, Amplification, Positive Control

    24) Product Images from "Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics"

    Article Title: Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics

    Journal: Memórias do Instituto Oswaldo Cruz

    doi: 10.1590/0074-02760160380

    : strategy to MS2-like and MS2-modified hepatitis C virus (MS2-mHCV) internal control (IC) construction. MS2 genome was inserted in the pGEM-T Easy plasmid. After the digestion with Not I, it was removed from the pGEM-T Easy and ligated into pET-47b(+) generating pET-47b(+)-MS2. The mHCV sequence was inserted into the pET-47b(+)-MS2 in the MS2 replicase gene at the Bam HI site, generating pET-47b(+)-MS2-mHCV. The constructed expression vectors pET-47b(+)-MS2 and pET-47b(+)-MS2-mHCV transformed in BL21(DE3)pLysS were used to produce MS2-like and MS2-mHCV IC, respectively, represented as MS2 particles.
    Figure Legend Snippet: : strategy to MS2-like and MS2-modified hepatitis C virus (MS2-mHCV) internal control (IC) construction. MS2 genome was inserted in the pGEM-T Easy plasmid. After the digestion with Not I, it was removed from the pGEM-T Easy and ligated into pET-47b(+) generating pET-47b(+)-MS2. The mHCV sequence was inserted into the pET-47b(+)-MS2 in the MS2 replicase gene at the Bam HI site, generating pET-47b(+)-MS2-mHCV. The constructed expression vectors pET-47b(+)-MS2 and pET-47b(+)-MS2-mHCV transformed in BL21(DE3)pLysS were used to produce MS2-like and MS2-mHCV IC, respectively, represented as MS2 particles.

    Techniques Used: Modification, Plasmid Preparation, Positron Emission Tomography, Sequencing, Construct, Expressing, Transformation Assay

    25) Product Images from "Molecular Cloning and Characterization of the srdBCA Operon, Encoding the Respiratory Selenate Reductase Complex, from the Selenate-Reducing Bacterium Bacillus selenatarsenatis SF-1 ▿ SF-1 ▿ †"

    Article Title: Molecular Cloning and Characterization of the srdBCA Operon, Encoding the Respiratory Selenate Reductase Complex, from the Selenate-Reducing Bacterium Bacillus selenatarsenatis SF-1 ▿ SF-1 ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01197-10

    Genetic map of pGEMsrdBCA. The srdBCA operon with its own promoter region was inserted into the pGEM-T Easy vector under the direction of the lac promoter. Annealing sites of primers used for the construction of derivative vectors are indicated: a, SRDCF;
    Figure Legend Snippet: Genetic map of pGEMsrdBCA. The srdBCA operon with its own promoter region was inserted into the pGEM-T Easy vector under the direction of the lac promoter. Annealing sites of primers used for the construction of derivative vectors are indicated: a, SRDCF;

    Techniques Used: Plasmid Preparation

    26) Product Images from "Involvement of TORC2, a CREB co-activator, in the in vivo-specific transcriptional control of HTLV-1"

    Article Title: Involvement of TORC2, a CREB co-activator, in the in vivo-specific transcriptional control of HTLV-1

    Journal: Retrovirology

    doi: 10.1186/1742-4690-6-73

    CpG methylation of the enhancer/promoter region of provirus DNA in EL4-Gax cells . Top: locations of CpG sites (#1–11) in the HTLV-1 U3 region studied in this experiment. The sense primer is complementary to the mouse genomic sequence flanking the 5'-LTR of provirus at the integration site, and the anti-sense primer is complementary to the junction sequence between the HTLV-1 and MLV U3 regions. The three 21 -bp enhancer sequences are indicated as boxes. Bottom: results of bisulfite genomic sequencing analysis of four independent experiments. Methylated and unmethylated CpG sites are expressed as filled and open rectangles, respectively. Amplified PCR products were subcloned into pGEM-T vector, and the nucleotide sequences of at least 13 clones were determined. GFP mfi: the GFP mean fluorescent intensity of EL4-Gax cells used for bisulfite genomic sequencing analysis.
    Figure Legend Snippet: CpG methylation of the enhancer/promoter region of provirus DNA in EL4-Gax cells . Top: locations of CpG sites (#1–11) in the HTLV-1 U3 region studied in this experiment. The sense primer is complementary to the mouse genomic sequence flanking the 5'-LTR of provirus at the integration site, and the anti-sense primer is complementary to the junction sequence between the HTLV-1 and MLV U3 regions. The three 21 -bp enhancer sequences are indicated as boxes. Bottom: results of bisulfite genomic sequencing analysis of four independent experiments. Methylated and unmethylated CpG sites are expressed as filled and open rectangles, respectively. Amplified PCR products were subcloned into pGEM-T vector, and the nucleotide sequences of at least 13 clones were determined. GFP mfi: the GFP mean fluorescent intensity of EL4-Gax cells used for bisulfite genomic sequencing analysis.

    Techniques Used: CpG Methylation Assay, Sequencing, Genomic Sequencing, Methylation, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay

    27) Product Images from "Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study"

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study

    Journal: Journal of Genetic Engineering & Biotechnology

    doi: 10.1016/j.jgeb.2018.04.001

    Electrophoresis result of recombinant plasmid pGEM-T Easy-Mpt83 (P1-P6).
    Figure Legend Snippet: Electrophoresis result of recombinant plasmid pGEM-T Easy-Mpt83 (P1-P6).

    Techniques Used: Electrophoresis, Recombinant, Plasmid Preparation

    E. coli growth pattern in LB-Amp plus IPTG and X-Gal Plate containing pGEM-T Easy-Mpt83 recombinant plasmid.
    Figure Legend Snippet: E. coli growth pattern in LB-Amp plus IPTG and X-Gal Plate containing pGEM-T Easy-Mpt83 recombinant plasmid.

    Techniques Used: Recombinant, Plasmid Preparation

    28) Product Images from "Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference"

    Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0073834

    Targeting the SnJHER 472 bp part after bacterial administration of dsJHER 472 . A. Confirmation of dsJHER 472 synthesis in IPTG induced HT115 bacteria. Agarose gel electrophoresis of RNA extracted from IPTG induced HT115/L4440 (1) and HT115/pGEM T-easy-JHER loop (2) bacteria followed by RNase-A treatment in high salinity buffer. B. Semiquantitative RT-PCR analysis of JHER gene in randomly selected pools of 10 insects recovered from a continuous feeding assay (1 st →5 h instar d0) with the HT115 bacteria (1, 2), 6 and 15 days post recovery (PR). C. Semiquantitative RT-PCR analysis of JHER , EcR , Hsp70 and Hsc70 in randomly selected pools of 10 insects from a continuous feeding assay (5 th →6 th instar) with the HT115 bacteria (1, 2), 7 days post feeding. As reference gene it was used the Sesamia ’s b-tubulin gene.
    Figure Legend Snippet: Targeting the SnJHER 472 bp part after bacterial administration of dsJHER 472 . A. Confirmation of dsJHER 472 synthesis in IPTG induced HT115 bacteria. Agarose gel electrophoresis of RNA extracted from IPTG induced HT115/L4440 (1) and HT115/pGEM T-easy-JHER loop (2) bacteria followed by RNase-A treatment in high salinity buffer. B. Semiquantitative RT-PCR analysis of JHER gene in randomly selected pools of 10 insects recovered from a continuous feeding assay (1 st →5 h instar d0) with the HT115 bacteria (1, 2), 6 and 15 days post recovery (PR). C. Semiquantitative RT-PCR analysis of JHER , EcR , Hsp70 and Hsc70 in randomly selected pools of 10 insects from a continuous feeding assay (5 th →6 th instar) with the HT115 bacteria (1, 2), 7 days post feeding. As reference gene it was used the Sesamia ’s b-tubulin gene.

    Techniques Used: Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Feeding Assay

    29) Product Images from "Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference"

    Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0073834

    Targeting the SnJHER 472 bp part after bacterial administration of dsJHER 472 . A. Confirmation of dsJHER 472 synthesis in IPTG induced HT115 bacteria. Agarose gel electrophoresis of RNA extracted from IPTG induced HT115/L4440 (1) and HT115/pGEM T-easy-JHER loop (2) bacteria followed by RNase-A treatment in high salinity buffer. B. Semiquantitative RT-PCR analysis of JHER gene in randomly selected pools of 10 insects recovered from a continuous feeding assay (1 st →5 h instar d0) with the HT115 bacteria (1, 2), 6 and 15 days post recovery (PR). C. Semiquantitative RT-PCR analysis of JHER , EcR , Hsp70 and Hsc70 in randomly selected pools of 10 insects from a continuous feeding assay (5 th →6 th instar) with the HT115 bacteria (1, 2), 7 days post feeding. As reference gene it was used the Sesamia ’s b-tubulin gene.
    Figure Legend Snippet: Targeting the SnJHER 472 bp part after bacterial administration of dsJHER 472 . A. Confirmation of dsJHER 472 synthesis in IPTG induced HT115 bacteria. Agarose gel electrophoresis of RNA extracted from IPTG induced HT115/L4440 (1) and HT115/pGEM T-easy-JHER loop (2) bacteria followed by RNase-A treatment in high salinity buffer. B. Semiquantitative RT-PCR analysis of JHER gene in randomly selected pools of 10 insects recovered from a continuous feeding assay (1 st →5 h instar d0) with the HT115 bacteria (1, 2), 6 and 15 days post recovery (PR). C. Semiquantitative RT-PCR analysis of JHER , EcR , Hsp70 and Hsc70 in randomly selected pools of 10 insects from a continuous feeding assay (5 th →6 th instar) with the HT115 bacteria (1, 2), 7 days post feeding. As reference gene it was used the Sesamia ’s b-tubulin gene.

    Techniques Used: Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Feeding Assay

    30) Product Images from "A New In Vitro Strand Transfer Assay for Monitoring Bacterial Class 1 Integron Recombinase IntI1 Activity"

    Article Title: A New In Vitro Strand Transfer Assay for Monitoring Bacterial Class 1 Integron Recombinase IntI1 Activity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0001315

    Effect of cations (A), salt (B) and detergent (C) on in vitro recombination catalyzed by IntI1. Recombination reactions were performed in the presence of 2 pmoles purified IntI1, 0.1 pmoles free attI1 * and 0.1 pmoles pGEM-T- attI1 and different concentrations of MgCl 2 , MnCl 2 NaCl and detergent as indicated. Recombination products were quantified with DNAJ software and are shown on the graphs as the percentage of recombinant product versus the total substrate.
    Figure Legend Snippet: Effect of cations (A), salt (B) and detergent (C) on in vitro recombination catalyzed by IntI1. Recombination reactions were performed in the presence of 2 pmoles purified IntI1, 0.1 pmoles free attI1 * and 0.1 pmoles pGEM-T- attI1 and different concentrations of MgCl 2 , MnCl 2 NaCl and detergent as indicated. Recombination products were quantified with DNAJ software and are shown on the graphs as the percentage of recombinant product versus the total substrate.

    Techniques Used: In Vitro, Purification, Software, Recombinant

    In vitro recombination catalyzed by IntI1 at attI1 and attC sites. Reactions were performed for 90 min in the presence of purified IntI1 (5 or 10 pmoles), 0.1 to 0.2 pmoles of either pGEM-T- attI1 or pGEM-T- attC (p attI1 and p attC in the figure) and 0.1 pmoles free 5′ 32 P radiolabeled recombination sites under standard conditions described in materials and methods . Products were loaded on 1% agarose gel and autoradiographied (A). F: free recombination sites, RP: recombination products. The recombination products were quantified and the percentage of recombination versus the amount of IntI in pmoles was plotted (B).
    Figure Legend Snippet: In vitro recombination catalyzed by IntI1 at attI1 and attC sites. Reactions were performed for 90 min in the presence of purified IntI1 (5 or 10 pmoles), 0.1 to 0.2 pmoles of either pGEM-T- attI1 or pGEM-T- attC (p attI1 and p attC in the figure) and 0.1 pmoles free 5′ 32 P radiolabeled recombination sites under standard conditions described in materials and methods . Products were loaded on 1% agarose gel and autoradiographied (A). F: free recombination sites, RP: recombination products. The recombination products were quantified and the percentage of recombination versus the amount of IntI in pmoles was plotted (B).

    Techniques Used: In Vitro, Purification, Agarose Gel Electrophoresis

    In vitro recombination catalyzed by wild type, R146E and R286K mutated IntI1. Reactions were performed for 90 min in the presence of purified enzyme (5 pmoles), 0.1 pmoles of linear radiolabeled recombination sites attI1 or attC and 0.1 pmoles of pGEM-T- attI1 under standard conditions described in materials and methods section. Products were loaded on 1% agarose gel and autoradiographied. F: free recombination sites, RP: recombination products.
    Figure Legend Snippet: In vitro recombination catalyzed by wild type, R146E and R286K mutated IntI1. Reactions were performed for 90 min in the presence of purified enzyme (5 pmoles), 0.1 pmoles of linear radiolabeled recombination sites attI1 or attC and 0.1 pmoles of pGEM-T- attI1 under standard conditions described in materials and methods section. Products were loaded on 1% agarose gel and autoradiographied. F: free recombination sites, RP: recombination products.

    Techniques Used: In Vitro, Purification, Agarose Gel Electrophoresis

    In vitro recombination catalyzed by wild type IntI1 in presence of double- or single-stranded substrates. Reactions were performed for 90 min in the presence of purified enzyme (5 pmoles), 0.1 pmoles of linear radiolabeled double-stranded (ds) or single-stranded (bottom strand: ss bot, or top strand: ss top) recombination sites attI1 or attC and 0.1 pmoles of pGEM-T- attI1 or pGEM-T- attC under standard conditions described in materials and methods section. Products were loaded on 1% agarose gel and autoradiographied. F: free recombination sites, RP: recombination products.
    Figure Legend Snippet: In vitro recombination catalyzed by wild type IntI1 in presence of double- or single-stranded substrates. Reactions were performed for 90 min in the presence of purified enzyme (5 pmoles), 0.1 pmoles of linear radiolabeled double-stranded (ds) or single-stranded (bottom strand: ss bot, or top strand: ss top) recombination sites attI1 or attC and 0.1 pmoles of pGEM-T- attI1 or pGEM-T- attC under standard conditions described in materials and methods section. Products were loaded on 1% agarose gel and autoradiographied. F: free recombination sites, RP: recombination products.

    Techniques Used: In Vitro, Purification, Agarose Gel Electrophoresis

    31) Product Images from "Human Enterovirus in the Gastrocnemius of Patients With Peripheral Arterial Disease"

    Article Title: Human Enterovirus in the Gastrocnemius of Patients With Peripheral Arterial Disease

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    doi: 10.1161/JAHA.113.000082

    HEV RNA is present in muscle biopsies of PAD gastrocnemius. Total RNA from muscle homogenates of 9 controls and 10 PAD patients comprising those with disease Stage II (samples 2, 5, 7, and 9), Stage III (samples 1, 4, and 10) and Stage IV (samples 3, 6, and 8) were analyzed by RT‐PCR (T7 RNA polymerase) for HEV RNA (positive‐strand genomic RNA) (A). All controls had no detectable HEV RNA (left panel) while 8 of the 10 PAD specimens were positive for HEV RNA (right panel). RNAs of the 10 PAD patients also were analyzed by RT‐PCR (SP6 RNA polymerase) for negative‐strand viral RNA (indicating viral replication) (B). All PAD specimens that were positive for HEV RNA (specimens 1, 3, 4, 6 to 10) had detectable negative‐strand RNA and those PAD specimens negative for HEV RNA (2 and 5) had no detectable negative‐strand RNA. For a control, T7 RNA polymerase‐transcribed positive‐strand HEV RNA (P) and SP6 RNA polymerase‐transcribed negative‐strand viral RNA (SP6) were synthesized from a linearized pGEM‐T harboring CVB1EV1/2 fragment (data not shown). A 100 bp ladder is seen in lane “M”. GAPDH was used as an internal housekeeping gene. Solid arrows indicate 200 bp DNA and dashed arrows indicate negative‐strand viral RNA. (C), HEV RNA detection primers, EV1, EV2 and EVU2 are shown. The EV1/EV2 primer pair was used for detection of positive‐strand HEV RNA (193 bp). The EV1/EVU2 primer pair was used for detection of negative‐strand viral RNA (150 bp). HEV indicates human enterovirus; PAD, peripheral arterial disease; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; RT‐PCR, reverse‐transcription polymerase chain reaction; VP1, viral capsid protein.
    Figure Legend Snippet: HEV RNA is present in muscle biopsies of PAD gastrocnemius. Total RNA from muscle homogenates of 9 controls and 10 PAD patients comprising those with disease Stage II (samples 2, 5, 7, and 9), Stage III (samples 1, 4, and 10) and Stage IV (samples 3, 6, and 8) were analyzed by RT‐PCR (T7 RNA polymerase) for HEV RNA (positive‐strand genomic RNA) (A). All controls had no detectable HEV RNA (left panel) while 8 of the 10 PAD specimens were positive for HEV RNA (right panel). RNAs of the 10 PAD patients also were analyzed by RT‐PCR (SP6 RNA polymerase) for negative‐strand viral RNA (indicating viral replication) (B). All PAD specimens that were positive for HEV RNA (specimens 1, 3, 4, 6 to 10) had detectable negative‐strand RNA and those PAD specimens negative for HEV RNA (2 and 5) had no detectable negative‐strand RNA. For a control, T7 RNA polymerase‐transcribed positive‐strand HEV RNA (P) and SP6 RNA polymerase‐transcribed negative‐strand viral RNA (SP6) were synthesized from a linearized pGEM‐T harboring CVB1EV1/2 fragment (data not shown). A 100 bp ladder is seen in lane “M”. GAPDH was used as an internal housekeeping gene. Solid arrows indicate 200 bp DNA and dashed arrows indicate negative‐strand viral RNA. (C), HEV RNA detection primers, EV1, EV2 and EVU2 are shown. The EV1/EV2 primer pair was used for detection of positive‐strand HEV RNA (193 bp). The EV1/EVU2 primer pair was used for detection of negative‐strand viral RNA (150 bp). HEV indicates human enterovirus; PAD, peripheral arterial disease; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; RT‐PCR, reverse‐transcription polymerase chain reaction; VP1, viral capsid protein.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Synthesized, RNA Detection

    32) Product Images from "Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung"

    Article Title: Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-15-23

    Validation of a qPCR system for the analysis of mouse tissues. The analyzed cDNAs were the following: (A) , BRP-39; (B) , Ym1; (C) , Ym2; (D) , Chit1; (E) , AMCase; (F) , GAPDH; (G) , β-actin; and (H) , pepsinogen C. Standard curves were obtained using the mouse Refs/CLPs standard DNA with pGEM-T Easy containing the eight mouse cDNA fragments (red closed circles). In addition, the quantification of the mouse entire coding cDNA was performed using the primer pairs for each gene. The target cDNA was amplified from a dilution of the entire coding cDNA with a known concentration and subsequently analyzed as an unknown sample (blue closed rhombuses). Equal quantities were obtained for each tested dilution of the standard curve and entire coding cDNA. Data are expressed as mean ± standard deviation (SD) of three measurements.
    Figure Legend Snippet: Validation of a qPCR system for the analysis of mouse tissues. The analyzed cDNAs were the following: (A) , BRP-39; (B) , Ym1; (C) , Ym2; (D) , Chit1; (E) , AMCase; (F) , GAPDH; (G) , β-actin; and (H) , pepsinogen C. Standard curves were obtained using the mouse Refs/CLPs standard DNA with pGEM-T Easy containing the eight mouse cDNA fragments (red closed circles). In addition, the quantification of the mouse entire coding cDNA was performed using the primer pairs for each gene. The target cDNA was amplified from a dilution of the entire coding cDNA with a known concentration and subsequently analyzed as an unknown sample (blue closed rhombuses). Equal quantities were obtained for each tested dilution of the standard curve and entire coding cDNA. Data are expressed as mean ± standard deviation (SD) of three measurements.

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Concentration Assay, Standard Deviation

    Preparation and validation of the mouse Refs/CLPs standard DNA with pGEM-T Easy. (A) Schematic representation of the mouse Refs/CLPs standard DNA cloning into pGEM-T Easy vector. (B) The mouse Refs/CLPs standard DNA with pGEM-T Easy was PCR-amplified from the plasmid DNA using the BRP-39 forward (blue arrow) and Ym1 reverse (red arrow) primers. As described above, we amplified the Ym1 and Ym2 cDNAs from this standard DNA using the Ym1 (C) and Ym2 (D) primers and these PCR products were analyzed using 10% polyacrylamide gel electrophoresis (E) . The y axis was expressed as first derivative of the fluorescence as a function of temperature (C and D) .
    Figure Legend Snippet: Preparation and validation of the mouse Refs/CLPs standard DNA with pGEM-T Easy. (A) Schematic representation of the mouse Refs/CLPs standard DNA cloning into pGEM-T Easy vector. (B) The mouse Refs/CLPs standard DNA with pGEM-T Easy was PCR-amplified from the plasmid DNA using the BRP-39 forward (blue arrow) and Ym1 reverse (red arrow) primers. As described above, we amplified the Ym1 and Ym2 cDNAs from this standard DNA using the Ym1 (C) and Ym2 (D) primers and these PCR products were analyzed using 10% polyacrylamide gel electrophoresis (E) . The y axis was expressed as first derivative of the fluorescence as a function of temperature (C and D) .

    Techniques Used: Clone Assay, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Polyacrylamide Gel Electrophoresis, Fluorescence

    BRP-39, Ym1 and Ym2 mRNA expression in mouse tissues. Quantification of BRP-39 (A) , Ym1 (B) and Ym2 (C) mRNAs in mouse tissues. The expression levels of the CLPs were quantified by real-time PCR using the standard DNA containing the eight mouse genes (the mouse Refs/CLPs standard DNA with pGEM-T Easy). The y axis was expressed as molecules per 10 ng of total RNA. The upper panel indicates the actual value, and the lower panel shows each value on logarithmic scale. Data are presented as mean ± SD of three measurements.
    Figure Legend Snippet: BRP-39, Ym1 and Ym2 mRNA expression in mouse tissues. Quantification of BRP-39 (A) , Ym1 (B) and Ym2 (C) mRNAs in mouse tissues. The expression levels of the CLPs were quantified by real-time PCR using the standard DNA containing the eight mouse genes (the mouse Refs/CLPs standard DNA with pGEM-T Easy). The y axis was expressed as molecules per 10 ng of total RNA. The upper panel indicates the actual value, and the lower panel shows each value on logarithmic scale. Data are presented as mean ± SD of three measurements.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Construction and validation of the mouse Refs/CLPs standard DNA. (A) Schematic representation of the mouse Refs/CLPs standard DNA used for qPCR analysis. We ligated the standard DNAs of the CLPs and the reference genes (Refs) DNA [ 40 , 41 ] using EcoRI restriction sites and the resulting fragment was then cloned into the pGEM-T Easy vector. The linearized standard DNA was amplified from the plasmid DNA. To examine whether the standard DNA gave one melting temperature, we amplified the mouse Refs/CLPs standard DNA using the Ym1 (B) and Ym2 (C) primers. (D) The Ym1 and Ym2 PCR products were evaluated using 10% polyacrylamide gel analysis. (E) Multiple products were amplified from the mouse Refs/CLPs standard DNA using the Ym2 primers. Pink arrows indicate Ym2 primers. Lines indicate the putative amplified DNA products.
    Figure Legend Snippet: Construction and validation of the mouse Refs/CLPs standard DNA. (A) Schematic representation of the mouse Refs/CLPs standard DNA used for qPCR analysis. We ligated the standard DNAs of the CLPs and the reference genes (Refs) DNA [ 40 , 41 ] using EcoRI restriction sites and the resulting fragment was then cloned into the pGEM-T Easy vector. The linearized standard DNA was amplified from the plasmid DNA. To examine whether the standard DNA gave one melting temperature, we amplified the mouse Refs/CLPs standard DNA using the Ym1 (B) and Ym2 (C) primers. (D) The Ym1 and Ym2 PCR products were evaluated using 10% polyacrylamide gel analysis. (E) Multiple products were amplified from the mouse Refs/CLPs standard DNA using the Ym2 primers. Pink arrows indicate Ym2 primers. Lines indicate the putative amplified DNA products.

    Techniques Used: Real-time Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Amplification, Polymerase Chain Reaction

    33) Product Images from "Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung"

    Article Title: Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-15-23

    Validation of a qPCR system for the analysis of mouse tissues. The analyzed cDNAs were the following: (A) , BRP-39; (B) , Ym1; (C) , Ym2; (D) , Chit1; (E) , AMCase; (F) , GAPDH; (G) , β-actin; and (H) , pepsinogen C. Standard curves were obtained using the mouse Refs/CLPs standard DNA with pGEM-T Easy containing the eight mouse cDNA fragments (red closed circles). In addition, the quantification of the mouse entire coding cDNA was performed using the primer pairs for each gene. The target cDNA was amplified from a dilution of the entire coding cDNA with a known concentration and subsequently analyzed as an unknown sample (blue closed rhombuses). Equal quantities were obtained for each tested dilution of the standard curve and entire coding cDNA. Data are expressed as mean ± standard deviation (SD) of three measurements.
    Figure Legend Snippet: Validation of a qPCR system for the analysis of mouse tissues. The analyzed cDNAs were the following: (A) , BRP-39; (B) , Ym1; (C) , Ym2; (D) , Chit1; (E) , AMCase; (F) , GAPDH; (G) , β-actin; and (H) , pepsinogen C. Standard curves were obtained using the mouse Refs/CLPs standard DNA with pGEM-T Easy containing the eight mouse cDNA fragments (red closed circles). In addition, the quantification of the mouse entire coding cDNA was performed using the primer pairs for each gene. The target cDNA was amplified from a dilution of the entire coding cDNA with a known concentration and subsequently analyzed as an unknown sample (blue closed rhombuses). Equal quantities were obtained for each tested dilution of the standard curve and entire coding cDNA. Data are expressed as mean ± standard deviation (SD) of three measurements.

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Concentration Assay, Standard Deviation

    Preparation and validation of the mouse Refs/CLPs standard DNA with pGEM-T Easy. (A) Schematic representation of the mouse Refs/CLPs standard DNA cloning into pGEM-T Easy vector. (B) The mouse Refs/CLPs standard DNA with pGEM-T Easy was PCR-amplified from the plasmid DNA using the BRP-39 forward (blue arrow) and Ym1 reverse (red arrow) primers. As described above, we amplified the Ym1 and Ym2 cDNAs from this standard DNA using the Ym1 (C) and Ym2 (D) primers and these PCR products were analyzed using 10% polyacrylamide gel electrophoresis (E) . The y axis was expressed as first derivative of the fluorescence as a function of temperature (C and D) .
    Figure Legend Snippet: Preparation and validation of the mouse Refs/CLPs standard DNA with pGEM-T Easy. (A) Schematic representation of the mouse Refs/CLPs standard DNA cloning into pGEM-T Easy vector. (B) The mouse Refs/CLPs standard DNA with pGEM-T Easy was PCR-amplified from the plasmid DNA using the BRP-39 forward (blue arrow) and Ym1 reverse (red arrow) primers. As described above, we amplified the Ym1 and Ym2 cDNAs from this standard DNA using the Ym1 (C) and Ym2 (D) primers and these PCR products were analyzed using 10% polyacrylamide gel electrophoresis (E) . The y axis was expressed as first derivative of the fluorescence as a function of temperature (C and D) .

    Techniques Used: Clone Assay, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Polyacrylamide Gel Electrophoresis, Fluorescence

    BRP-39, Ym1 and Ym2 mRNA expression in mouse tissues. Quantification of BRP-39 (A) , Ym1 (B) and Ym2 (C) mRNAs in mouse tissues. The expression levels of the CLPs were quantified by real-time PCR using the standard DNA containing the eight mouse genes (the mouse Refs/CLPs standard DNA with pGEM-T Easy). The y axis was expressed as molecules per 10 ng of total RNA. The upper panel indicates the actual value, and the lower panel shows each value on logarithmic scale. Data are presented as mean ± SD of three measurements.
    Figure Legend Snippet: BRP-39, Ym1 and Ym2 mRNA expression in mouse tissues. Quantification of BRP-39 (A) , Ym1 (B) and Ym2 (C) mRNAs in mouse tissues. The expression levels of the CLPs were quantified by real-time PCR using the standard DNA containing the eight mouse genes (the mouse Refs/CLPs standard DNA with pGEM-T Easy). The y axis was expressed as molecules per 10 ng of total RNA. The upper panel indicates the actual value, and the lower panel shows each value on logarithmic scale. Data are presented as mean ± SD of three measurements.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Construction and validation of the mouse Refs/CLPs standard DNA. (A) Schematic representation of the mouse Refs/CLPs standard DNA used for qPCR analysis. We ligated the standard DNAs of the CLPs and the reference genes (Refs) DNA [ 40 , 41 ] using EcoRI restriction sites and the resulting fragment was then cloned into the pGEM-T Easy vector. The linearized standard DNA was amplified from the plasmid DNA. To examine whether the standard DNA gave one melting temperature, we amplified the mouse Refs/CLPs standard DNA using the Ym1 (B) and Ym2 (C) primers. (D) The Ym1 and Ym2 PCR products were evaluated using 10% polyacrylamide gel analysis. (E) Multiple products were amplified from the mouse Refs/CLPs standard DNA using the Ym2 primers. Pink arrows indicate Ym2 primers. Lines indicate the putative amplified DNA products.
    Figure Legend Snippet: Construction and validation of the mouse Refs/CLPs standard DNA. (A) Schematic representation of the mouse Refs/CLPs standard DNA used for qPCR analysis. We ligated the standard DNAs of the CLPs and the reference genes (Refs) DNA [ 40 , 41 ] using EcoRI restriction sites and the resulting fragment was then cloned into the pGEM-T Easy vector. The linearized standard DNA was amplified from the plasmid DNA. To examine whether the standard DNA gave one melting temperature, we amplified the mouse Refs/CLPs standard DNA using the Ym1 (B) and Ym2 (C) primers. (D) The Ym1 and Ym2 PCR products were evaluated using 10% polyacrylamide gel analysis. (E) Multiple products were amplified from the mouse Refs/CLPs standard DNA using the Ym2 primers. Pink arrows indicate Ym2 primers. Lines indicate the putative amplified DNA products.

    Techniques Used: Real-time Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Amplification, Polymerase Chain Reaction

    34) Product Images from "Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study"

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study

    Journal: Journal of Genetic Engineering & Biotechnology

    doi: 10.1016/j.jgeb.2018.04.001

    Electrophoresis result of recombinant plasmid pGEM-T Easy-Mpt83 (P1-P6).
    Figure Legend Snippet: Electrophoresis result of recombinant plasmid pGEM-T Easy-Mpt83 (P1-P6).

    Techniques Used: Electrophoresis, Recombinant, Plasmid Preparation

    E. coli growth pattern in LB-Amp plus IPTG and X-Gal Plate containing pGEM-T Easy-Mpt83 recombinant plasmid.
    Figure Legend Snippet: E. coli growth pattern in LB-Amp plus IPTG and X-Gal Plate containing pGEM-T Easy-Mpt83 recombinant plasmid.

    Techniques Used: Recombinant, Plasmid Preparation

    35) Product Images from "Screening and cloning for proteins transactivated by the PS1TP5 protein of hepatitis B virus: A suppression subtractive hybridization study"

    Article Title: Screening and cloning for proteins transactivated by the PS1TP5 protein of hepatitis B virus: A suppression subtractive hybridization study

    Journal:

    doi: 10.3748/wjg.v13.i10.1602

    Digestion and identification of the recombinant plasmid pGEM-T-PS1TP5 by Eco RI/ Bgl II. Lane 1: Restriction analysis of pGEM-T-PS1TP5; lane 2: DNA marker 2000.
    Figure Legend Snippet: Digestion and identification of the recombinant plasmid pGEM-T-PS1TP5 by Eco RI/ Bgl II. Lane 1: Restriction analysis of pGEM-T-PS1TP5; lane 2: DNA marker 2000.

    Techniques Used: Recombinant, Plasmid Preparation, Marker

    36) Product Images from "The Selenocysteine tRNA Gene in Leishmania major Is Transcribed by both RNA Polymerase II and RNA Polymerase III"

    Article Title: The Selenocysteine tRNA Gene in Leishmania major Is Transcribed by both RNA Polymerase II and RNA Polymerase III

    Journal: Eukaryotic Cell

    doi: 10.1128/EC.00239-14

    Effect of tagetitoxin on tRNA-Sec gene transcription. (A) Nuclear run-on RNA was radiolabeled in the presence of tagetitoxin at 160 μM and hybridized to dot blots of double-stranded DNAs (2 μg) cloned into the pGEM-T Easy vector. The genes
    Figure Legend Snippet: Effect of tagetitoxin on tRNA-Sec gene transcription. (A) Nuclear run-on RNA was radiolabeled in the presence of tagetitoxin at 160 μM and hybridized to dot blots of double-stranded DNAs (2 μg) cloned into the pGEM-T Easy vector. The genes

    Techniques Used: Size-exclusion Chromatography, Clone Assay, Plasmid Preparation

    Nuclear run-on analysis of the tRNA-Sec gene. (A) (Top) Labeled nascent RNA from nuclei isolated from L. major promastigotes was hybridized to dot blots of double-stranded DNAs (2 μg) cloned into the pGEM-T Easy vector. (Bottom) A genomic map
    Figure Legend Snippet: Nuclear run-on analysis of the tRNA-Sec gene. (A) (Top) Labeled nascent RNA from nuclei isolated from L. major promastigotes was hybridized to dot blots of double-stranded DNAs (2 μg) cloned into the pGEM-T Easy vector. (Bottom) A genomic map

    Techniques Used: Size-exclusion Chromatography, Labeling, Isolation, Clone Assay, Plasmid Preparation

    37) Product Images from "Epigenetic Regulation of Foxp3 Expression in Regulatory T Cells by DNA Methylation"

    Article Title: Epigenetic Regulation of Foxp3 Expression in Regulatory T Cells by DNA Methylation

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi:

    Methylation of upstream Foxp3 CpG island. A , Schematic view of mouse Foxp3 gene and upstream CpG island analyzed with GrailExp software (compbio.ornl.gov). Filled bars represent the individual CpG residues. “Kim and Leonard, 2007” is Ref. 7 and “Tone et al., 2008” is Ref. 19. B , CD4 + CD25 − gfp − T cells (naive) and CD4 + CD25 + gfp + T cells (nTreg) were purified. CD4 + CD25 − gfp − T cells were cultured with irradiated, syngeneic, T cell-depleted splenocytes in the presence of IL-2, anti-CD3 ε mAb, and TGFβ for 4 days, and CD4 + CD25 + gfp + T cells were purified by FACS sorting. Genomic DNA was isolated, digested with Msp I (methyl insensitive), Hpa II (methyl sensitive), or Eco RI (negative control), PCR amplified using upstream Foxp3 enhancer- or H19 -specific primers, and PCR products were resolved on agarose gels. Data are representative of three experiments. C , Genomic DNA was isolated from the indicated T cell subsets, modified with sodium bisulfite, PCR amplified, cloned into the pGEM-T vector, and individual clones were sequenced. The methylation pattern of each clone obtained is shown. ●, Methylated CpG; ○, nonmethylated CpG.
    Figure Legend Snippet: Methylation of upstream Foxp3 CpG island. A , Schematic view of mouse Foxp3 gene and upstream CpG island analyzed with GrailExp software (compbio.ornl.gov). Filled bars represent the individual CpG residues. “Kim and Leonard, 2007” is Ref. 7 and “Tone et al., 2008” is Ref. 19. B , CD4 + CD25 − gfp − T cells (naive) and CD4 + CD25 + gfp + T cells (nTreg) were purified. CD4 + CD25 − gfp − T cells were cultured with irradiated, syngeneic, T cell-depleted splenocytes in the presence of IL-2, anti-CD3 ε mAb, and TGFβ for 4 days, and CD4 + CD25 + gfp + T cells were purified by FACS sorting. Genomic DNA was isolated, digested with Msp I (methyl insensitive), Hpa II (methyl sensitive), or Eco RI (negative control), PCR amplified using upstream Foxp3 enhancer- or H19 -specific primers, and PCR products were resolved on agarose gels. Data are representative of three experiments. C , Genomic DNA was isolated from the indicated T cell subsets, modified with sodium bisulfite, PCR amplified, cloned into the pGEM-T vector, and individual clones were sequenced. The methylation pattern of each clone obtained is shown. ●, Methylated CpG; ○, nonmethylated CpG.

    Techniques Used: Methylation, Software, Purification, Cell Culture, Irradiation, FACS, Isolation, Negative Control, Polymerase Chain Reaction, Amplification, Modification, Clone Assay, Plasmid Preparation

    38) Product Images from "Development of sensitive and specific multiplex PCR method for the detection of microcystin producing cyanobacteria in spirulina food supplements"

    Article Title: Development of sensitive and specific multiplex PCR method for the detection of microcystin producing cyanobacteria in spirulina food supplements

    Journal: Food Science and Biotechnology

    doi: 10.1007/s10068-018-0476-0

    PCR amplification of pcb and mcyB genes with the diluted template DNA. ( A ) Tenfold dilutions of the PGEM ® -T Easy Vector mcyB M- 100 bp Ladder, L1-25 ng/μL, L2-2.5 ng/μL, L3-250 pg/μL, L4-25 pg/μL, L5-2.5 pg/μL, L6-250 fg/μL, L7-NTC; ( B ) tenfold dilutions of the PGEM ® -T Easy Vector pcb M-100 bp Ladder, L1-30 ng/μL, L2-3.0 ng/μL, L3-300 pg/μL, L4-30 pg/μL, L5-3.0 pg/μL, L6-300 fg/μL, L7-30 fg/μL, L8-3 fg/μL, L9-300 ag/μL, L10-30 ag/μL, L11-3 ag/μL, L12-300 zg/μL, L13-NTC
    Figure Legend Snippet: PCR amplification of pcb and mcyB genes with the diluted template DNA. ( A ) Tenfold dilutions of the PGEM ® -T Easy Vector mcyB M- 100 bp Ladder, L1-25 ng/μL, L2-2.5 ng/μL, L3-250 pg/μL, L4-25 pg/μL, L5-2.5 pg/μL, L6-250 fg/μL, L7-NTC; ( B ) tenfold dilutions of the PGEM ® -T Easy Vector pcb M-100 bp Ladder, L1-30 ng/μL, L2-3.0 ng/μL, L3-300 pg/μL, L4-30 pg/μL, L5-3.0 pg/μL, L6-300 fg/μL, L7-30 fg/μL, L8-3 fg/μL, L9-300 ag/μL, L10-30 ag/μL, L11-3 ag/μL, L12-300 zg/μL, L13-NTC

    Techniques Used: Polymerase Chain Reaction, Amplification, Plasmid Preparation

    Multiplex PCR analysis with constant PGEM ® -T Easy Vector pcb template of 3 ng/μL (76 bp) and varying concentration of PGEM ® -T Easy Vector mcyB template (212 bp) M-100 bp ladder, L1-2.5 ng/μL, L2-25 pg/μL, L3-250 fg/μL, L4-2.5 fg/μL, L5-25 ag/μL, L6-25 zg/μL, L7-2.5 zg/μL, L8-NTC
    Figure Legend Snippet: Multiplex PCR analysis with constant PGEM ® -T Easy Vector pcb template of 3 ng/μL (76 bp) and varying concentration of PGEM ® -T Easy Vector mcyB template (212 bp) M-100 bp ladder, L1-2.5 ng/μL, L2-25 pg/μL, L3-250 fg/μL, L4-2.5 fg/μL, L5-25 ag/μL, L6-25 zg/μL, L7-2.5 zg/μL, L8-NTC

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Plasmid Preparation, Concentration Assay

    39) Product Images from "Brief report of the construction of infectious DNA clones of South African genetic variants of grapevine virus A and grapevine virus B"

    Article Title: Brief report of the construction of infectious DNA clones of South African genetic variants of grapevine virus A and grapevine virus B

    Journal: SpringerPlus

    doi: 10.1186/s40064-015-1517-2

    General strategy of construction of DNA clones of a GVA and b GVB genetic variants P163-M5 and 953-1, respectively. Numbers I–VI describe RT-PCR amplified CaMV 35S promoter and virus genome fragments using primers which nucleotide sequences are shown it Table 1 . The fragments III-VI were cloned into the TA site of pGEM-T Easy vector (Promega) ( single dashed line ) and then assembled in this vector using carefully selected restriction enzymes to digest the vector and virus sequences. The open arrows show the sequence of the assembling of virus fragments in the vector. Closed arrows show the stages of ligation of virus fragments to obtain full-length DNA clones of viruses under CaMV 35S promoter
    Figure Legend Snippet: General strategy of construction of DNA clones of a GVA and b GVB genetic variants P163-M5 and 953-1, respectively. Numbers I–VI describe RT-PCR amplified CaMV 35S promoter and virus genome fragments using primers which nucleotide sequences are shown it Table 1 . The fragments III-VI were cloned into the TA site of pGEM-T Easy vector (Promega) ( single dashed line ) and then assembled in this vector using carefully selected restriction enzymes to digest the vector and virus sequences. The open arrows show the sequence of the assembling of virus fragments in the vector. Closed arrows show the stages of ligation of virus fragments to obtain full-length DNA clones of viruses under CaMV 35S promoter

    Techniques Used: Clone Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing, Ligation

    40) Product Images from "Functional Analysis of Drosophila HSP70 Promoter with Different HSE Numbers in Human Cells"

    Article Title: Functional Analysis of Drosophila HSP70 Promoter with Different HSE Numbers in Human Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0101994

    Nucleotide sequence of the hsp70+500 bp fragment cloned into pGem-T Easy. Capital letters indicate the hsp70 promoter sequence (453 bp). The 100 bp regulatory sequence included in the 500 bp regulatory region is shown in italics. Sequencing was performed using the reverse primer phsR (5 ′ -taacgaattcccaattccctattcag-3′).
    Figure Legend Snippet: Nucleotide sequence of the hsp70+500 bp fragment cloned into pGem-T Easy. Capital letters indicate the hsp70 promoter sequence (453 bp). The 100 bp regulatory sequence included in the 500 bp regulatory region is shown in italics. Sequencing was performed using the reverse primer phsR (5 ′ -taacgaattcccaattccctattcag-3′).

    Techniques Used: Sequencing, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
    Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Amplification:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Agarose Gel Electrophoresis:

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Purification:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Polymerase Chain Reaction:

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
    Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Activity Assay:

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    DNA Sequencing:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Sequencing:

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    Plasmid Preparation:

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
    Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Promega pgem t easy cloning vector
    (A) Southern blotting of EcoRI-digested total DNA from FD-C-infected and FD-D-infected and healthy (H) periwinkles probed with a DIG-labeled malG gene amplicon obtained through <t>PCR</t> driven by primer pair malG _F/ malG _R (C+, probe positive control represented by <t>pGEM-T-</t> malG1 plasmid). (B) Electrophoresis separation of amplicons obtained following PCR of total DNA from FD-C-infected and FD-D-infected periwinkles with copy-specific primer pairs (002 and 005), according to the draft genome of FD92, and from healthy periwinkle. *, nonspecific PCR product.
    Pgem T Easy Cloning Vector, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 282 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy cloning vector/product/Promega
    Average 93 stars, based on 282 article reviews
    Price from $9.99 to $1999.99
    pgem t easy cloning vector - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    85
    Promega pax2 1 expression vector
    Expression of fadd is down-regulated in noi mutant zebrafish. ( A–F ) fadd expression in wild-type (wt), <t>pax2.1</t> −/− coloboma mutant ( noi ) and lamb1 −/− coloboma mutant ( gup ). Gene expression tested at either 24 (24
    Pax2 1 Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pax2 1 expression vector/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pax2 1 expression vector - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    88
    Promega β globin genes
    Fractionation of VSV-infected 293T cells. 293T cells were infected with VSV at different MOI (0.0001 to 0.1) and incubated for 16 hr. The nuclear and cytoplasmic fractions were separated and subjected to real-time PCR using the VSV-N (left panel) and <t>β-globin</t> primers (right panel). The DNA copy number per cell was estimated using the VSV N gene or β-globin gene in the control plasmid and is indicated on the axis. The means ± SE of two independent experiments performed in duplicate are shown.
    β Globin Genes, supplied by Promega, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/β globin genes/product/Promega
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    β globin genes - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    99
    Promega pgem t easy vector
    Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of <t>vlhA</t> promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of <t>pGEM-T</t> Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.
    Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 6915 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector/product/Promega
    Average 99 stars, based on 6915 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    (A) Southern blotting of EcoRI-digested total DNA from FD-C-infected and FD-D-infected and healthy (H) periwinkles probed with a DIG-labeled malG gene amplicon obtained through PCR driven by primer pair malG _F/ malG _R (C+, probe positive control represented by pGEM-T- malG1 plasmid). (B) Electrophoresis separation of amplicons obtained following PCR of total DNA from FD-C-infected and FD-D-infected periwinkles with copy-specific primer pairs (002 and 005), according to the draft genome of FD92, and from healthy periwinkle. *, nonspecific PCR product.

    Journal: Applied and Environmental Microbiology

    Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale

    doi: 10.1128/AEM.03123-18

    Figure Lengend Snippet: (A) Southern blotting of EcoRI-digested total DNA from FD-C-infected and FD-D-infected and healthy (H) periwinkles probed with a DIG-labeled malG gene amplicon obtained through PCR driven by primer pair malG _F/ malG _R (C+, probe positive control represented by pGEM-T- malG1 plasmid). (B) Electrophoresis separation of amplicons obtained following PCR of total DNA from FD-C-infected and FD-D-infected periwinkles with copy-specific primer pairs (002 and 005), according to the draft genome of FD92, and from healthy periwinkle. *, nonspecific PCR product.

    Article Snippet: In the case of mixed infections (presence of double peaks in the analyzed pherograms from the sequencing of the original PCR amplicon), purified PCR products were ligated into pGEM-T easy cloning vector following the manufacturer's instructions (pGEM-T clone kit; Promega, Madison, WI) and transformed into Escherichia coli DH5α competent cells by heat shock.

    Techniques: Southern Blot, Infection, Labeling, Amplification, Polymerase Chain Reaction, Positive Control, Plasmid Preparation, Electrophoresis

    Expression of fadd is down-regulated in noi mutant zebrafish. ( A–F ) fadd expression in wild-type (wt), pax2.1 −/− coloboma mutant ( noi ) and lamb1 −/− coloboma mutant ( gup ). Gene expression tested at either 24 (24

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Expression of fadd is down-regulated in noi mutant zebrafish. ( A–F ) fadd expression in wild-type (wt), pax2.1 −/− coloboma mutant ( noi ) and lamb1 −/− coloboma mutant ( gup ). Gene expression tested at either 24 (24

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Expressing, Mutagenesis

    Rescue of the pax2.1 -deficient phenotype by mRNA injection. ( A – E ) Wild-type embryos (wt) were injected with pax2.1 mRNA. ( F – J ) Uninjected pax2.1 -deficient (mt) embryos ( K – O ) pax2.1 -deficient embryos injected with pax2.1 mRNA. (

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Rescue of the pax2.1 -deficient phenotype by mRNA injection. ( A – E ) Wild-type embryos (wt) were injected with pax2.1 mRNA. ( F – J ) Uninjected pax2.1 -deficient (mt) embryos ( K – O ) pax2.1 -deficient embryos injected with pax2.1 mRNA. (

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Injection

    Pax2.1 binds to the fadd promoter. ( A ) EMSA using fadd oligonucleotide probe containing the second pax2 -binding site. Fadd probe bound to the pax2.1 protein (lane 2), which was displaced by unlabelled competitor (lane 3) and in the presence of pax2 antibody

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Pax2.1 binds to the fadd promoter. ( A ) EMSA using fadd oligonucleotide probe containing the second pax2 -binding site. Fadd probe bound to the pax2.1 protein (lane 2), which was displaced by unlabelled competitor (lane 3) and in the presence of pax2 antibody

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Binding Assay

    pax2.1 responsive elements in the fadd promoter. ( A ) Diagram at top depicts symbols used for transcription factor-binding sites. p, pax2.1 site; v, vax2 site; rxr, rxr site. Hatched box, exon 1 of fadd . L, luciferase gene. Reporter constructs transfected

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: pax2.1 responsive elements in the fadd promoter. ( A ) Diagram at top depicts symbols used for transcription factor-binding sites. p, pax2.1 site; v, vax2 site; rxr, rxr site. Hatched box, exon 1 of fadd . L, luciferase gene. Reporter constructs transfected

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Binding Assay, Luciferase, Construct, Transfection

    Spatiotemporal RIP3 localization and rescue of eye phenotype using necrostatin-1. ( A – C ) RIP3 immunohistochemistry (red) in wild-type (wt) eyes counterstained with DAPI. ( D and E ) High-level RIP3 labelling in pax2.1 -deficient eyes (mt). White arrow

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Spatiotemporal RIP3 localization and rescue of eye phenotype using necrostatin-1. ( A – C ) RIP3 immunohistochemistry (red) in wild-type (wt) eyes counterstained with DAPI. ( D and E ) High-level RIP3 labelling in pax2.1 -deficient eyes (mt). White arrow

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Immunohistochemistry

    Fractionation of VSV-infected 293T cells. 293T cells were infected with VSV at different MOI (0.0001 to 0.1) and incubated for 16 hr. The nuclear and cytoplasmic fractions were separated and subjected to real-time PCR using the VSV-N (left panel) and β-globin primers (right panel). The DNA copy number per cell was estimated using the VSV N gene or β-globin gene in the control plasmid and is indicated on the axis. The means ± SE of two independent experiments performed in duplicate are shown.

    Journal: Scientific Reports

    Article Title: Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    doi: 10.1038/srep05074

    Figure Lengend Snippet: Fractionation of VSV-infected 293T cells. 293T cells were infected with VSV at different MOI (0.0001 to 0.1) and incubated for 16 hr. The nuclear and cytoplasmic fractions were separated and subjected to real-time PCR using the VSV-N (left panel) and β-globin primers (right panel). The DNA copy number per cell was estimated using the VSV N gene or β-globin gene in the control plasmid and is indicated on the axis. The means ± SE of two independent experiments performed in duplicate are shown.

    Article Snippet: The copy number of each product was estimated using standard curves that were obtained using serial dilutions of the plasmids containing the VSV N and β-globin genes (pGEM®-T Easy vector) (Promega).

    Techniques: Fractionation, Infection, Incubation, Real-time Polymerase Chain Reaction, Plasmid Preparation

    LINE-1 transduction of the NP-2 cell line and its effect on VSV DNA formation. (a) LINE-1 transduction of the NP-2 cell line. The LINE-1 ORF1p and β-actin levels in the 293T, NP-2, NP-2/LINE-1 (L1.2), and NP-2/LINE-1 (L1.2 ORF2mut) cells were examined via Western blot using the anti-ORF1p IgY antibody. The ORF1p protein was observed at a molecular weight of ~41 kDa. The membrane was re-probed with an anti-β-actin antibody. The size marker at 38 kDa is indicated. Note that cropped western blots are shown and that full-length images are presented in the supplementary information . (b) The effect of LINE-1 transduction on VSV DNA production. The cells described above were infected with VSV, and the cell lysates were prepared. Real-time PCR was performed with either the N478-F/N681-R or β-globin primer pair. In addition, the VSV progeny produced by these cells were titrated and the VSV N mRNA expression levels were compared among these cells.

    Journal: Scientific Reports

    Article Title: Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    doi: 10.1038/srep05074

    Figure Lengend Snippet: LINE-1 transduction of the NP-2 cell line and its effect on VSV DNA formation. (a) LINE-1 transduction of the NP-2 cell line. The LINE-1 ORF1p and β-actin levels in the 293T, NP-2, NP-2/LINE-1 (L1.2), and NP-2/LINE-1 (L1.2 ORF2mut) cells were examined via Western blot using the anti-ORF1p IgY antibody. The ORF1p protein was observed at a molecular weight of ~41 kDa. The membrane was re-probed with an anti-β-actin antibody. The size marker at 38 kDa is indicated. Note that cropped western blots are shown and that full-length images are presented in the supplementary information . (b) The effect of LINE-1 transduction on VSV DNA production. The cells described above were infected with VSV, and the cell lysates were prepared. Real-time PCR was performed with either the N478-F/N681-R or β-globin primer pair. In addition, the VSV progeny produced by these cells were titrated and the VSV N mRNA expression levels were compared among these cells.

    Article Snippet: The copy number of each product was estimated using standard curves that were obtained using serial dilutions of the plasmids containing the VSV N and β-globin genes (pGEM®-T Easy vector) (Promega).

    Techniques: Transduction, Western Blot, Molecular Weight, Marker, Infection, Real-time Polymerase Chain Reaction, Produced, Expressing

    Cell-based differences in VSV DNA production. Various human cells were infected with VSV at an MOI of 0.1. The DNA was extracted 16 hr later and subjected to PCR amplification. Real-time PCR was performed using the N478-F/N681-R or β-globin primer pair. The copy numbers of the VSV N and β-globin genes in each cell line are shown in closed and open bars, respectively. The arrows indicate that the copy number per cell was below the detection limit. The positive cells are ordered according to the VSV N DNA level, followed by the VSV DNA-negative adherent cells. Subsequently, the VSV DNA-negative suspension cells are arranged in alphabetical order. The means ± SE of two independent experiments performed in duplicate are shown.

    Journal: Scientific Reports

    Article Title: Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    doi: 10.1038/srep05074

    Figure Lengend Snippet: Cell-based differences in VSV DNA production. Various human cells were infected with VSV at an MOI of 0.1. The DNA was extracted 16 hr later and subjected to PCR amplification. Real-time PCR was performed using the N478-F/N681-R or β-globin primer pair. The copy numbers of the VSV N and β-globin genes in each cell line are shown in closed and open bars, respectively. The arrows indicate that the copy number per cell was below the detection limit. The positive cells are ordered according to the VSV N DNA level, followed by the VSV DNA-negative adherent cells. Subsequently, the VSV DNA-negative suspension cells are arranged in alphabetical order. The means ± SE of two independent experiments performed in duplicate are shown.

    Article Snippet: The copy number of each product was estimated using standard curves that were obtained using serial dilutions of the plasmids containing the VSV N and β-globin genes (pGEM®-T Easy vector) (Promega).

    Techniques: Infection, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of vlhA promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of pGEM-T Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.

    Journal: PLoS ONE

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics

    doi: 10.1371/journal.pone.0194528

    Figure Lengend Snippet: Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of vlhA promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of pGEM-T Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.

    Article Snippet: Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia).

    Techniques: Plasmid Preparation, Binding Assay, Overlap Extension Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Molecular Weight, Marker, Clone Assay