pgem t easy  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pGEM T Easy Vector Systems
    Description:
    PCR cloning vectors with 3 options for insert excision
    Catalog Number:
    A1360
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR PCR Cloning
    Buy from Supplier


    Structured Review

    Promega pgem t easy
    Retrieval of the variable region of rearranged germline immunoglobulin genes by semi-nested <t>PCR.</t> (A) Genomic DNA (200 ng) from CD19 + splenocytes was used as templates for semi-nested PCR to retrieve the variable region of rearranged Ig genes. The 1 st round PCR products of heavy- (lane 1) and κ light- (lane 3) chains were used as templates for the 2 nd round semi-nest PCR (lane 2 and 4). Sizes of PCR products were estimated against the 1 Kbp DNA ladders (Marker). Primers used and PCR protocols are described in Methods. After gel purification, the 2 nd round semi-nested PCR products of heavy- (lane 5) and κ light- (lane 6) chains were cloned into Topo TA or <t>pGEM-T</t> vectors for nucleotide sequence determination. (B) Sequence analysis indicates that 92% and 100% of the randomly picked V H or V Lκ clones are mouse immunoglobulin genes, respectively. The sequence V H (C) or V Lκ (D) clones were further analyzed against the VBASE2 Ig database, indicating all the sequenced clones are germline-derived. Class 1 genes are with genomic and rearranged evidence; Class 2 genes are with genomic evidence only; Class 3 genes are with rearranged evidence only as defined by VBASE2.
    PCR cloning vectors with 3 options for insert excision
    https://www.bioz.com/result/pgem t easy/product/Promega
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgem t easy - by Bioz Stars, 2021-07
    99/100 stars

    Images

    1) Product Images from "Construction and Characterization of Single-Chain Variable Fragment Antibody Library Derived from Germline Rearranged Immunoglobulin Variable Genes"

    Article Title: Construction and Characterization of Single-Chain Variable Fragment Antibody Library Derived from Germline Rearranged Immunoglobulin Variable Genes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027406

    Retrieval of the variable region of rearranged germline immunoglobulin genes by semi-nested PCR. (A) Genomic DNA (200 ng) from CD19 + splenocytes was used as templates for semi-nested PCR to retrieve the variable region of rearranged Ig genes. The 1 st round PCR products of heavy- (lane 1) and κ light- (lane 3) chains were used as templates for the 2 nd round semi-nest PCR (lane 2 and 4). Sizes of PCR products were estimated against the 1 Kbp DNA ladders (Marker). Primers used and PCR protocols are described in Methods. After gel purification, the 2 nd round semi-nested PCR products of heavy- (lane 5) and κ light- (lane 6) chains were cloned into Topo TA or pGEM-T vectors for nucleotide sequence determination. (B) Sequence analysis indicates that 92% and 100% of the randomly picked V H or V Lκ clones are mouse immunoglobulin genes, respectively. The sequence V H (C) or V Lκ (D) clones were further analyzed against the VBASE2 Ig database, indicating all the sequenced clones are germline-derived. Class 1 genes are with genomic and rearranged evidence; Class 2 genes are with genomic evidence only; Class 3 genes are with rearranged evidence only as defined by VBASE2.
    Figure Legend Snippet: Retrieval of the variable region of rearranged germline immunoglobulin genes by semi-nested PCR. (A) Genomic DNA (200 ng) from CD19 + splenocytes was used as templates for semi-nested PCR to retrieve the variable region of rearranged Ig genes. The 1 st round PCR products of heavy- (lane 1) and κ light- (lane 3) chains were used as templates for the 2 nd round semi-nest PCR (lane 2 and 4). Sizes of PCR products were estimated against the 1 Kbp DNA ladders (Marker). Primers used and PCR protocols are described in Methods. After gel purification, the 2 nd round semi-nested PCR products of heavy- (lane 5) and κ light- (lane 6) chains were cloned into Topo TA or pGEM-T vectors for nucleotide sequence determination. (B) Sequence analysis indicates that 92% and 100% of the randomly picked V H or V Lκ clones are mouse immunoglobulin genes, respectively. The sequence V H (C) or V Lκ (D) clones were further analyzed against the VBASE2 Ig database, indicating all the sequenced clones are germline-derived. Class 1 genes are with genomic and rearranged evidence; Class 2 genes are with genomic evidence only; Class 3 genes are with rearranged evidence only as defined by VBASE2.

    Techniques Used: Nested PCR, Polymerase Chain Reaction, Marker, Gel Purification, Clone Assay, Sequencing, Derivative Assay

    2) Product Images from "Quantitative Analysis of BRCA1 and BRCA2 Germline Splicing Variants Using a Novel RNA-Massively Parallel Sequencing Assay"

    Article Title: Quantitative Analysis of BRCA1 and BRCA2 Germline Splicing Variants Using a Novel RNA-Massively Parallel Sequencing Assay

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2018.00286

    Schematic representation of the CloneSeq protocol and splicing events detected by the bioinformatics pipeline . (A) Blood from normal healthy controls and patients participating in the Ambry Genetics Family Studies program was drawn in PAXgene Blood RNA Tubes. RT-PCR was performed following ENIGMA recommendations. RT-PCR products were cloned into pGEM-T Easy and transformed into bacteria. For CloneSeq, all colonies on a plate were scraped and suspended in PBS. Plasmids were extracted, CloneSeq libraries were constructed, and Massively Parallel Sequencing (MPS) was performed, which generated 2 × 250 paired-end reads. The mapped reads are then analyzed by the customized Ambry Bioinformatic Pipeline (ABP) software to generate qualitative and quantitative data for splicing events, including exon skipping, alternative 5′ donor site, alternative 3′ acceptor site, and intron retention. We confirmed CloneSeq results by comparing the data with ENIGMA-recommended assays, in which several individual positive colonies were picked, amplified by rolling-circle amplification, and Sanger sequenced. Single-transcript alignment (STA) was performed to characterize the transcripts' sequences. (B) The five types of alternative splicing events, as described by Diederichs et al. that can be detected by the ABP: (1) exon skipping; (2) partial exon skipping (as a result of the usage of alternative exonic donor or acceptor site); (3) partial intron inclusion (as a result of the usage of alternative intronic donor or acceptor site);(4) intron retention;(5) insertion of cryptic exons.
    Figure Legend Snippet: Schematic representation of the CloneSeq protocol and splicing events detected by the bioinformatics pipeline . (A) Blood from normal healthy controls and patients participating in the Ambry Genetics Family Studies program was drawn in PAXgene Blood RNA Tubes. RT-PCR was performed following ENIGMA recommendations. RT-PCR products were cloned into pGEM-T Easy and transformed into bacteria. For CloneSeq, all colonies on a plate were scraped and suspended in PBS. Plasmids were extracted, CloneSeq libraries were constructed, and Massively Parallel Sequencing (MPS) was performed, which generated 2 × 250 paired-end reads. The mapped reads are then analyzed by the customized Ambry Bioinformatic Pipeline (ABP) software to generate qualitative and quantitative data for splicing events, including exon skipping, alternative 5′ donor site, alternative 3′ acceptor site, and intron retention. We confirmed CloneSeq results by comparing the data with ENIGMA-recommended assays, in which several individual positive colonies were picked, amplified by rolling-circle amplification, and Sanger sequenced. Single-transcript alignment (STA) was performed to characterize the transcripts' sequences. (B) The five types of alternative splicing events, as described by Diederichs et al. that can be detected by the ABP: (1) exon skipping; (2) partial exon skipping (as a result of the usage of alternative exonic donor or acceptor site); (3) partial intron inclusion (as a result of the usage of alternative intronic donor or acceptor site);(4) intron retention;(5) insertion of cryptic exons.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Clone Assay, Transformation Assay, Construct, Sequencing, Generated, Software, Amplification

    Related Articles

    Purification:

    Article Title: Construction and Characterization of Single-Chain Variable Fragment Antibody Library Derived from Germline Rearranged Immunoglobulin Variable Genes
    Article Snippet: After separation on a 1.5% agarose gel, DNA fragments with a size range of 300–400 bp were electro-eluted, phenol-chloroform purified, and ethanol precipitated. .. The purified PCR products were either cloned into TOPO TA (Invitrogen) or pGEM-T Easy (Promega) cloning vectors for nucleotide sequence determination, or used for subsequent scFv construction. .. ScFv construction The CDR3-diversified germline Ig VH and VLκ DNA fragments were randomly linked together using a two-stage overlap extension PCR (oePCR).

    Polymerase Chain Reaction:

    Article Title: Construction and Characterization of Single-Chain Variable Fragment Antibody Library Derived from Germline Rearranged Immunoglobulin Variable Genes
    Article Snippet: After separation on a 1.5% agarose gel, DNA fragments with a size range of 300–400 bp were electro-eluted, phenol-chloroform purified, and ethanol precipitated. .. The purified PCR products were either cloned into TOPO TA (Invitrogen) or pGEM-T Easy (Promega) cloning vectors for nucleotide sequence determination, or used for subsequent scFv construction. .. ScFv construction The CDR3-diversified germline Ig VH and VLκ DNA fragments were randomly linked together using a two-stage overlap extension PCR (oePCR).

    Article Title: Efficient production of a mature and functional gamma secretase protease
    Article Snippet: In addition, eight histidine repeats (octa-His tag) were cloned at the C-terminus of NCT and Calmodulin Binding Protein (CBP) purification tag was cloned at the N-terminus of PEN-2 to facilitate protein purification. .. The PCR amplified PS1(wt), PS1Δ9 and APH1aL inserts were cloned into pGEM® T easy (Promega A1360) vectors using ‘T-A’ cloning and maintained in E. coli One Shot® MAX Efficiency® DH5α™-T1R (Life Technologies, Australia 12297016). .. The NCT-octa-His insert was cloned into pSPL vector (pSPL vector described previously ).

    Article Title: Precise and efficient genome editing in zebrafish using the CRISPR/Cas9 system
    Article Snippet: Donor DNA flanked by CRISPR target sites was generated by PCR with primers 1323 and 1324 ( ). .. A-overhangs were added and the PCR product was cloned into pGEM-T Easy. .. Injection and genotyping One-cell stage zebrafish embryos were injected with ∼2-3 nl of a solution containing 250 ng/µl Cas9 mRNA, 15 ng/µl sgRNA and 5-50 ng/µl template DNA.

    Article Title: Quantitative Analysis of BRCA1 and BRCA2 Germline Splicing Variants Using a Novel RNA-Massively Parallel Sequencing Assay
    Article Snippet: CE analysis was performed with GeneMapper software (Thermo Fisher Scientific). .. PCR products were cloned into pGEM-T Easy and transformed into bacteria according to the manufacturer's recommended protocol (Promega, Fitchburg, WI, USA). .. Individual white colonies were picked, amplified by rolling-circle replication, and Sanger sequenced by Genewiz (La Jolla, CA, USA).

    Clone Assay:

    Article Title: Construction and Characterization of Single-Chain Variable Fragment Antibody Library Derived from Germline Rearranged Immunoglobulin Variable Genes
    Article Snippet: After separation on a 1.5% agarose gel, DNA fragments with a size range of 300–400 bp were electro-eluted, phenol-chloroform purified, and ethanol precipitated. .. The purified PCR products were either cloned into TOPO TA (Invitrogen) or pGEM-T Easy (Promega) cloning vectors for nucleotide sequence determination, or used for subsequent scFv construction. .. ScFv construction The CDR3-diversified germline Ig VH and VLκ DNA fragments were randomly linked together using a two-stage overlap extension PCR (oePCR).

    Article Title: Efficient production of a mature and functional gamma secretase protease
    Article Snippet: In addition, eight histidine repeats (octa-His tag) were cloned at the C-terminus of NCT and Calmodulin Binding Protein (CBP) purification tag was cloned at the N-terminus of PEN-2 to facilitate protein purification. .. The PCR amplified PS1(wt), PS1Δ9 and APH1aL inserts were cloned into pGEM® T easy (Promega A1360) vectors using ‘T-A’ cloning and maintained in E. coli One Shot® MAX Efficiency® DH5α™-T1R (Life Technologies, Australia 12297016). .. The NCT-octa-His insert was cloned into pSPL vector (pSPL vector described previously ).

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: In this paper, a novel antigen as candidate TB vaccine, MPT83 antigen from local strain M. tuberculosis bacteria has been successfully amplified using PCR technique, resulting in 660 bp band. .. The cloning of MPT83 gene into pGEM-T Easy vector results in recombinant plasmid with the size of 3678 bp. .. Based on the order of amino acid encoding protein in recombinant plasmid, pGEM-T Easy-Mpt83 was subcloned and expressed into E coli BL-21 cell in order to produce protein recombinant using 48 kDa molecules as GST-MPT83 fusion protein.

    Article Title: Precise and efficient genome editing in zebrafish using the CRISPR/Cas9 system
    Article Snippet: Donor DNA flanked by CRISPR target sites was generated by PCR with primers 1323 and 1324 ( ). .. A-overhangs were added and the PCR product was cloned into pGEM-T Easy. .. Injection and genotyping One-cell stage zebrafish embryos were injected with ∼2-3 nl of a solution containing 250 ng/µl Cas9 mRNA, 15 ng/µl sgRNA and 5-50 ng/µl template DNA.

    Article Title: Quantitative Analysis of BRCA1 and BRCA2 Germline Splicing Variants Using a Novel RNA-Massively Parallel Sequencing Assay
    Article Snippet: CE analysis was performed with GeneMapper software (Thermo Fisher Scientific). .. PCR products were cloned into pGEM-T Easy and transformed into bacteria according to the manufacturer's recommended protocol (Promega, Fitchburg, WI, USA). .. Individual white colonies were picked, amplified by rolling-circle replication, and Sanger sequenced by Genewiz (La Jolla, CA, USA).

    Sequencing:

    Article Title: Construction and Characterization of Single-Chain Variable Fragment Antibody Library Derived from Germline Rearranged Immunoglobulin Variable Genes
    Article Snippet: After separation on a 1.5% agarose gel, DNA fragments with a size range of 300–400 bp were electro-eluted, phenol-chloroform purified, and ethanol precipitated. .. The purified PCR products were either cloned into TOPO TA (Invitrogen) or pGEM-T Easy (Promega) cloning vectors for nucleotide sequence determination, or used for subsequent scFv construction. .. ScFv construction The CDR3-diversified germline Ig VH and VLκ DNA fragments were randomly linked together using a two-stage overlap extension PCR (oePCR).

    Amplification:

    Article Title: Efficient production of a mature and functional gamma secretase protease
    Article Snippet: In addition, eight histidine repeats (octa-His tag) were cloned at the C-terminus of NCT and Calmodulin Binding Protein (CBP) purification tag was cloned at the N-terminus of PEN-2 to facilitate protein purification. .. The PCR amplified PS1(wt), PS1Δ9 and APH1aL inserts were cloned into pGEM® T easy (Promega A1360) vectors using ‘T-A’ cloning and maintained in E. coli One Shot® MAX Efficiency® DH5α™-T1R (Life Technologies, Australia 12297016). .. The NCT-octa-His insert was cloned into pSPL vector (pSPL vector described previously ).

    Plasmid Preparation:

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: In this paper, a novel antigen as candidate TB vaccine, MPT83 antigen from local strain M. tuberculosis bacteria has been successfully amplified using PCR technique, resulting in 660 bp band. .. The cloning of MPT83 gene into pGEM-T Easy vector results in recombinant plasmid with the size of 3678 bp. .. Based on the order of amino acid encoding protein in recombinant plasmid, pGEM-T Easy-Mpt83 was subcloned and expressed into E coli BL-21 cell in order to produce protein recombinant using 48 kDa molecules as GST-MPT83 fusion protein.

    Article Title: Characterization of the DNA binding activity of structural protein VP1 from chicken anaemia virus
    Article Snippet: Different DNA species, including circular dsDNA, linear dsDNA and circular ssDNA were used for assessing DNA-binding activity. .. The circular dsDNA, pcDNA3.1 (#V80020, Invitrogen, USA), pGEM-T easy vector (#A1360, Promega, USA) and pCAV were used for the DNA binding assay. .. The pCAV plasmid DNA was composed of a full-length Australian CAV strain CAU269/7 (GenBank # ).

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: Blood sample as source local strain of M. tuberculosis was collected from the pulmonary tuberculosis patient from the Wahidin Sudirohusodo Hospital, Makassar, Indonesia. .. Signed written informed consent was obtained according to Ethics Committee from Hasanuddin University Hospital, Makassar, Indonesia. pGEX-2TK vector and E. coli BL21 component cells were purchased from Amersham Pharmacia Biotech. pGEM-T Easy vector and E. coli JM109 cells was purchased from Promega, USA. .. Glutathione-agarose beads was purchased from GE Healthcare Hong Kong.

    Recombinant:

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study
    Article Snippet: In this paper, a novel antigen as candidate TB vaccine, MPT83 antigen from local strain M. tuberculosis bacteria has been successfully amplified using PCR technique, resulting in 660 bp band. .. The cloning of MPT83 gene into pGEM-T Easy vector results in recombinant plasmid with the size of 3678 bp. .. Based on the order of amino acid encoding protein in recombinant plasmid, pGEM-T Easy-Mpt83 was subcloned and expressed into E coli BL-21 cell in order to produce protein recombinant using 48 kDa molecules as GST-MPT83 fusion protein.

    DNA Binding Assay:

    Article Title: Characterization of the DNA binding activity of structural protein VP1 from chicken anaemia virus
    Article Snippet: Different DNA species, including circular dsDNA, linear dsDNA and circular ssDNA were used for assessing DNA-binding activity. .. The circular dsDNA, pcDNA3.1 (#V80020, Invitrogen, USA), pGEM-T easy vector (#A1360, Promega, USA) and pCAV were used for the DNA binding assay. .. The pCAV plasmid DNA was composed of a full-length Australian CAV strain CAU269/7 (GenBank # ).

    Transformation Assay:

    Article Title: Quantitative Analysis of BRCA1 and BRCA2 Germline Splicing Variants Using a Novel RNA-Massively Parallel Sequencing Assay
    Article Snippet: CE analysis was performed with GeneMapper software (Thermo Fisher Scientific). .. PCR products were cloned into pGEM-T Easy and transformed into bacteria according to the manufacturer's recommended protocol (Promega, Fitchburg, WI, USA). .. Individual white colonies were picked, amplified by rolling-circle replication, and Sanger sequenced by Genewiz (La Jolla, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pgem t easy vector systems
    The VP1 protein has DNA-binding ability with no sequence specificity. The recombinant GST and GST-fused proteins were prepared by E. coli overexpression and purified through GST affinity chromatography. Purified results were analysed by SDS-PAGE with Coomassie blue staining and Western blotting with an anti-GST monoclonal antibody or anti-C-ter-VP1 polyclonal antibody ( a ). The purified proteins were used for DNA binding ability by an agarose gel shift assay with different DNA sequences of plasmid preparation of <t>pcDNA3.1</t> ( b ), of the <t>pGEM-T</t> easy vector ( c ), and of pCAV containing the whole CAV genome ( d ). The binding activity of the VP1 protein was determined by comparing the existence of DNA fragments for the protein-DNA complex and DNA patterns from the blank (no-protein used), negative control (GST only) and positive control (GST-VP3). To confirm the observed DNA migration results that were induced by bound recombinant proteins, the protein-DNA experimental samples were mixed with 1% SDS as a protein denaturant (underline lane-labelled 1% SDS). Lane M, DNA ladder marker. Bold triangles indicated the protein-DNA complex formed by tested proteins and plasmids. Asterisks indicated the two conformations of plasmid DNA, including the relaxed form (Form I), and another was the supercoiled form (Form II)
    Pgem T Easy Vector Systems, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector systems/product/Promega
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector systems - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    86
    Promega pgem t easy vector
    In vitro transcription of coat protein gene of CMV. Complementary RNAs were produced by transcription of coat protein gene of the CMV isolates cloned in the <t>pGEM-T</t> easy vector in both orientations. Transcript of 701 nt long of anti-sense strand (AUR) and 691 nt long sense strand (PUNE) were generated using Promega Riboprobe Kit. Transcript of pGEM-T easy was used as control. DNA marker of 1 kb was used
    Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector/product/Promega
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    99
    Promega plasmid vector pgem t easy vector
    NP-1 real-time PCR assay showing representative results obtained with serial 10-fold dilutions (10 1 to 10 8 copies per reaction) of the <t>pGEM-T</t> NP-1 HBoV2 plasmid, run in triplicate. The left panel shows baseline subtractive curve fit views of the data
    Plasmid Vector Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid vector pgem t easy vector/product/Promega
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plasmid vector pgem t easy vector - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    The VP1 protein has DNA-binding ability with no sequence specificity. The recombinant GST and GST-fused proteins were prepared by E. coli overexpression and purified through GST affinity chromatography. Purified results were analysed by SDS-PAGE with Coomassie blue staining and Western blotting with an anti-GST monoclonal antibody or anti-C-ter-VP1 polyclonal antibody ( a ). The purified proteins were used for DNA binding ability by an agarose gel shift assay with different DNA sequences of plasmid preparation of pcDNA3.1 ( b ), of the pGEM-T easy vector ( c ), and of pCAV containing the whole CAV genome ( d ). The binding activity of the VP1 protein was determined by comparing the existence of DNA fragments for the protein-DNA complex and DNA patterns from the blank (no-protein used), negative control (GST only) and positive control (GST-VP3). To confirm the observed DNA migration results that were induced by bound recombinant proteins, the protein-DNA experimental samples were mixed with 1% SDS as a protein denaturant (underline lane-labelled 1% SDS). Lane M, DNA ladder marker. Bold triangles indicated the protein-DNA complex formed by tested proteins and plasmids. Asterisks indicated the two conformations of plasmid DNA, including the relaxed form (Form I), and another was the supercoiled form (Form II)

    Journal: BMC Veterinary Research

    Article Title: Characterization of the DNA binding activity of structural protein VP1 from chicken anaemia virus

    doi: 10.1186/s12917-018-1465-5

    Figure Lengend Snippet: The VP1 protein has DNA-binding ability with no sequence specificity. The recombinant GST and GST-fused proteins were prepared by E. coli overexpression and purified through GST affinity chromatography. Purified results were analysed by SDS-PAGE with Coomassie blue staining and Western blotting with an anti-GST monoclonal antibody or anti-C-ter-VP1 polyclonal antibody ( a ). The purified proteins were used for DNA binding ability by an agarose gel shift assay with different DNA sequences of plasmid preparation of pcDNA3.1 ( b ), of the pGEM-T easy vector ( c ), and of pCAV containing the whole CAV genome ( d ). The binding activity of the VP1 protein was determined by comparing the existence of DNA fragments for the protein-DNA complex and DNA patterns from the blank (no-protein used), negative control (GST only) and positive control (GST-VP3). To confirm the observed DNA migration results that were induced by bound recombinant proteins, the protein-DNA experimental samples were mixed with 1% SDS as a protein denaturant (underline lane-labelled 1% SDS). Lane M, DNA ladder marker. Bold triangles indicated the protein-DNA complex formed by tested proteins and plasmids. Asterisks indicated the two conformations of plasmid DNA, including the relaxed form (Form I), and another was the supercoiled form (Form II)

    Article Snippet: The circular dsDNA, pcDNA3.1 (#V80020, Invitrogen, USA), pGEM-T easy vector (#A1360, Promega, USA) and pCAV were used for the DNA binding assay.

    Techniques: Binding Assay, Sequencing, Recombinant, Over Expression, Purification, Affinity Chromatography, SDS Page, Staining, Western Blot, Agarose Gel Electrophoresis, Shift Assay, Plasmid Preparation, Activity Assay, Negative Control, Positive Control, Migration, Marker

    In vitro transcription of coat protein gene of CMV. Complementary RNAs were produced by transcription of coat protein gene of the CMV isolates cloned in the pGEM-T easy vector in both orientations. Transcript of 701 nt long of anti-sense strand (AUR) and 691 nt long sense strand (PUNE) were generated using Promega Riboprobe Kit. Transcript of pGEM-T easy was used as control. DNA marker of 1 kb was used

    Journal: VirusDisease

    Article Title: Dicer 1 of Candida albicans cleaves plant viral dsRNA in vitro and provides tolerance in plants against virus infection

    doi: 10.1007/s13337-019-00520-x

    Figure Lengend Snippet: In vitro transcription of coat protein gene of CMV. Complementary RNAs were produced by transcription of coat protein gene of the CMV isolates cloned in the pGEM-T easy vector in both orientations. Transcript of 701 nt long of anti-sense strand (AUR) and 691 nt long sense strand (PUNE) were generated using Promega Riboprobe Kit. Transcript of pGEM-T easy was used as control. DNA marker of 1 kb was used

    Article Snippet: Cloning and in vitro transcription of the coat protein gene (CP) of CMV The CP genes of two CMV isolates (Tfr-In and Pun-In) were amplified using specific primers (BM05F: 5′AGTCGAGTCATGGACAAATC 3′ and BM06R: 5′TTAGACTGGGAGCACCC 3′) and cloned in pGEM-T Easy vector in both orientations (sense i.e. Pun-In isolate and anti-sense i.e. Aur-In isolate) at Eco RI sites [ ].

    Techniques: In Vitro, Produced, Clone Assay, Plasmid Preparation, Generated, Marker

    Disruption and complementation of FST1 . (A) A hygromycin‐resistance cassette (HYG R ) was inserted into the FST1 gene by homologous recombination to create a Δ fst1 strain. For complementation, protoplasts of Δ fst1 were co‐transformed with pHT‐10 (constructed by cloning the FST1 locus into the pGEM‐T‐Easy vector; dashed lines represent vector sequence) and pKS‐GEN, a vector harbouring a geneticin resistance cassette. For Southern analysis, genomic DNA was digested with Cla I (C) and probed with a 473‐bp region of FST1 (P). (B) The presence or absence of FST1 was verified by Southern analysis in the wild‐type (lane 1), Δ fst1 (lane 2), FST‐COMP1 (lane 3) and FST‐COMP2 (lane 4) strains. Integration of pHT‐10 was ectopic in the transformants, and the FST‐COMP1 strain appeared to contain two copies of the complementation construct and thus was not used in subsequent experiments.

    Journal: Molecular Plant Pathology

    Article Title: Involvement of ZFR1 of Fusarium verticillioides in kernel colonization and the regulation of FST1, a putative sugar transporter gene required for fumonisin biosynthesis on maize kernels

    doi: 10.1111/j.1364-3703.2007.00458.x

    Figure Lengend Snippet: Disruption and complementation of FST1 . (A) A hygromycin‐resistance cassette (HYG R ) was inserted into the FST1 gene by homologous recombination to create a Δ fst1 strain. For complementation, protoplasts of Δ fst1 were co‐transformed with pHT‐10 (constructed by cloning the FST1 locus into the pGEM‐T‐Easy vector; dashed lines represent vector sequence) and pKS‐GEN, a vector harbouring a geneticin resistance cassette. For Southern analysis, genomic DNA was digested with Cla I (C) and probed with a 473‐bp region of FST1 (P). (B) The presence or absence of FST1 was verified by Southern analysis in the wild‐type (lane 1), Δ fst1 (lane 2), FST‐COMP1 (lane 3) and FST‐COMP2 (lane 4) strains. Integration of pHT‐10 was ectopic in the transformants, and the FST‐COMP1 strain appeared to contain two copies of the complementation construct and thus was not used in subsequent experiments.

    Article Snippet: A 3.6‐kb fusion product was amplified from the three individual templates with nested primers FST1‐nF/FST1‐nR and was cloned into the pGEM‐T‐Easy vector (Promega) to create pFST1‐KO.

    Techniques: Homologous Recombination, Transformation Assay, Construct, Clone Assay, Plasmid Preparation, Sequencing

    NP-1 real-time PCR assay showing representative results obtained with serial 10-fold dilutions (10 1 to 10 8 copies per reaction) of the pGEM-T NP-1 HBoV2 plasmid, run in triplicate. The left panel shows baseline subtractive curve fit views of the data

    Journal: Journal of Clinical Microbiology

    Article Title: Development of a Real-Time PCR Assay for Detecting and Quantifying Human Bocavirus 2 ▿

    doi: 10.1128/JCM.00196-10

    Figure Lengend Snippet: NP-1 real-time PCR assay showing representative results obtained with serial 10-fold dilutions (10 1 to 10 8 copies per reaction) of the pGEM-T NP-1 HBoV2 plasmid, run in triplicate. The left panel shows baseline subtractive curve fit views of the data

    Article Snippet: The product was cloned into plasmid vector pGEM-T Easy vector (Promega, Madison, WI) and sequenced for verification (GenBank accession no. ).

    Techniques: Real-time Polymerase Chain Reaction, Plasmid Preparation