Structured Review

Promega λdna mc
Heat map of distributions of reads acquired from next-generation bisulfite sequencing. Three independent preparations of ESC mitochondrial nucleic acid (mtNA) (E1, E2 and E3), two independent preparations of brain mtNA (B1 and B2), two independent preparations of liver mtNA (L1 and L2) and a preparation of synthetic mtDNA (S1) were subjected to bisulfite conversion for 5, 15, 40, 60 and 90 min (5, 15, 40, 60 and 90) and a total of 24 bisulfite-converted samples (Table 1 ) were deep-sequenced. Reads were sorted to corresponding samples with distinctions between L stands (L) and H strands (H) of mtDNA ( a ), and between plus strands (p) and minus strands (m) of spiked <t>λDNA</t> −mC ( b ). Unconversion rates of cytosines in each read were calculated from statuses (converted or unconverted) of all cytosines in the read, and were expressed as percentages. Reads were then categorised with 10% increments of unconversion rates, and distributions of the reads in each increment block were calculated as percentages and are presented in heat maps; colour changes from white to red indicate from 0% to 100%. Calculated percentages of read distributions in increment blocks for each read assembly are shown in Supplementary Fig. S2e,f .
λdna Mc, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 37127 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/λdna mc/product/Promega
Average 92 stars, based on 37127 article reviews
Price from $9.99 to $1999.99
λdna mc - by Bioz Stars, 2020-08
92/100 stars

Images

1) Product Images from "Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA"

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA

Journal: Scientific Reports

doi: 10.1038/s41598-018-24251-z

Heat map of distributions of reads acquired from next-generation bisulfite sequencing. Three independent preparations of ESC mitochondrial nucleic acid (mtNA) (E1, E2 and E3), two independent preparations of brain mtNA (B1 and B2), two independent preparations of liver mtNA (L1 and L2) and a preparation of synthetic mtDNA (S1) were subjected to bisulfite conversion for 5, 15, 40, 60 and 90 min (5, 15, 40, 60 and 90) and a total of 24 bisulfite-converted samples (Table 1 ) were deep-sequenced. Reads were sorted to corresponding samples with distinctions between L stands (L) and H strands (H) of mtDNA ( a ), and between plus strands (p) and minus strands (m) of spiked λDNA −mC ( b ). Unconversion rates of cytosines in each read were calculated from statuses (converted or unconverted) of all cytosines in the read, and were expressed as percentages. Reads were then categorised with 10% increments of unconversion rates, and distributions of the reads in each increment block were calculated as percentages and are presented in heat maps; colour changes from white to red indicate from 0% to 100%. Calculated percentages of read distributions in increment blocks for each read assembly are shown in Supplementary Fig. S2e,f .
Figure Legend Snippet: Heat map of distributions of reads acquired from next-generation bisulfite sequencing. Three independent preparations of ESC mitochondrial nucleic acid (mtNA) (E1, E2 and E3), two independent preparations of brain mtNA (B1 and B2), two independent preparations of liver mtNA (L1 and L2) and a preparation of synthetic mtDNA (S1) were subjected to bisulfite conversion for 5, 15, 40, 60 and 90 min (5, 15, 40, 60 and 90) and a total of 24 bisulfite-converted samples (Table 1 ) were deep-sequenced. Reads were sorted to corresponding samples with distinctions between L stands (L) and H strands (H) of mtDNA ( a ), and between plus strands (p) and minus strands (m) of spiked λDNA −mC ( b ). Unconversion rates of cytosines in each read were calculated from statuses (converted or unconverted) of all cytosines in the read, and were expressed as percentages. Reads were then categorised with 10% increments of unconversion rates, and distributions of the reads in each increment block were calculated as percentages and are presented in heat maps; colour changes from white to red indicate from 0% to 100%. Calculated percentages of read distributions in increment blocks for each read assembly are shown in Supplementary Fig. S2e,f .

Techniques Used: Methylation Sequencing, Blocking Assay

Analysis of methylation status of mtDNA by next-generation bisulfite sequencing. ( a – c ) Cytosine unconversion rates at cytosine sites with coverage of ≥10 in whole mtDNA of an ESC mtNA preparation (E2) ( a ), λDNA −mC mixed as an internal control ( b ) and the control region (CR) of the mtDNA ( c ) are plotted according to nucleotide numbers (X axis) from 1 to 16,299 for mtDNA, from 1 to 48,502 for λDNA −mC and from15,423 to 16,034 for the CR, and unconversion rates in percentages (Y axis). Nucleotide positions on X axes are shown below graph fields. Plots for L strands of mtDNA and plus strands of λDNA −mC are shown above X axes with percentages of unconversion increasing upwards, and H strands and minus strands below X axes downwards. Graphs with higher resolution are shown in Supplementary Fig. S3 . ( d,e ) Average unconversion rates of cytosines with coverage of ≥10 in whole mtDNA and λDNA −mC . For each sample shown are average unconversion rates of all cytosines in CN (N = A, G, C and T), CG and non-CG sequences in L strands and H strands of whole mtDNA (L/CN, L/CG, L/CH, H/CN, H/CG and H/CH, respectively) ( d ) and in plus strands and minus strands of λDNA −mC (p/CN, p/CG, p/CH, m/CN, m/CG and m/CH, respectively) ( e ). Percentages of unconverted cytosines in L/CN, H/CN, p/CN and m/CN are shown above the bars. ( f ) Comparisons of average unconversion rates of cytosines with coverage of ≥10 in L strands and H strands of the CR of mtDNA and whole mtDNA (CR_L/CN, CR_H/CN, L/CN and H/CN, respectively). Sample names are presented as in Fig. 2 .
Figure Legend Snippet: Analysis of methylation status of mtDNA by next-generation bisulfite sequencing. ( a – c ) Cytosine unconversion rates at cytosine sites with coverage of ≥10 in whole mtDNA of an ESC mtNA preparation (E2) ( a ), λDNA −mC mixed as an internal control ( b ) and the control region (CR) of the mtDNA ( c ) are plotted according to nucleotide numbers (X axis) from 1 to 16,299 for mtDNA, from 1 to 48,502 for λDNA −mC and from15,423 to 16,034 for the CR, and unconversion rates in percentages (Y axis). Nucleotide positions on X axes are shown below graph fields. Plots for L strands of mtDNA and plus strands of λDNA −mC are shown above X axes with percentages of unconversion increasing upwards, and H strands and minus strands below X axes downwards. Graphs with higher resolution are shown in Supplementary Fig. S3 . ( d,e ) Average unconversion rates of cytosines with coverage of ≥10 in whole mtDNA and λDNA −mC . For each sample shown are average unconversion rates of all cytosines in CN (N = A, G, C and T), CG and non-CG sequences in L strands and H strands of whole mtDNA (L/CN, L/CG, L/CH, H/CN, H/CG and H/CH, respectively) ( d ) and in plus strands and minus strands of λDNA −mC (p/CN, p/CG, p/CH, m/CN, m/CG and m/CH, respectively) ( e ). Percentages of unconverted cytosines in L/CN, H/CN, p/CN and m/CN are shown above the bars. ( f ) Comparisons of average unconversion rates of cytosines with coverage of ≥10 in L strands and H strands of the CR of mtDNA and whole mtDNA (CR_L/CN, CR_H/CN, L/CN and H/CN, respectively). Sample names are presented as in Fig. 2 .

Techniques Used: Methylation, Methylation Sequencing

Bisulfite sequencing of cytochrome b gene region of ESC mtDNA. Three independent preparations of embryonic stem cell (ESC) mtDNA (ESC preps. i–iii) were examined by bisulfite sequencing. After bisulfite conversion, L and H strands of the cytochrome b gene region were PCR-amplified and cloned into T-vectors. Average unconversion rates of cytosines at CG sequences (CG) and those at non-CG sequences [CH (H = A, G and T)] in the cloned fragments were obtained from sequencing data for inserts of each plasmid clone, and means of average rates were calculated with SEM for L strands (L) and H strands (H). Data are presented as percentages. A region of control λDNA −mC was also analysed to confirm conversion efficiency of the reactions (λ). n indicates the number of clones analysed in each category.
Figure Legend Snippet: Bisulfite sequencing of cytochrome b gene region of ESC mtDNA. Three independent preparations of embryonic stem cell (ESC) mtDNA (ESC preps. i–iii) were examined by bisulfite sequencing. After bisulfite conversion, L and H strands of the cytochrome b gene region were PCR-amplified and cloned into T-vectors. Average unconversion rates of cytosines at CG sequences (CG) and those at non-CG sequences [CH (H = A, G and T)] in the cloned fragments were obtained from sequencing data for inserts of each plasmid clone, and means of average rates were calculated with SEM for L strands (L) and H strands (H). Data are presented as percentages. A region of control λDNA −mC was also analysed to confirm conversion efficiency of the reactions (λ). n indicates the number of clones analysed in each category.

Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing, Plasmid Preparation

2) Product Images from "Molecular characterization of Drosophila cells persistently infected with Flock House virus"

Article Title: Molecular characterization of Drosophila cells persistently infected with Flock House virus

Journal: Virology

doi: 10.1016/j.virol.2011.08.002

Profile of vsiRNAs in lytically and persistently infected DL-1 cells ( A ). The region of RNA1 giving rise to the subgenomic RNA3 is shaded in gray. ( B ) Schematic diagram of PCR fragments used for mapping of vsiRNAs in the current study. ( C ) Mapping of vsiRNAs along the FHV genome. Lane numbers correspond to PCR fragments shown in panel B. vsiRNAs were extracted at 12 hpi (LI-12 hpi), 24 hpi (LI-24 hpi) or 36 hpi (LI-36 hpi) from DL-1 cells lytically infected with FHV at an moi of 1. Additionally, vsiRNAs were isolated from four different DL1 cell lines persistently infected with FHV. vsiRNAs were radioactively labeled and hybridized to DNA fragments representing defined portions of FHV RNA1 and RNA2. For each blot, the corresponding EtBr-stained gel is presented as a loading control. A 250-nt-long NoV fragment was loaded in the rightmost lane as a negative control.
Figure Legend Snippet: Profile of vsiRNAs in lytically and persistently infected DL-1 cells ( A ). The region of RNA1 giving rise to the subgenomic RNA3 is shaded in gray. ( B ) Schematic diagram of PCR fragments used for mapping of vsiRNAs in the current study. ( C ) Mapping of vsiRNAs along the FHV genome. Lane numbers correspond to PCR fragments shown in panel B. vsiRNAs were extracted at 12 hpi (LI-12 hpi), 24 hpi (LI-24 hpi) or 36 hpi (LI-36 hpi) from DL-1 cells lytically infected with FHV at an moi of 1. Additionally, vsiRNAs were isolated from four different DL1 cell lines persistently infected with FHV. vsiRNAs were radioactively labeled and hybridized to DNA fragments representing defined portions of FHV RNA1 and RNA2. For each blot, the corresponding EtBr-stained gel is presented as a loading control. A 250-nt-long NoV fragment was loaded in the rightmost lane as a negative control.

Techniques Used: Infection, Polymerase Chain Reaction, Isolation, Labeling, Staining, Negative Control

3) Product Images from "Effect of Dynamic DNA Methylation and Histone Acetylation on cPouV Expression in Differentiation of Chick Embryonic Germ Cells"

Article Title: Effect of Dynamic DNA Methylation and Histone Acetylation on cPouV Expression in Differentiation of Chick Embryonic Germ Cells

Journal: Stem Cells and Development

doi: 10.1089/scd.2013.0046

Luciferase reporter assay of various plasmid constructs in HEK293T cells. The firefly luciferase reporter plasmid pGL3-Basic-0.6 or pGL3-Basic-1.0 was cotransfected with pU6B-Renilla reporter using Lipofectamine 2000. At 24 and 48 h, the luciferase reporter activities were assayed using the Dual-Luciferase Reporter Assay System. The firefly luciferase activities were normalized for analyses using Renilla luciferase activities (* p
Figure Legend Snippet: Luciferase reporter assay of various plasmid constructs in HEK293T cells. The firefly luciferase reporter plasmid pGL3-Basic-0.6 or pGL3-Basic-1.0 was cotransfected with pU6B-Renilla reporter using Lipofectamine 2000. At 24 and 48 h, the luciferase reporter activities were assayed using the Dual-Luciferase Reporter Assay System. The firefly luciferase activities were normalized for analyses using Renilla luciferase activities (* p

Techniques Used: Luciferase, Reporter Assay, Plasmid Preparation, Construct

4) Product Images from "Nanos3 Gene Targeting in Medaka ES Cells"

Article Title: Nanos3 Gene Targeting in Medaka ES Cells

Journal: International Journal of Biological Sciences

doi: 10.7150/ijbs.6507

Differentiation in vitro. (A) EB formation. MES1, parental ES cell line; A15, nanos3-targeted clone derived from MES1. MES1 and A15 were genetically labeled by RFP and GFP, respectively, and mixed at a 1:1 ratio and seeded onto cell culture Petri dishes. Shown is an EB at day 18 post suspension culture. Scale bars, 200 µm. (B) Gene expression profile of MES1 line and its nanos3-targeted clones (A15 and B2). ES cells were maintained in adherent culture for undifferentiated (Undiff) growth or for induced differentiation (Diff) by EB formation in suspension culture for 10 days. Numbers of PCR cycles are indicated to the right. Genes chosen are markers for pluripotency (oct4 and nanog) and differentiated lineages (nf200, ectoderm; ntl, mesoderm; sox17, endoderm). β-actin served as a loading control. Neg, negative control by using H 2 O as a template. Notably, the nanos3 RNA was barely detectable in all samples.
Figure Legend Snippet: Differentiation in vitro. (A) EB formation. MES1, parental ES cell line; A15, nanos3-targeted clone derived from MES1. MES1 and A15 were genetically labeled by RFP and GFP, respectively, and mixed at a 1:1 ratio and seeded onto cell culture Petri dishes. Shown is an EB at day 18 post suspension culture. Scale bars, 200 µm. (B) Gene expression profile of MES1 line and its nanos3-targeted clones (A15 and B2). ES cells were maintained in adherent culture for undifferentiated (Undiff) growth or for induced differentiation (Diff) by EB formation in suspension culture for 10 days. Numbers of PCR cycles are indicated to the right. Genes chosen are markers for pluripotency (oct4 and nanog) and differentiated lineages (nf200, ectoderm; ntl, mesoderm; sox17, endoderm). β-actin served as a loading control. Neg, negative control by using H 2 O as a template. Notably, the nanos3 RNA was barely detectable in all samples.

Techniques Used: In Vitro, Derivative Assay, Labeling, Cell Culture, Expressing, Clone Assay, Polymerase Chain Reaction, Negative Control

Allelic polymorphism of the nanos3 locus in medaka. (A) Schematic structure of WTa and WTb alleles. N, NheI; S, SphI; X, XbaI. Polymorphic sites are highlighted in bold color. Arrowheads depict primers for PCR analyses. (B) PCR analyses. PCR was run using primers indicated. PCR products were not digested (-) or digested (+) with XbaI or SphI and separated on agarose gels. Medaka strains (HB32C and HdrR), MES1 and GT sublines are indicated. Arrows depict digested products. Sizes in bp are given to the right. (C) Sequences of WTa and WTb spanning the polymorphic XbaI site, which is located in the region upstream of the 5' homology arm. (D) Sequences of WTa and WTb spanning the polymorphic SphI site, which is located in the region downstream of the 3' homology arm. broken underline, absence of the site; solid underline, presence of the site.
Figure Legend Snippet: Allelic polymorphism of the nanos3 locus in medaka. (A) Schematic structure of WTa and WTb alleles. N, NheI; S, SphI; X, XbaI. Polymorphic sites are highlighted in bold color. Arrowheads depict primers for PCR analyses. (B) PCR analyses. PCR was run using primers indicated. PCR products were not digested (-) or digested (+) with XbaI or SphI and separated on agarose gels. Medaka strains (HB32C and HdrR), MES1 and GT sublines are indicated. Arrows depict digested products. Sizes in bp are given to the right. (C) Sequences of WTa and WTb spanning the polymorphic XbaI site, which is located in the region upstream of the 5' homology arm. (D) Sequences of WTa and WTb spanning the polymorphic SphI site, which is located in the region downstream of the 3' homology arm. broken underline, absence of the site; solid underline, presence of the site.

Techniques Used: Polymerase Chain Reaction

Schematic nanos3 gene targeting in medaka ES cells. arrowhead, positions and extension directions of PCR primers for genotyping; cross, HR region: gfp:neo, cassette that expresses the fusion between GFP and Neo; STk, the cassette expresses HSP-tk; S, SphI.
Figure Legend Snippet: Schematic nanos3 gene targeting in medaka ES cells. arrowhead, positions and extension directions of PCR primers for genotyping; cross, HR region: gfp:neo, cassette that expresses the fusion between GFP and Neo; STk, the cassette expresses HSP-tk; S, SphI.

Techniques Used: Polymerase Chain Reaction

5) Product Images from "Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species"

Article Title: Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.43.3.1171-1176.2005

Simple sequence alignment of the ITS regions of several Bartonella species (homology A) and Bartonella and Mesorhizobium species (homology B). High-homology regions are in gray. Arrows (locations of primers used in this work): I, H56s; II, H493as; III, J1; IV, J2; V, 321s; VI, 983as.
Figure Legend Snippet: Simple sequence alignment of the ITS regions of several Bartonella species (homology A) and Bartonella and Mesorhizobium species (homology B). High-homology regions are in gray. Arrows (locations of primers used in this work): I, H56s; II, H493as; III, J1; IV, J2; V, 321s; VI, 983as.

Techniques Used: Sequencing

6) Product Images from "Effect of Dynamic DNA Methylation and Histone Acetylation on cPouV Expression in Differentiation of Chick Embryonic Germ Cells"

Article Title: Effect of Dynamic DNA Methylation and Histone Acetylation on cPouV Expression in Differentiation of Chick Embryonic Germ Cells

Journal: Stem Cells and Development

doi: 10.1089/scd.2013.0046

Histone H3 acetylation states of cPouV and the expression of HAT and HDAC 3 in EG cells and EBs. (A) Schematic representation of the cPouV gene. Numbers depict the positions of primer pairs used for ChIP relative to TSS. (B) A representative electrophoresis photograph of ChIP analysis of histone acetylation in corresponding regions of cPouV in EG ( upper ) and EB ( lower ) cells. (C) Quantitation of PCR signals in (B) . Data are expressed as percent precipitated relative to input DNA. The ratio of signals at EG cells was set as 1. (D) The relative expression of HAT and HDAC 3 analyzed by real-time PCR in EG cells and EBs. The relative fold change in EG cells was normalized as 1 (* p
Figure Legend Snippet: Histone H3 acetylation states of cPouV and the expression of HAT and HDAC 3 in EG cells and EBs. (A) Schematic representation of the cPouV gene. Numbers depict the positions of primer pairs used for ChIP relative to TSS. (B) A representative electrophoresis photograph of ChIP analysis of histone acetylation in corresponding regions of cPouV in EG ( upper ) and EB ( lower ) cells. (C) Quantitation of PCR signals in (B) . Data are expressed as percent precipitated relative to input DNA. The ratio of signals at EG cells was set as 1. (D) The relative expression of HAT and HDAC 3 analyzed by real-time PCR in EG cells and EBs. The relative fold change in EG cells was normalized as 1 (* p

Techniques Used: Expressing, HAT Assay, Chromatin Immunoprecipitation, Electrophoresis, Quantitation Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

7) Product Images from "Nanos3 Gene Targeting in Medaka ES Cells"

Article Title: Nanos3 Gene Targeting in Medaka ES Cells

Journal: International Journal of Biological Sciences

doi: 10.7150/ijbs.6507

Differentiation in vitro. (A) EB formation. MES1, parental ES cell line; A15, nanos3-targeted clone derived from MES1. MES1 and A15 were genetically labeled by RFP and GFP, respectively, and mixed at a 1:1 ratio and seeded onto cell culture Petri dishes. Shown is an EB at day 18 post suspension culture. Scale bars, 200 µm. (B) Gene expression profile of MES1 line and its nanos3-targeted clones (A15 and B2). ES cells were maintained in adherent culture for undifferentiated (Undiff) growth or for induced differentiation (Diff) by EB formation in suspension culture for 10 days. Numbers of PCR cycles are indicated to the right. Genes chosen are markers for pluripotency (oct4 and nanog) and differentiated lineages (nf200, ectoderm; ntl, mesoderm; sox17, endoderm). β-actin served as a loading control. Neg, negative control by using H 2 O as a template. Notably, the nanos3 RNA was barely detectable in all samples.
Figure Legend Snippet: Differentiation in vitro. (A) EB formation. MES1, parental ES cell line; A15, nanos3-targeted clone derived from MES1. MES1 and A15 were genetically labeled by RFP and GFP, respectively, and mixed at a 1:1 ratio and seeded onto cell culture Petri dishes. Shown is an EB at day 18 post suspension culture. Scale bars, 200 µm. (B) Gene expression profile of MES1 line and its nanos3-targeted clones (A15 and B2). ES cells were maintained in adherent culture for undifferentiated (Undiff) growth or for induced differentiation (Diff) by EB formation in suspension culture for 10 days. Numbers of PCR cycles are indicated to the right. Genes chosen are markers for pluripotency (oct4 and nanog) and differentiated lineages (nf200, ectoderm; ntl, mesoderm; sox17, endoderm). β-actin served as a loading control. Neg, negative control by using H 2 O as a template. Notably, the nanos3 RNA was barely detectable in all samples.

Techniques Used: In Vitro, Derivative Assay, Labeling, Cell Culture, Expressing, Clone Assay, Polymerase Chain Reaction, Negative Control

Allelic polymorphism of the nanos3 locus in medaka. (A) Schematic structure of WTa and WTb alleles. N, NheI; S, SphI; X, XbaI. Polymorphic sites are highlighted in bold color. Arrowheads depict primers for PCR analyses. (B) PCR analyses. PCR was run using primers indicated. PCR products were not digested (-) or digested (+) with XbaI or SphI and separated on agarose gels. Medaka strains (HB32C and HdrR), MES1 and GT sublines are indicated. Arrows depict digested products. Sizes in bp are given to the right. (C) Sequences of WTa and WTb spanning the polymorphic XbaI site, which is located in the region upstream of the 5' homology arm. (D) Sequences of WTa and WTb spanning the polymorphic SphI site, which is located in the region downstream of the 3' homology arm. broken underline, absence of the site; solid underline, presence of the site.
Figure Legend Snippet: Allelic polymorphism of the nanos3 locus in medaka. (A) Schematic structure of WTa and WTb alleles. N, NheI; S, SphI; X, XbaI. Polymorphic sites are highlighted in bold color. Arrowheads depict primers for PCR analyses. (B) PCR analyses. PCR was run using primers indicated. PCR products were not digested (-) or digested (+) with XbaI or SphI and separated on agarose gels. Medaka strains (HB32C and HdrR), MES1 and GT sublines are indicated. Arrows depict digested products. Sizes in bp are given to the right. (C) Sequences of WTa and WTb spanning the polymorphic XbaI site, which is located in the region upstream of the 5' homology arm. (D) Sequences of WTa and WTb spanning the polymorphic SphI site, which is located in the region downstream of the 3' homology arm. broken underline, absence of the site; solid underline, presence of the site.

Techniques Used: Polymerase Chain Reaction

Analyses of nanos3 gene targeting. (A) Predicted number and size of WT and GT alleles of genomic digests as detected by three probes. For detailed information on the positions of probes and sites for XbaI and SphI see Figure 2 and Figure 3 . (B) Southern blot of XbaI digests probed with Int. (C) Southern blot of NheI/SphI digests probed with Ext (left panel) followed by reprobing with gfp:neo (right panel). WT alleles (WTa and WTb) are depicted by arrowheads. GT alleles are highlighted by hash (GTa) or asterisks (GTb). ®, putative RI bands. Parental MES1 is negative for probe gfp:neo .
Figure Legend Snippet: Analyses of nanos3 gene targeting. (A) Predicted number and size of WT and GT alleles of genomic digests as detected by three probes. For detailed information on the positions of probes and sites for XbaI and SphI see Figure 2 and Figure 3 . (B) Southern blot of XbaI digests probed with Int. (C) Southern blot of NheI/SphI digests probed with Ext (left panel) followed by reprobing with gfp:neo (right panel). WT alleles (WTa and WTb) are depicted by arrowheads. GT alleles are highlighted by hash (GTa) or asterisks (GTb). ®, putative RI bands. Parental MES1 is negative for probe gfp:neo .

Techniques Used: Southern Blot

Retention of pluripotency in vitro . (A) Phenotype of growing ES cells of parental MES1 and nanos3 -targeted clones. (B) AP staining of parental MES1 and nanos3 -targeted clones. (C) Expression of pluripotency genes in parental MES1 and nanos3 -targeted clones (numerals on lanes). neg, negative control without cDNA template.
Figure Legend Snippet: Retention of pluripotency in vitro . (A) Phenotype of growing ES cells of parental MES1 and nanos3 -targeted clones. (B) AP staining of parental MES1 and nanos3 -targeted clones. (C) Expression of pluripotency genes in parental MES1 and nanos3 -targeted clones (numerals on lanes). neg, negative control without cDNA template.

Techniques Used: In Vitro, Staining, Expressing, Clone Assay, Negative Control

Schematic nanos3 gene targeting in medaka ES cells. arrowhead, positions and extension directions of PCR primers for genotyping; cross, HR region: gfp:neo, cassette that expresses the fusion between GFP and Neo; STk, the cassette expresses HSP-tk; S, SphI.
Figure Legend Snippet: Schematic nanos3 gene targeting in medaka ES cells. arrowhead, positions and extension directions of PCR primers for genotyping; cross, HR region: gfp:neo, cassette that expresses the fusion between GFP and Neo; STk, the cassette expresses HSP-tk; S, SphI.

Techniques Used: Polymerase Chain Reaction

8) Product Images from "Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species"

Article Title: Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.43.3.1171-1176.2005

Simple sequence alignment of the ITS regions of several Bartonella species (homology A) and Bartonella and Mesorhizobium species (homology B). High-homology regions are in gray. Arrows (locations of primers used in this work): I, H56s; II, H493as; III, J1; IV, J2; V, 321s; VI, 983as.
Figure Legend Snippet: Simple sequence alignment of the ITS regions of several Bartonella species (homology A) and Bartonella and Mesorhizobium species (homology B). High-homology regions are in gray. Arrows (locations of primers used in this work): I, H56s; II, H493as; III, J1; IV, J2; V, 321s; VI, 983as.

Techniques Used: Sequencing

Amplification of Bartonella ). Lanes: 1, 1-kbp DNA ladder; 2, B. clarridgeiae ; 3, B. elizabethae ; 4, B. henselae Houston-1; 5, B. quintana Fuller; 6, B. vinsonii subsp. berkhoffii ; 7, B. bovis ; 8, E. coli ; 9 and 10, PCR negative controls with molecular-grade water (two different manufacturers); 11, PCR negative control with non-molecular-grade water (sterile water for injection, drug diluent use); 12, 1-kbp DNA ladder. Arrows, 200-bp marker.
Figure Legend Snippet: Amplification of Bartonella ). Lanes: 1, 1-kbp DNA ladder; 2, B. clarridgeiae ; 3, B. elizabethae ; 4, B. henselae Houston-1; 5, B. quintana Fuller; 6, B. vinsonii subsp. berkhoffii ; 7, B. bovis ; 8, E. coli ; 9 and 10, PCR negative controls with molecular-grade water (two different manufacturers); 11, PCR negative control with non-molecular-grade water (sterile water for injection, drug diluent use); 12, 1-kbp DNA ladder. Arrows, 200-bp marker.

Techniques Used: Amplification, Polymerase Chain Reaction, Negative Control, Injection, Marker

9) Product Images from "The DnaA Protein Is Not the Limiting Factor for Initiation of Replication in Escherichia coli"

Article Title: The DnaA Protein Is Not the Limiting Factor for Initiation of Replication in Escherichia coli

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1005276

DiaA can hold back premature and rifampicin resistant initiations. Flow cytometry DNA histograms of wild type cells (MG1655 with pACYC184, IF26) (left histogram), Δ datA cells with pACYC184 (IF104) (middle histogram) and Δ datA cells with pACYC184 diaA (IF105) (right histogram) grown in acetate medium (A) or GluCAA medium (B). For the cells grown in acetate DNA histograms of exponentially growing cells are shown, while for the cells grown in GluCAA the rifampicin run-out histograms are shown. See legend to Fig 1 for further details. For the cells grown in acetate the initiation ages of the Δ datA cells without (light grey bar) or with (dark grey bar) extra DiaA relative to the wild type control (black bar) are shown in the bar histogram in the rightmost panel. The values are an average of three experiments and the error bars represent the standard deviation. For the cells grown in GluCAA the average number of chromosomes for the Δ datA cells without (light grey bar) or with (dark grey bar) extra DiaA relative to the wild type control (black bar) are shown in the bar histogram in the rightmost panel. The values are an average of three experiments and the error bars represent the standard deviation.
Figure Legend Snippet: DiaA can hold back premature and rifampicin resistant initiations. Flow cytometry DNA histograms of wild type cells (MG1655 with pACYC184, IF26) (left histogram), Δ datA cells with pACYC184 (IF104) (middle histogram) and Δ datA cells with pACYC184 diaA (IF105) (right histogram) grown in acetate medium (A) or GluCAA medium (B). For the cells grown in acetate DNA histograms of exponentially growing cells are shown, while for the cells grown in GluCAA the rifampicin run-out histograms are shown. See legend to Fig 1 for further details. For the cells grown in acetate the initiation ages of the Δ datA cells without (light grey bar) or with (dark grey bar) extra DiaA relative to the wild type control (black bar) are shown in the bar histogram in the rightmost panel. The values are an average of three experiments and the error bars represent the standard deviation. For the cells grown in GluCAA the average number of chromosomes for the Δ datA cells without (light grey bar) or with (dark grey bar) extra DiaA relative to the wild type control (black bar) are shown in the bar histogram in the rightmost panel. The values are an average of three experiments and the error bars represent the standard deviation.

Techniques Used: Flow Cytometry, Cytometry, Standard Deviation

10) Product Images from "Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species"

Article Title: Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.43.3.1171-1176.2005

Simple sequence alignment of the ITS regions of several Bartonella species (homology A) and Bartonella and Mesorhizobium species (homology B). High-homology regions are in gray. Arrows (locations of primers used in this work): I, H56s; II, H493as; III, J1; IV, J2; V, 321s; VI, 983as.
Figure Legend Snippet: Simple sequence alignment of the ITS regions of several Bartonella species (homology A) and Bartonella and Mesorhizobium species (homology B). High-homology regions are in gray. Arrows (locations of primers used in this work): I, H56s; II, H493as; III, J1; IV, J2; V, 321s; VI, 983as.

Techniques Used: Sequencing

Related Articles

Clone Assay:

Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Amplification:

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Agarose Gel Electrophoresis:

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Purification:

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Polymerase Chain Reaction:

Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Activity Assay:

Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

DNA Sequencing:

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Sequencing:

Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

Plasmid Preparation:

Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pgem t easy
    Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy/product/Promega
    Average 99 stars, based on 171 article reviews
    Price from $9.99 to $1999.99
    pgem t easy - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results