Structured Review

Agilent technologies pfuultra high fidelity dnapol
Pfuultra High Fidelity Dnapol, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pfuultra high fidelity dnapol/product/Agilent technologies
Average 87 stars, based on 1 article reviews
Price from $9.99 to $1999.99
pfuultra high fidelity dnapol - by Bioz Stars, 2020-04
87/100 stars

Images

Related Articles

Transduction:

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs. .. The inserts in each individual clone were sequenced using M13 primers (DNA sequencing facility of Division of Signal Transduction Therapy at the University of Dundee).

Clone Assay:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Paragraph title: Cloning of pre-miRNA regions ... Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C.

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: Paragraph title: Cloning of the zebra finch FoxP2 3′-UTR. ... PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: The fragment was cloned into Pst I-Sac I sites of pREP1 ( ) using the In-Fusion HD Cloning Kit (TaKaRa bio, catalog number 639649). .. The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385).

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: Selected clones lacking expression of Rab10 were sequenced to confirm the KO. .. The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs.

Amplification:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. .. The amplified fragments were purified with PCR purification kit (Qiagen) and analyzed on 1.5% agarose gels.

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: We amplified two overlapping cDNA fragments, and ligated the two fragments to obtain a full-length FoxP2 3′-UTR. .. PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: The three fragments were mixed and amplified with primers KT1910-KT1913 to obtain 2,435 bp of concatenated DNA fragment. .. The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385).

Article Title: Metabolically Stabilized Double Stranded mRNA Polyplexes
Article Snippet: .. The DNA was amplified by PCR using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA). .. The PCR product ( Luc-DNA ) was purified by phenol-chloroform extraction and verified by Sanger sequencing ( ).

Article Title: APOE Promoter Polymorphism-219T/G is an Effect Modifier of the Influence of APOE ε4 on Alzheimer’s Disease Risk in a Multiracial Sample
Article Snippet: The amplified DNA from each subject was digested with KpnI and XhoI and ligated into the pGL3.basic vector (Promega, Madison, WI, USA). .. The reactions were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies Inc, Santa Clara, CA, USA).

Construct:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Cloning of pre-miRNA regions Pre-miRNA expression vectors were constructed by amplifying a ~0.5-kb DNA fragment encompassing the pre-miRNA region using the human genomic DNA (heterozygous for the variant of interest) as a template. .. Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C.

Article Title: N-Glycans on the Rift Valley Fever Virus Envelope Glycoproteins Gn and Gc Redundantly Support Viral Infection via DC-SIGN
Article Snippet: .. Plasmids To generate rMP-12 mutants encoding either N438Q, N794Q, N1035Q, N1077Q, N438Q/N729Q, N438Q/N1035Q or N438Q/N1077Q, we constructed seven plasmids: pProT7-vM(+)N438Q, pProT7-vM(+)N794Q, pProT7-vM(+)N1035Q, pProT7-vM(+)N1077Q, pProT7-vM(+)N438Q/N794Q, pProT7-vM(+)N438Q/N1035Q or pProT7-vM(+)N438Q/N1077Q by site-directed mutagenesis using PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, La Jolla, CA, USA) according to the manufacturer’s instructions. .. The plasmids encode a point non-synonymous mutation (N to Q) at the indicated asparagine position (aa.1 represents the first methionine of M-segment open reading frame).

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified. .. Fragment 2 was digested by restriction enzymes NdeI and NotI and inserted into the NdeI and NotI sites of the TOPO- FoxP2 3′-UTR-1 to generate the TOPO- FoxP2 3′-UTR 1 + 2 construct.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: Paragraph title: Constructs ... The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385).

Article Title: APOE Promoter Polymorphism-219T/G is an Effect Modifier of the Influence of APOE ε4 on Alzheimer’s Disease Risk in a Multiracial Sample
Article Snippet: Paragraph title: 2.4.1. APOE Promoter Construct ... The reactions were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies Inc, Santa Clara, CA, USA).

Article Title: Formononetin may protect aged hearts from ischemia/reperfusion damage by enhancing autophagic degradation
Article Snippet: To construct the mCherry-GFP-LC3 plasmid, PCR was performed for mCherry from the pLV-mCherry vector with a pair of primers (Forward, 5′-GCTAGCGCCTGGAGCTGCTTGGCCACCATGCCCCAGACTGTGAGTTGC-3′ and reverse, 5′-GCTAGCATAAAAGACACCAAGGAAGCTGACAAGATAGAGGAAGAGCAA-3′) containing the Nhe 1 target sequence, 21 random nucleotides in between as linker and a 21 nucleotide matching mCherry sequence. .. PCR was performed with PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, USA). dNTPs were purchased from New England Biolabs, Inc. (Ipswich, MA, USA).

Incubation:

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: .. The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs. .. The PCR products were then cloned into pSC-A-amp/kan vector using StrataClone PCR Cloning Kit (Agilent Technologies).

Expressing:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Cloning of pre-miRNA regions Pre-miRNA expression vectors were constructed by amplifying a ~0.5-kb DNA fragment encompassing the pre-miRNA region using the human genomic DNA (heterozygous for the variant of interest) as a template. .. Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: To construct a single gRNA expression vector, a 978 bp DNA fragment containing the partial rrk1+ promoter and a 966 bp DNA fragment of rrk1+ terminator were amplified from fission yeast genomic DNA with primers KT1910-KT1903 and KT1907-KT1913, respectively. .. The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385).

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: Selected clones lacking expression of Rab10 were sequenced to confirm the KO. .. The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs.

Modification:

Article Title: N-Glycans on the Rift Valley Fever Virus Envelope Glycoproteins Gn and Gc Redundantly Support Viral Infection via DC-SIGN
Article Snippet: Plasmids To generate rMP-12 mutants encoding either N438Q, N794Q, N1035Q, N1077Q, N438Q/N729Q, N438Q/N1035Q or N438Q/N1077Q, we constructed seven plasmids: pProT7-vM(+)N438Q, pProT7-vM(+)N794Q, pProT7-vM(+)N1035Q, pProT7-vM(+)N1077Q, pProT7-vM(+)N438Q/N794Q, pProT7-vM(+)N438Q/N1035Q or pProT7-vM(+)N438Q/N1077Q by site-directed mutagenesis using PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, La Jolla, CA, USA) according to the manufacturer’s instructions. .. To analyze the N -glycosylation of Gc, we modified pCAGGS-vG to encode all of N438Q, N729Q, N829Q, N1035Q, and N1077Q mutations (pCAGGS-vG-Gly-null).

Western Blot:

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: After reaching ∼80% confluency the clones were screened by Western blotting for the presence of Rab10. .. The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs.

Inverse PCR:

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385). .. To exchange Csp CI sites with Bbs I sites as gRNA target sequence cloning sites, inverse PCR was performed using primers KT1932-KT1933 with KOD-Plus-Ver.2 (TOYOBO life science, catalog number KOD-201) to replace a 36 bp sequence with a 47 bp sequence including two Bbs I sites (pAH233).

Generated:

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385). .. The adh1 promoter driven Cas9 expression plasmid (pAH261) was generated by exchanging the nmt41 promoter to the adh1 promoter.

DNA Sequencing:

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs. .. The inserts in each individual clone were sequenced using M13 primers (DNA sequencing facility of Division of Signal Transduction Therapy at the University of Dundee).

Polymerase Chain Reaction:

Article Title: Coronary vasculature patterning requires a novel endothelial ErbB2 holoreceptor
Article Snippet: .. PfuUltra high-fidelity DNA polymerase (Agilent, 600380) was used to amplify a plasmid with 5′ phosphorylated primers flanking the regions to be deleted Primers are as follows: ErbB2-V5 Δ ECD F—5′-GCCGAGCAGAGAGCCAGCCCTCTG-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 Δ ICD F—5′-TACCTGGGTCTGGACGTGCCAGTG-3′ R—5′-CTTCCGGATCTTCTGCTGCCGTCGCTT-3′ ErbB2-V5 T1 F—5′-CACAAGAACAACCAGCTGGCTCTC-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 T2 F—5′-GGTCTGGGCATGGAGCACTTGCGA-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 T3 F—5′-CGGAACCCGCACCAAGCTCTGCTC-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2 Δ16 –V5 F—5′-CCCTCTGACGTCCATCATCTCT-3′ R—5′-GAGTGGGTGCAGTTGATGGGGCAA Linear PCR products were circularized using T4 DNA ligase (Invitrogen, 15224) and sequenced. .. RNA interference HUVECs were transfected with Lipofectamine RNAiMAX (Invitrogen, 13778030) using ErbB2 siRNA (Cell Signaling), Nrp1 pre-designed siRNA (Ambion, #4914) or Silencer Negative control siRNA #1 (Ambion, AM4611) in antibiotic-free media.

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: .. Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. .. The amplified fragments were purified with PCR purification kit (Qiagen) and analyzed on 1.5% agarose gels.

Article Title: A genetic selection reveals functional metastable structures embedded in a toxin-encoding mRNA
Article Snippet: .. Site-directed mutagenesis PCR was performed with the PfuUltra High-Fidelity DNA Polymerase (Agilent). .. RNA extraction For RNA extraction, bacterial growth was stopped at the desired OD600nm by adding 650 μl cold Stop Solution (95% ethanol, 5% phenol pH 4.5) to 5 ml of culture, which was placed on ice.

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: .. PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified. .. Fragment 1 was inserted into the TOPO PCR cloning vector (Invitrogen) to create the plasmid TOPO- FoxP2 3′-UTR-1.

Article Title: Metabolically Stabilized Double Stranded mRNA Polyplexes
Article Snippet: .. The DNA was amplified by PCR using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA). .. The PCR product ( Luc-DNA ) was purified by phenol-chloroform extraction and verified by Sanger sequencing ( ).

Article Title: A genetic selection reveals functional metastable structures embedded in a toxin-encoding mRNA
Article Snippet: .. Mutant generation by site-directed mutagenesis PCR Plasmids and custom-designed overlapping oligonucleotides containing the desired mutations were used for site-directed mutagenesis PCR using the PfuUltra high-fidelity DNA polymerase. ..

Article Title: APOE Promoter Polymorphism-219T/G is an Effect Modifier of the Influence of APOE ε4 on Alzheimer’s Disease Risk in a Multiracial Sample
Article Snippet: PCR based site-directed mutagenesis of rs405509 (−219G/T) was carried out to replace T by G for the construct from AD patient and G by T from control using the following primers: T → G forward, 5’-GAGGAGGGTGTCTGGATTACTGGGCGAG-3’; reverse, 5′- CTCGCCCAGTAATCCAGACACCCTCCTC -3′, G → T forward, 5’-GAGGAGGGTGTCTGTATTACTGGGCGAGG-3’; 5’-CCTCGCCCAGTAATACAGACACCCTCCTC-3’. .. The reactions were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies Inc, Santa Clara, CA, USA).

Article Title: Formononetin may protect aged hearts from ischemia/reperfusion damage by enhancing autophagic degradation
Article Snippet: .. PCR was performed with PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, USA). dNTPs were purchased from New England Biolabs, Inc. (Ipswich, MA, USA). .. The following thermocycling conditions were used: 94°C 5 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1 min, with a final extension at 72°C for 10 min.

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: .. The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs. .. The PCR products were then cloned into pSC-A-amp/kan vector using StrataClone PCR Cloning Kit (Agilent Technologies).

Article Title: Comparison of L-Threonine Aldolase Variants in the Aldol and Retro-Aldol Reactions
Article Snippet: .. PCR was carried out under the following conditions: 50 μL total volume, 200 μM of each dNTP, 0.2 μM of each primer, 5 ng of template plasmid DNA, and 2.5 U of PfuUltra High-Fidelity DNA polymerase. .. Cycling conditions were as follows: initial denaturation at 95°C for 2 min, followed by 21 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 60 s, extension at 68°C for 8 min. Amplification was controlled by electrophoresis of 10 μL of the PCR reaction on an agarose gel.

DNA Extraction:

Article Title: A genetic selection reveals functional metastable structures embedded in a toxin-encoding mRNA
Article Snippet: High-Purity Plasmid Miniprep Kit (Neo Biotech) and Quick Bacteria Genomic DNA extraction Kit (Neo Biotech) were used for plasmid preparations and H. pylori genomic DNA extractions, respectively. .. Site-directed mutagenesis PCR was performed with the PfuUltra High-Fidelity DNA Polymerase (Agilent).

Mutagenesis:

Article Title: Coronary vasculature patterning requires a novel endothelial ErbB2 holoreceptor
Article Snippet: ErbB2 truncations Truncations were made to the plasmid ErbB2-pEF-Dest51 using site directed mutagenesis PCR. .. PfuUltra high-fidelity DNA polymerase (Agilent, 600380) was used to amplify a plasmid with 5′ phosphorylated primers flanking the regions to be deleted Primers are as follows: ErbB2-V5 Δ ECD F—5′-GCCGAGCAGAGAGCCAGCCCTCTG-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 Δ ICD F—5′-TACCTGGGTCTGGACGTGCCAGTG-3′ R—5′-CTTCCGGATCTTCTGCTGCCGTCGCTT-3′ ErbB2-V5 T1 F—5′-CACAAGAACAACCAGCTGGCTCTC-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 T2 F—5′-GGTCTGGGCATGGAGCACTTGCGA-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 T3 F—5′-CGGAACCCGCACCAAGCTCTGCTC-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2 Δ16 –V5 F—5′-CCCTCTGACGTCCATCATCTCT-3′ R—5′-GAGTGGGTGCAGTTGATGGGGCAA Linear PCR products were circularized using T4 DNA ligase (Invitrogen, 15224) and sequenced.

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. .. The plasmids that contained the wild-type or mutant miRNA genes were identified by Sanger sequencing.

Article Title: N-Glycans on the Rift Valley Fever Virus Envelope Glycoproteins Gn and Gc Redundantly Support Viral Infection via DC-SIGN
Article Snippet: .. Plasmids To generate rMP-12 mutants encoding either N438Q, N794Q, N1035Q, N1077Q, N438Q/N729Q, N438Q/N1035Q or N438Q/N1077Q, we constructed seven plasmids: pProT7-vM(+)N438Q, pProT7-vM(+)N794Q, pProT7-vM(+)N1035Q, pProT7-vM(+)N1077Q, pProT7-vM(+)N438Q/N794Q, pProT7-vM(+)N438Q/N1035Q or pProT7-vM(+)N438Q/N1077Q by site-directed mutagenesis using PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, La Jolla, CA, USA) according to the manufacturer’s instructions. .. The plasmids encode a point non-synonymous mutation (N to Q) at the indicated asparagine position (aa.1 represents the first methionine of M-segment open reading frame).

Article Title: A genetic selection reveals functional metastable structures embedded in a toxin-encoding mRNA
Article Snippet: .. Site-directed mutagenesis PCR was performed with the PfuUltra High-Fidelity DNA Polymerase (Agilent). .. RNA extraction For RNA extraction, bacterial growth was stopped at the desired OD600nm by adding 650 μl cold Stop Solution (95% ethanol, 5% phenol pH 4.5) to 5 ml of culture, which was placed on ice.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: .. The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385). .. To exchange Csp CI sites with Bbs I sites as gRNA target sequence cloning sites, inverse PCR was performed using primers KT1932-KT1933 with KOD-Plus-Ver.2 (TOYOBO life science, catalog number KOD-201) to replace a 36 bp sequence with a 47 bp sequence including two Bbs I sites (pAH233).

Article Title: A genetic selection reveals functional metastable structures embedded in a toxin-encoding mRNA
Article Snippet: .. Mutant generation by site-directed mutagenesis PCR Plasmids and custom-designed overlapping oligonucleotides containing the desired mutations were used for site-directed mutagenesis PCR using the PfuUltra high-fidelity DNA polymerase. ..

Article Title: APOE Promoter Polymorphism-219T/G is an Effect Modifier of the Influence of APOE ε4 on Alzheimer’s Disease Risk in a Multiracial Sample
Article Snippet: PCR based site-directed mutagenesis of rs405509 (−219G/T) was carried out to replace T by G for the construct from AD patient and G by T from control using the following primers: T → G forward, 5’-GAGGAGGGTGTCTGGATTACTGGGCGAG-3’; reverse, 5′- CTCGCCCAGTAATCCAGACACCCTCCTC -3′, G → T forward, 5’-GAGGAGGGTGTCTGTATTACTGGGCGAGG-3’; 5’-CCTCGCCCAGTAATACAGACACCCTCCTC-3’. .. The reactions were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies Inc, Santa Clara, CA, USA).

Isolation:

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: Genomic DNA was isolated using a GenElute Mammalian Genomic DNA Miniprep Kit (Sigma–Aldrich). .. The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs.

Size-exclusion Chromatography:

Article Title: Formononetin may protect aged hearts from ischemia/reperfusion damage by enhancing autophagic degradation
Article Snippet: PCR was performed with PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, USA). dNTPs were purchased from New England Biolabs, Inc. (Ipswich, MA, USA). .. The following thermocycling conditions were used: 94°C 5 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1 min, with a final extension at 72°C for 10 min.

Purification:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. .. The amplified fragments were purified with PCR purification kit (Qiagen) and analyzed on 1.5% agarose gels.

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: .. PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified. .. Fragment 1 was inserted into the TOPO PCR cloning vector (Invitrogen) to create the plasmid TOPO- FoxP2 3′-UTR-1.

Article Title: Metabolically Stabilized Double Stranded mRNA Polyplexes
Article Snippet: The DNA was amplified by PCR using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA). .. The PCR product ( Luc-DNA ) was purified by phenol-chloroform extraction and verified by Sanger sequencing ( ).

Sequencing:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. .. The plasmids that contained the wild-type or mutant miRNA genes were identified by Sanger sequencing.

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: The overlapping sequence between these two fragments contained an NdeI restriction site. .. PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385). .. To exchange Csp CI sites with Bbs I sites as gRNA target sequence cloning sites, inverse PCR was performed using primers KT1932-KT1933 with KOD-Plus-Ver.2 (TOYOBO life science, catalog number KOD-201) to replace a 36 bp sequence with a 47 bp sequence including two Bbs I sites (pAH233).

Article Title: Metabolically Stabilized Double Stranded mRNA Polyplexes
Article Snippet: The DNA was amplified by PCR using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA). .. The PCR product ( Luc-DNA ) was purified by phenol-chloroform extraction and verified by Sanger sequencing ( ).

Article Title: Formononetin may protect aged hearts from ischemia/reperfusion damage by enhancing autophagic degradation
Article Snippet: To construct the mCherry-GFP-LC3 plasmid, PCR was performed for mCherry from the pLV-mCherry vector with a pair of primers (Forward, 5′-GCTAGCGCCTGGAGCTGCTTGGCCACCATGCCCCAGACTGTGAGTTGC-3′ and reverse, 5′-GCTAGCATAAAAGACACCAAGGAAGCTGACAAGATAGAGGAAGAGCAA-3′) containing the Nhe 1 target sequence, 21 random nucleotides in between as linker and a 21 nucleotide matching mCherry sequence. .. PCR was performed with PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, USA). dNTPs were purchased from New England Biolabs, Inc. (Ipswich, MA, USA).

Plasmid Preparation:

Article Title: Coronary vasculature patterning requires a novel endothelial ErbB2 holoreceptor
Article Snippet: .. PfuUltra high-fidelity DNA polymerase (Agilent, 600380) was used to amplify a plasmid with 5′ phosphorylated primers flanking the regions to be deleted Primers are as follows: ErbB2-V5 Δ ECD F—5′-GCCGAGCAGAGAGCCAGCCCTCTG-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 Δ ICD F—5′-TACCTGGGTCTGGACGTGCCAGTG-3′ R—5′-CTTCCGGATCTTCTGCTGCCGTCGCTT-3′ ErbB2-V5 T1 F—5′-CACAAGAACAACCAGCTGGCTCTC-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 T2 F—5′-GGTCTGGGCATGGAGCACTTGCGA-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2-V5 T3 F—5′-CGGAACCCGCACCAAGCTCTGCTC-3′ R—5′-GCGGCACAAGGCCGCCAGCTCCAT-3′ ErbB2 Δ16 –V5 F—5′-CCCTCTGACGTCCATCATCTCT-3′ R—5′-GAGTGGGTGCAGTTGATGGGGCAA Linear PCR products were circularized using T4 DNA ligase (Invitrogen, 15224) and sequenced. .. RNA interference HUVECs were transfected with Lipofectamine RNAiMAX (Invitrogen, 13778030) using ErbB2 siRNA (Cell Signaling), Nrp1 pre-designed siRNA (Ambion, #4914) or Silencer Negative control siRNA #1 (Ambion, AM4611) in antibiotic-free media.

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. .. The resulting fragments were cloned into a lentiviral vector (pCDH-CMV-EF1-Puro-GFP) using Xba I and Bam HI or Nhe I and Bam HI restriction enzymes ( ).

Article Title: A genetic selection reveals functional metastable structures embedded in a toxin-encoding mRNA
Article Snippet: High-Purity Plasmid Miniprep Kit (Neo Biotech) and Quick Bacteria Genomic DNA extraction Kit (Neo Biotech) were used for plasmid preparations and H. pylori genomic DNA extractions, respectively. .. Site-directed mutagenesis PCR was performed with the PfuUltra High-Fidelity DNA Polymerase (Agilent).

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified. .. Fragment 1 was inserted into the TOPO PCR cloning vector (Invitrogen) to create the plasmid TOPO- FoxP2 3′-UTR-1.

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: To construct a single gRNA expression vector, a 978 bp DNA fragment containing the partial rrk1+ promoter and a 966 bp DNA fragment of rrk1+ terminator were amplified from fission yeast genomic DNA with primers KT1910-KT1903 and KT1907-KT1913, respectively. .. The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385).

Article Title: APOE Promoter Polymorphism-219T/G is an Effect Modifier of the Influence of APOE ε4 on Alzheimer’s Disease Risk in a Multiracial Sample
Article Snippet: The amplified DNA from each subject was digested with KpnI and XhoI and ligated into the pGL3.basic vector (Promega, Madison, WI, USA). .. The reactions were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies Inc, Santa Clara, CA, USA).

Article Title: Formononetin may protect aged hearts from ischemia/reperfusion damage by enhancing autophagic degradation
Article Snippet: To construct the mCherry-GFP-LC3 plasmid, PCR was performed for mCherry from the pLV-mCherry vector with a pair of primers (Forward, 5′-GCTAGCGCCTGGAGCTGCTTGGCCACCATGCCCCAGACTGTGAGTTGC-3′ and reverse, 5′-GCTAGCATAAAAGACACCAAGGAAGCTGACAAGATAGAGGAAGAGCAA-3′) containing the Nhe 1 target sequence, 21 random nucleotides in between as linker and a 21 nucleotide matching mCherry sequence. .. PCR was performed with PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, USA). dNTPs were purchased from New England Biolabs, Inc. (Ipswich, MA, USA).

Article Title: Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors
Article Snippet: The PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) with primers 5′-TTCCTCAAAGCTGTTCGTAGGTCG-3′ and 5′-TCCTCCCACAGGTCTTACCTATGG-3′ to amplify the region targeted for KO, followed by incubation with Taq polymerase (New England Biolabs) to add 3′ A overhangs. .. The PCR products were then cloned into pSC-A-amp/kan vector using StrataClone PCR Cloning Kit (Agilent Technologies).

Article Title: Comparison of L-Threonine Aldolase Variants in the Aldol and Retro-Aldol Reactions
Article Snippet: .. PCR was carried out under the following conditions: 50 μL total volume, 200 μM of each dNTP, 0.2 μM of each primer, 5 ng of template plasmid DNA, and 2.5 U of PfuUltra High-Fidelity DNA polymerase. .. Cycling conditions were as follows: initial denaturation at 95°C for 2 min, followed by 21 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 60 s, extension at 68°C for 8 min. Amplification was controlled by electrophoresis of 10 μL of the PCR reaction on an agarose gel.

Marker:

Article Title: Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast
Article Snippet: .. The Bbs I site of LEU2 marker gene was disrupted by site-directed mutagenesis using primers KT1928-KT1929 with PfuUltra High Fidelity DNA polymerase (Agilent, catalog number 600385). .. To exchange Csp CI sites with Bbs I sites as gRNA target sequence cloning sites, inverse PCR was performed using primers KT1932-KT1933 with KOD-Plus-Ver.2 (TOYOBO life science, catalog number KOD-201) to replace a 36 bp sequence with a 47 bp sequence including two Bbs I sites (pAH233).

Gel Extraction:

Article Title: Formononetin may protect aged hearts from ischemia/reperfusion damage by enhancing autophagic degradation
Article Snippet: PCR was performed with PfuUltra High-Fidelity DNA polymerase (Agilent Technologies, USA). dNTPs were purchased from New England Biolabs, Inc. (Ipswich, MA, USA). .. The PCR product was subjected to Nhe 1 digestion at 37°C overnight (New England Biolabs, Inc.) and gel extraction.

Variant Assay:

Article Title: Variants in microRNA genes in familial papillary thyroid carcinoma
Article Snippet: Cloning of pre-miRNA regions Pre-miRNA expression vectors were constructed by amplifying a ~0.5-kb DNA fragment encompassing the pre-miRNA region using the human genomic DNA (heterozygous for the variant of interest) as a template. .. Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers ( ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C.

Article Title: miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches
Article Snippet: Based on the homology to the human FOXP2 3′-UTR sequence obtained from the NCBI database (variant II, accession No. NM148898 ), we extracted the zebra finch FoxP2 3′-UTR sequence (3846 bp) from the zebra finch genome (reference assembly 3.2.4), and designed PCR primer. .. PfuUltra High-Fidelity DNA Polymerase (Agilent) was used and the PCR products were gel purified.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    Agilent technologies pfuultra high fidelity dnapol
    Pfuultra High Fidelity Dnapol, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pfuultra high fidelity dnapol/product/Agilent technologies
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pfuultra high fidelity dnapol - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    Image Search Results