human tlr2  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Millipore human tlr2
    Effect of TirEs and Hp1 on IL-8 release. (a) Presence of tirE1-hp1-tirE2 does not affect IL-8 release. Upon infection of macrophage-like cells (differentiated Thp1 cells) with E1162 and E1162Δtir at MOI 300, MOI 100, and MOI 10, IL-8 was measured in the cellular supernatant at 2 h, 4 h, and 6 h after infection, through IL-8 ELISA. Data are pooled from 3 independent experiments, each in duplicates. (b) Interference of TirE1 and TirE2 with <t>TLR2</t> signaling. IL-8 release was measured as a response of HEK293 cells stably expressing TLR2 towards stimulation with the lipoproteins Malp2, Pam2Cys, and Pam3Cys. The cells were left untreated (nonstimulated) or were added Malp2, Pam2Cys, or Pam3Cys. One hour before stimulation with agonists, the TLR2-expressing HEK293 cells were added SSL3 (well-known inhibitor of TLR2 signaling), TirE1, TirE2, or a combination of TirE1, Hp1, and TirE2 to a final concentration of 10 µ g/ml. IL-8 was quantified in IL-8 ELISA, using TMB as the substrate and measuring the absorbance at 450 nm. Data are shown in triplicates, representative of 3 independent experiments. ∗ P ≤ 0.05, inhibited vs uninhibited: P Tir1Malp2 =0.051, P Tir1Pam2 =0.045, P Tir1Pam3 =0.017, P Tir2Malp2 =0.049, P Tir2Pam2 =0.035, and P Tir2Pam3 =0.004; Abs: absorption.
    Human Tlr2, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 243 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human tlr2/product/Millipore
    Average 91 stars, based on 243 article reviews
    Price from $9.99 to $1999.99
    human tlr2 - by Bioz Stars, 2020-08
    91/100 stars

    Images

    1) Product Images from "Enterococcus faecium TIR-Domain Genes Are Part of a Gene Cluster Which Promotes Bacterial Survival in Blood"

    Article Title: Enterococcus faecium TIR-Domain Genes Are Part of a Gene Cluster Which Promotes Bacterial Survival in Blood

    Journal: International Journal of Microbiology

    doi: 10.1155/2018/1435820

    Effect of TirEs and Hp1 on IL-8 release. (a) Presence of tirE1-hp1-tirE2 does not affect IL-8 release. Upon infection of macrophage-like cells (differentiated Thp1 cells) with E1162 and E1162Δtir at MOI 300, MOI 100, and MOI 10, IL-8 was measured in the cellular supernatant at 2 h, 4 h, and 6 h after infection, through IL-8 ELISA. Data are pooled from 3 independent experiments, each in duplicates. (b) Interference of TirE1 and TirE2 with TLR2 signaling. IL-8 release was measured as a response of HEK293 cells stably expressing TLR2 towards stimulation with the lipoproteins Malp2, Pam2Cys, and Pam3Cys. The cells were left untreated (nonstimulated) or were added Malp2, Pam2Cys, or Pam3Cys. One hour before stimulation with agonists, the TLR2-expressing HEK293 cells were added SSL3 (well-known inhibitor of TLR2 signaling), TirE1, TirE2, or a combination of TirE1, Hp1, and TirE2 to a final concentration of 10 µ g/ml. IL-8 was quantified in IL-8 ELISA, using TMB as the substrate and measuring the absorbance at 450 nm. Data are shown in triplicates, representative of 3 independent experiments. ∗ P ≤ 0.05, inhibited vs uninhibited: P Tir1Malp2 =0.051, P Tir1Pam2 =0.045, P Tir1Pam3 =0.017, P Tir2Malp2 =0.049, P Tir2Pam2 =0.035, and P Tir2Pam3 =0.004; Abs: absorption.
    Figure Legend Snippet: Effect of TirEs and Hp1 on IL-8 release. (a) Presence of tirE1-hp1-tirE2 does not affect IL-8 release. Upon infection of macrophage-like cells (differentiated Thp1 cells) with E1162 and E1162Δtir at MOI 300, MOI 100, and MOI 10, IL-8 was measured in the cellular supernatant at 2 h, 4 h, and 6 h after infection, through IL-8 ELISA. Data are pooled from 3 independent experiments, each in duplicates. (b) Interference of TirE1 and TirE2 with TLR2 signaling. IL-8 release was measured as a response of HEK293 cells stably expressing TLR2 towards stimulation with the lipoproteins Malp2, Pam2Cys, and Pam3Cys. The cells were left untreated (nonstimulated) or were added Malp2, Pam2Cys, or Pam3Cys. One hour before stimulation with agonists, the TLR2-expressing HEK293 cells were added SSL3 (well-known inhibitor of TLR2 signaling), TirE1, TirE2, or a combination of TirE1, Hp1, and TirE2 to a final concentration of 10 µ g/ml. IL-8 was quantified in IL-8 ELISA, using TMB as the substrate and measuring the absorbance at 450 nm. Data are shown in triplicates, representative of 3 independent experiments. ∗ P ≤ 0.05, inhibited vs uninhibited: P Tir1Malp2 =0.051, P Tir1Pam2 =0.045, P Tir1Pam3 =0.017, P Tir2Malp2 =0.049, P Tir2Pam2 =0.035, and P Tir2Pam3 =0.004; Abs: absorption.

    Techniques Used: Infection, Enzyme-linked Immunosorbent Assay, Stable Transfection, Expressing, Concentration Assay

    2) Product Images from "Excess Podocyte Semaphorin-3A Leads to Glomerular Disease Involving PlexinA1–Nephrin Interaction"

    Article Title: Excess Podocyte Semaphorin-3A Leads to Glomerular Disease Involving PlexinA1–Nephrin Interaction

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2013.06.022

    Sema3a signaling receptor plexinA 1 interacts with nephrin. A : Representative Western blots and quantitation indicate no significant changes in plexinA 1 or neuropilin 1 expression in whole kidneys after doxycycline induction. B : Immunofluorescence reveals colocalization of plexinA 1 and nephrin in cultured podocytes. C : Co-immunoprecipitation reveals association of endogenous plexinA 1 and FLAG-nephrin. Lane 1, cultured podocytes; lane 2, whole kidney. D : Reciprocal nephrin and plexinA 1 coimmunoprecipitation reveals nephrin–plexinA 1 interaction in transfected HEK cells. E and F : GST binding assay ( E ) indicates direct interaction of purified FLAG-plexinA 1 with nephrin cytoplasmic domain (GST-CD-nephrin, approximately 60 kDa; red arrowhead ); the GST-control is approximately 25 kDa ( black arrowhead ). Overlay assay ( F ) indicates that plexinA 1 –nephrin interaction is direct. Purified FLAG-plexinA 1 binds increasing amounts of GST-CD-nephrin blotted on cellulose membrane, as detected by FLAG immunoblotting; the GST Western blot confirms equal loading. Data are representative of at least three independent experiments. IP, immunoprecipitation; RS, rabbit serum; WB, Western blot; WCL, whole-cell lysate. Original magnification, ×400 ( B ).
    Figure Legend Snippet: Sema3a signaling receptor plexinA 1 interacts with nephrin. A : Representative Western blots and quantitation indicate no significant changes in plexinA 1 or neuropilin 1 expression in whole kidneys after doxycycline induction. B : Immunofluorescence reveals colocalization of plexinA 1 and nephrin in cultured podocytes. C : Co-immunoprecipitation reveals association of endogenous plexinA 1 and FLAG-nephrin. Lane 1, cultured podocytes; lane 2, whole kidney. D : Reciprocal nephrin and plexinA 1 coimmunoprecipitation reveals nephrin–plexinA 1 interaction in transfected HEK cells. E and F : GST binding assay ( E ) indicates direct interaction of purified FLAG-plexinA 1 with nephrin cytoplasmic domain (GST-CD-nephrin, approximately 60 kDa; red arrowhead ); the GST-control is approximately 25 kDa ( black arrowhead ). Overlay assay ( F ) indicates that plexinA 1 –nephrin interaction is direct. Purified FLAG-plexinA 1 binds increasing amounts of GST-CD-nephrin blotted on cellulose membrane, as detected by FLAG immunoblotting; the GST Western blot confirms equal loading. Data are representative of at least three independent experiments. IP, immunoprecipitation; RS, rabbit serum; WB, Western blot; WCL, whole-cell lysate. Original magnification, ×400 ( B ).

    Techniques Used: Western Blot, Quantitation Assay, Expressing, Immunofluorescence, Cell Culture, Immunoprecipitation, Transfection, Binding Assay, Purification, Overlay Assay

    3) Product Images from "Identification of a family of endocytic proteins that define a new ?-adaptin ear-binding motif"

    Article Title: Identification of a family of endocytic proteins that define a new ?-adaptin ear-binding motif

    Journal: EMBO Reports

    doi: 10.1038/sj.embor.7400004

    Identification of a new AP-2-binding motif in NECAP 1. ( A ) Coat proteins stripped from clathrin-coated vesicles were separated on SDS–PAGE and transferred to nitrocellulose. Nitrocellulose strips were overlaid with glutathione S -transferase (GST) or GST–NECAP 1, or western blotted with α-adaptin and γ-adaptin antibodies. ( B ) GST fusion proteins encoding the ear domains of α-, β2- and γ-adaptin and GST alone were pre-coupled to glutathione–sepharose and incubated with purified His6-tagged NECAP 1. Affinity-selected His–NECAP 1 was detected with the His6 epitope tag antibody. The starting material (SM) is an aliquot of His–NECAP 1 equal to one-tenth of that added to the fusion proteins. ( C ) GST fusion proteins encoding full-length NECAP 1, NECAP 1 lacking the last six amino acids (Δ270–275), or the last six amino acids of NECAP 1 alone (aa 270–275), as well as GST, were pre-coupled to glutathione–sepharose and incubated with soluble rat brain extracts or purified His–α-ear. Affinity-selected proteins, along with an aliquot of the SM equal to one-tenth of that added to the fusion proteins, were western blotted with antibodies against α- and γ-adaptin or the His6 epitope tag. ( D ) Equimolar amounts of the indicated GST fusion proteins were pre-coupled to glutathione–sepharose and incubated with soluble rat brain extracts. Affinity-selected proteins were processed as in ( C ). ( E ) Equimolar amounts of the indicated GST fusion proteins were pre-coupled to glutathione–sepharose and incubated with 0.5 mg of soluble rat brain extract without (−) or in the presence of increasing concentrations of a peptide encoding the last 11 amino acids of NECAP 1. The molar ratio of the peptide to fusion protein is indicated. Affinity-selected proteins were western blotted as described in ( C ). ( F ) Monoclonal antibody to α-adaptin (AP.6) was incubated with a Triton X-100-solubilized rat brain extract. Antibody was precipitated by the addition of protein-G–agarose beads and immunoprecipitated proteins were processed for western blotting with the antibodies indicated. The SM is an aliquot of extract equal to one-tenth of that used for immunoprecipitation. Mock samples were treated identically, except that AP.6 antibody was excluded. ( G ) Model of distinct modes of interaction with α-ear. NECAP 1, adaptin-ear-binding coat-associated protein 1.
    Figure Legend Snippet: Identification of a new AP-2-binding motif in NECAP 1. ( A ) Coat proteins stripped from clathrin-coated vesicles were separated on SDS–PAGE and transferred to nitrocellulose. Nitrocellulose strips were overlaid with glutathione S -transferase (GST) or GST–NECAP 1, or western blotted with α-adaptin and γ-adaptin antibodies. ( B ) GST fusion proteins encoding the ear domains of α-, β2- and γ-adaptin and GST alone were pre-coupled to glutathione–sepharose and incubated with purified His6-tagged NECAP 1. Affinity-selected His–NECAP 1 was detected with the His6 epitope tag antibody. The starting material (SM) is an aliquot of His–NECAP 1 equal to one-tenth of that added to the fusion proteins. ( C ) GST fusion proteins encoding full-length NECAP 1, NECAP 1 lacking the last six amino acids (Δ270–275), or the last six amino acids of NECAP 1 alone (aa 270–275), as well as GST, were pre-coupled to glutathione–sepharose and incubated with soluble rat brain extracts or purified His–α-ear. Affinity-selected proteins, along with an aliquot of the SM equal to one-tenth of that added to the fusion proteins, were western blotted with antibodies against α- and γ-adaptin or the His6 epitope tag. ( D ) Equimolar amounts of the indicated GST fusion proteins were pre-coupled to glutathione–sepharose and incubated with soluble rat brain extracts. Affinity-selected proteins were processed as in ( C ). ( E ) Equimolar amounts of the indicated GST fusion proteins were pre-coupled to glutathione–sepharose and incubated with 0.5 mg of soluble rat brain extract without (−) or in the presence of increasing concentrations of a peptide encoding the last 11 amino acids of NECAP 1. The molar ratio of the peptide to fusion protein is indicated. Affinity-selected proteins were western blotted as described in ( C ). ( F ) Monoclonal antibody to α-adaptin (AP.6) was incubated with a Triton X-100-solubilized rat brain extract. Antibody was precipitated by the addition of protein-G–agarose beads and immunoprecipitated proteins were processed for western blotting with the antibodies indicated. The SM is an aliquot of extract equal to one-tenth of that used for immunoprecipitation. Mock samples were treated identically, except that AP.6 antibody was excluded. ( G ) Model of distinct modes of interaction with α-ear. NECAP 1, adaptin-ear-binding coat-associated protein 1.

    Techniques Used: Binding Assay, SDS Page, Western Blot, Incubation, Purification, Immunoprecipitation

    4) Product Images from "Specific Inhibition of the Redox Activity of Ape1/Ref-1 by E3330 Blocks Tnf-?-Induced Activation of Il-8 Production in Liver Cancer Cell Lines"

    Article Title: Specific Inhibition of the Redox Activity of Ape1/Ref-1 by E3330 Blocks Tnf-?-Induced Activation of Il-8 Production in Liver Cancer Cell Lines

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0070909

    Overexpression of APE1 protein does not protect HepG2 cells from FAs treatment. Panel A: Nile Red staining. Fluorescence of Nile Red-stained were measured on HepG2 cells previously incubated with 600 µM FAs mixture (oleate/palmitate 2∶1) for 24 h (b and d) or left untreated as control ( a and c ). Cells were fixed with 1.5% glutaraldehyde in PBS, washed with buffered saline and then were stained with Nile Red 10 µg/ml ( a and b ) or 100 μg/ml ( c and d ). As confirmed by Nile Red staining, HepG2 cell line exhibited a fat overloading profile. Panel B: Transmission electron microscopy analysis. HepG2 cells were treated with the 600 µM FAs mixture at the final ratio of 2∶1 (oleate/palmitate) for 24 h ( b and d ) or left untreated ( a and c ). Cells were then fixed and paraffin-embedded. Transmission electron microscopy confirmed fat overloading induction in HepG2 cell line. Magnification: 6300X ( a and b ) and 8000X ( c and d ). Panel C: Western Blotting analysis of total cell extracts from HepG2 stable cell clones after FAs treatment. HepG2 cell clones were treated with 600 µM of FAs mixture (2∶1 ratio of oleate/palmitate) for 24 h or left untreated as control. After FAs treatment, total cell extracts were prepared and 12 µg of protein extract was loaded onto a 12% SDS-PAGE, blotted and probed with anti-APE1 antibody. FAs treatment does not alter the endogenous levels of APE1 both in the APE1 WT and the APE1 NΔ33 cell clones. Panel D: Effect of FAs treatment on viability of HepG2 cell clones. HepG2 cell clones were treated with 600 µM of FAs mixture (2∶1 ratio of oleate/palmitate) for 24 h. Cytotoxicity was assessed by trypan blue exclusion test. After exposure to FAs there was a significant reduction in cell viability but no significant difference between the clones. Data, expressed as the percentage of cell viability, are the means ± SD of three independent experiments.
    Figure Legend Snippet: Overexpression of APE1 protein does not protect HepG2 cells from FAs treatment. Panel A: Nile Red staining. Fluorescence of Nile Red-stained were measured on HepG2 cells previously incubated with 600 µM FAs mixture (oleate/palmitate 2∶1) for 24 h (b and d) or left untreated as control ( a and c ). Cells were fixed with 1.5% glutaraldehyde in PBS, washed with buffered saline and then were stained with Nile Red 10 µg/ml ( a and b ) or 100 μg/ml ( c and d ). As confirmed by Nile Red staining, HepG2 cell line exhibited a fat overloading profile. Panel B: Transmission electron microscopy analysis. HepG2 cells were treated with the 600 µM FAs mixture at the final ratio of 2∶1 (oleate/palmitate) for 24 h ( b and d ) or left untreated ( a and c ). Cells were then fixed and paraffin-embedded. Transmission electron microscopy confirmed fat overloading induction in HepG2 cell line. Magnification: 6300X ( a and b ) and 8000X ( c and d ). Panel C: Western Blotting analysis of total cell extracts from HepG2 stable cell clones after FAs treatment. HepG2 cell clones were treated with 600 µM of FAs mixture (2∶1 ratio of oleate/palmitate) for 24 h or left untreated as control. After FAs treatment, total cell extracts were prepared and 12 µg of protein extract was loaded onto a 12% SDS-PAGE, blotted and probed with anti-APE1 antibody. FAs treatment does not alter the endogenous levels of APE1 both in the APE1 WT and the APE1 NΔ33 cell clones. Panel D: Effect of FAs treatment on viability of HepG2 cell clones. HepG2 cell clones were treated with 600 µM of FAs mixture (2∶1 ratio of oleate/palmitate) for 24 h. Cytotoxicity was assessed by trypan blue exclusion test. After exposure to FAs there was a significant reduction in cell viability but no significant difference between the clones. Data, expressed as the percentage of cell viability, are the means ± SD of three independent experiments.

    Techniques Used: Over Expression, Staining, Fluorescence, Incubation, Transmission Assay, Electron Microscopy, Western Blot, Stable Transfection, Clone Assay, SDS Page

    Model of the effect of E3330 redox inhibitor on the Fatty Acid-TNFα-APE1-NFκB-IL8 axis. APE1 redox inhibitor E3330 prevents inflammatory cytokines production (IL-8 and IL-6) triggered by FAs accumulation and TNF-α stimulation in hepatic cancer cell lines. In this pathway, mitochondrial impairment and resulting oxidative stress condition may cause the functional activation of NF-κB transcription factor through APE1 regulatory redox function leading to IL-8 and IL-6 gene expression.
    Figure Legend Snippet: Model of the effect of E3330 redox inhibitor on the Fatty Acid-TNFα-APE1-NFκB-IL8 axis. APE1 redox inhibitor E3330 prevents inflammatory cytokines production (IL-8 and IL-6) triggered by FAs accumulation and TNF-α stimulation in hepatic cancer cell lines. In this pathway, mitochondrial impairment and resulting oxidative stress condition may cause the functional activation of NF-κB transcription factor through APE1 regulatory redox function leading to IL-8 and IL-6 gene expression.

    Techniques Used: Functional Assay, Activation Assay, Expressing

    NF-κB transcription factor regulates IL-8 promoter activity in JHH6 cells and E3330 treatment inhibits TNF-α-induced promoter activation. Panel A: Western Blotting analysis of total cell extracts from human hepatocellular carcinoma cell lines. A representative Western blot analysis for the evaluation of APE1 expression in Huh-7, HepG2 and JHH6 cell lines is shown in the upper panel. β-Tubulin was always measured as loading control and was used for data normalization. The lower panel shows expression levels of the protein obtained after densitometric analysis of the bands. An almost two-fold increase was observed in the content of APE1/Ref-1 in JHH6 cell line compared to Huh-7. Values were reported as histograms of the ratio between APE/Ref-1 band intensities and β-Tubulin. Data are the means ± SD of three independent experiments. Panel B: IL-8 mRNA expression in human hepatocellular carcinoma cell lines. IL-8 mRNA levels were evaluated on HepG2 and JHH6 cell lines by Real-Time PCR. Total RNA was extracted and reverse-transcribed as described in Material and Methods section. The histograms show the detected levels of IL-8 mRNA normalized to two different housekeeping genes (18S and GAPDH). An almost thirty-fold increase was observed for the mRNA IL-8 expression in JHH6 cell line. Data are the means ± SD of three independent experiments. Panel C: Schematic representation of the luciferase-linked human IL-8 promoter constructs used in this study. The plasmids −1498/+44 hIL-8/Luc and −162/+44 hIL-8/Luc (deleted of a 5′ promoter region) contain binding sites for AP-1, NF-IL-6 and NF-κB transcription factors. Site-directed mutation of the IL-8 NF-κB binding site in the context of the −162/+44 hIL-8/Luc plasmid abolished the binding of NF-κB on IL-8 promoter. Panel D: Effect of site-directed mutagenesis of the NF-κB binding site in the human IL-8 promoter sequence. JHH6 cells transfected with −1498/+44 hIL-8/Luc or −162/+44 hIL-8/Luc ΔNF-κB constructs and then treated with 2000 U/ml of TNF-α for 3 h, were analyzed through gene reporter assay. In cells transfected with the −1498/+44 hIL-8/Luc construct, TNF-α stimulated IL-8 luciferase activity, whereas mutation of the NF-κB binding site significantly decreased both basal and TNF-α-induced IL-8 promoter driven activity in JHH6. Data reported are the means ± SD of three independent experiments. These data suggest a central role of NF-κB in IL-8 gene transcription. Panel E: Effect of E3330 treatment on JHH6 viability. Levels of viability were measured with MTS assay in JHH6 cells treated for 7 h with increasing doses of E3330. Up to a concentration of 100 µM the treatment with E3330 did not affect the cellular viability. Data, expressed as the percentage of cell viability, are the means ± SD of three independent experiments. Panel F: Effect of E3330 on APE1 subcellular distribution. APE1 subcellular localization was detected through confocal microscopy analysis using a specific α-APE1 monoclonal primary antibody. APE1 mainly localized within the nuclear compartment and accumulated into nucleoli. Treatment with 100 µM E3330 for 6 h induced a robust cytoplasmic enrichment of APE1. As control, cells were treated with DMSO without any effect on APE1 subcellular distribution. Panel G: Effect of E3330 treatment on TNF-α-induced IL-8 promoter activity. JHH6 cells transfected with −1498/+44 hIL-8/Luc construct were pre-treated with increasing concentration of E3330, or with vehicle (DMSO) as a control, for 4 h prior to treatment with 2000 U/ml TNF-α for 3 h. TNF-α stimulated IL-8 luciferase activity and the pre-treatment with E3330 significantly decreased, in a dose-dependent manner, TNF-α-induced IL-8 promoter activity. Data reported are the means ± SD of three independent experiments.
    Figure Legend Snippet: NF-κB transcription factor regulates IL-8 promoter activity in JHH6 cells and E3330 treatment inhibits TNF-α-induced promoter activation. Panel A: Western Blotting analysis of total cell extracts from human hepatocellular carcinoma cell lines. A representative Western blot analysis for the evaluation of APE1 expression in Huh-7, HepG2 and JHH6 cell lines is shown in the upper panel. β-Tubulin was always measured as loading control and was used for data normalization. The lower panel shows expression levels of the protein obtained after densitometric analysis of the bands. An almost two-fold increase was observed in the content of APE1/Ref-1 in JHH6 cell line compared to Huh-7. Values were reported as histograms of the ratio between APE/Ref-1 band intensities and β-Tubulin. Data are the means ± SD of three independent experiments. Panel B: IL-8 mRNA expression in human hepatocellular carcinoma cell lines. IL-8 mRNA levels were evaluated on HepG2 and JHH6 cell lines by Real-Time PCR. Total RNA was extracted and reverse-transcribed as described in Material and Methods section. The histograms show the detected levels of IL-8 mRNA normalized to two different housekeeping genes (18S and GAPDH). An almost thirty-fold increase was observed for the mRNA IL-8 expression in JHH6 cell line. Data are the means ± SD of three independent experiments. Panel C: Schematic representation of the luciferase-linked human IL-8 promoter constructs used in this study. The plasmids −1498/+44 hIL-8/Luc and −162/+44 hIL-8/Luc (deleted of a 5′ promoter region) contain binding sites for AP-1, NF-IL-6 and NF-κB transcription factors. Site-directed mutation of the IL-8 NF-κB binding site in the context of the −162/+44 hIL-8/Luc plasmid abolished the binding of NF-κB on IL-8 promoter. Panel D: Effect of site-directed mutagenesis of the NF-κB binding site in the human IL-8 promoter sequence. JHH6 cells transfected with −1498/+44 hIL-8/Luc or −162/+44 hIL-8/Luc ΔNF-κB constructs and then treated with 2000 U/ml of TNF-α for 3 h, were analyzed through gene reporter assay. In cells transfected with the −1498/+44 hIL-8/Luc construct, TNF-α stimulated IL-8 luciferase activity, whereas mutation of the NF-κB binding site significantly decreased both basal and TNF-α-induced IL-8 promoter driven activity in JHH6. Data reported are the means ± SD of three independent experiments. These data suggest a central role of NF-κB in IL-8 gene transcription. Panel E: Effect of E3330 treatment on JHH6 viability. Levels of viability were measured with MTS assay in JHH6 cells treated for 7 h with increasing doses of E3330. Up to a concentration of 100 µM the treatment with E3330 did not affect the cellular viability. Data, expressed as the percentage of cell viability, are the means ± SD of three independent experiments. Panel F: Effect of E3330 on APE1 subcellular distribution. APE1 subcellular localization was detected through confocal microscopy analysis using a specific α-APE1 monoclonal primary antibody. APE1 mainly localized within the nuclear compartment and accumulated into nucleoli. Treatment with 100 µM E3330 for 6 h induced a robust cytoplasmic enrichment of APE1. As control, cells were treated with DMSO without any effect on APE1 subcellular distribution. Panel G: Effect of E3330 treatment on TNF-α-induced IL-8 promoter activity. JHH6 cells transfected with −1498/+44 hIL-8/Luc construct were pre-treated with increasing concentration of E3330, or with vehicle (DMSO) as a control, for 4 h prior to treatment with 2000 U/ml TNF-α for 3 h. TNF-α stimulated IL-8 luciferase activity and the pre-treatment with E3330 significantly decreased, in a dose-dependent manner, TNF-α-induced IL-8 promoter activity. Data reported are the means ± SD of three independent experiments.

    Techniques Used: Activity Assay, Activation Assay, Western Blot, Expressing, Real-time Polymerase Chain Reaction, Luciferase, Construct, Binding Assay, Mutagenesis, Plasmid Preparation, Sequencing, Transfection, Reporter Assay, MTS Assay, Concentration Assay, Confocal Microscopy

    Expression of ectopic APE1 WT protein confers cells protection to genotoxic damage but not to FAs-induced cytotoxicity. Panel A: Western Blot analysis of total cell extracts from HepG2 stable cell clones. Stably transfected clones have been obtained as described in Materials and Methods section. Twelve micrograms of protein extracts were separated by 12% SDS-PAGE and then transferred onto a NC membrane. The membrane was immunoblotted with anti-APE1 antibody. The values reported above refer to the ratios of the band intensities between ectopically-expressed and endogenous APE1, as measured by densitometry. The ectopic Flag-tagged recombinant protein both in the APE1 WT and the APE1 NΔ33 cell clones is expressed to a similar extent at different days of cell culture. a: clones after the sixth in vitro passage; b: clones after the tenth in vitro passage. Panel B: APE1 localization within HepG2 cell clones. HepG2 cell clones were fixed and immunostained for Histone H3 (red) and for Flag-tagged APE1 with an α-Flag antibody (green). Merged images (yellow) show the localization of APE1 WT within cell nuclei and colocalization with Histone H3. The APE1 NΔ33 deletion mutant colocalizes with Histone H3 within cell nuclei but show also cytoplasmic positivity. Panel C: Growth curve of HepG2 cell clones. HepG2 empty clone, APE1 WT clone and APE1 NΔ33 clone cells were seeded into each well of a 24-well plate and cell growth was monitored every two or three days as indicated, by trypan blue exclusion. APE1 NΔ33 cells (triangle) grew more slowly than the APE1 WT (square) and the empty clones (dot). Panel D: Cell growth by MTT colorimetric assay. Thirty thousand cells of the control (empty clone), APE1 WT and APE1 NΔ33 clones were seeded in quadruplicate wells in a 96-well microculture plate. Cell viability was measured after 72 h of culture. MTT assay also revealed that APE1 NΔ33 cell clone has a lower level of proliferation than empty and APE1 WT clones. Data, expressed as the percentage of cell viability with respect to the control empty clone, are the means ± SD of three independent experiments. Panel E : Effect of MMS on viability of HepG2 cell clones. HepG2 cell clones were treated for 2 h with 1.6 or 2.0 mM MMS and cell viability was estimated by the MTT colorimetric assay. When cells were treated with 2.0 mM MMS, cell viability was significantly decreased in the APE1 NΔ33 cell clone but not in the APE1 WT clone, suggesting that the ectopic expression of APE1 WT protects cells against MMS-induced citotoxicity. Data shown are the means ± SD of three independent experiments. Panel F: Effect of H 2 O 2 on viability of HepG2 cell clones . HepG2 cell clones were treated with 2.5 mM hydrogen peroxide for 1 h, then cell viability was determined by the MTT assay. After exposure to 2.5 mM H 2 O 2 no significant decrease in cell viability was detected for APE1 WT clone compared to empty and APE1 NΔ33 cell clones. The histograms show the means ± SD of three independent experiments. Panel G: Quantification of γH2A.X foci in response to etoposide treatment. The γH2A.X foci were detected using immunohistochemistry and quantified by image analysis. Cells were treated with etoposide (50 µM) for 1 h and the number of double strand DNA breaks (DSBs) was determined at different times of release (0 h, 15 h and 24 h). γH2A.X foci levels remain significantly higher than controls at 15 h and 24 h in etoposide treated APE1 NΔ33 cell clone (triangle). DNA damage was weaker for APE1 WT clone (square) than empty (dot) and APE1 NΔ33 cell clones, suggesting a protective role of APE1 overexpression in DNA repair.
    Figure Legend Snippet: Expression of ectopic APE1 WT protein confers cells protection to genotoxic damage but not to FAs-induced cytotoxicity. Panel A: Western Blot analysis of total cell extracts from HepG2 stable cell clones. Stably transfected clones have been obtained as described in Materials and Methods section. Twelve micrograms of protein extracts were separated by 12% SDS-PAGE and then transferred onto a NC membrane. The membrane was immunoblotted with anti-APE1 antibody. The values reported above refer to the ratios of the band intensities between ectopically-expressed and endogenous APE1, as measured by densitometry. The ectopic Flag-tagged recombinant protein both in the APE1 WT and the APE1 NΔ33 cell clones is expressed to a similar extent at different days of cell culture. a: clones after the sixth in vitro passage; b: clones after the tenth in vitro passage. Panel B: APE1 localization within HepG2 cell clones. HepG2 cell clones were fixed and immunostained for Histone H3 (red) and for Flag-tagged APE1 with an α-Flag antibody (green). Merged images (yellow) show the localization of APE1 WT within cell nuclei and colocalization with Histone H3. The APE1 NΔ33 deletion mutant colocalizes with Histone H3 within cell nuclei but show also cytoplasmic positivity. Panel C: Growth curve of HepG2 cell clones. HepG2 empty clone, APE1 WT clone and APE1 NΔ33 clone cells were seeded into each well of a 24-well plate and cell growth was monitored every two or three days as indicated, by trypan blue exclusion. APE1 NΔ33 cells (triangle) grew more slowly than the APE1 WT (square) and the empty clones (dot). Panel D: Cell growth by MTT colorimetric assay. Thirty thousand cells of the control (empty clone), APE1 WT and APE1 NΔ33 clones were seeded in quadruplicate wells in a 96-well microculture plate. Cell viability was measured after 72 h of culture. MTT assay also revealed that APE1 NΔ33 cell clone has a lower level of proliferation than empty and APE1 WT clones. Data, expressed as the percentage of cell viability with respect to the control empty clone, are the means ± SD of three independent experiments. Panel E : Effect of MMS on viability of HepG2 cell clones. HepG2 cell clones were treated for 2 h with 1.6 or 2.0 mM MMS and cell viability was estimated by the MTT colorimetric assay. When cells were treated with 2.0 mM MMS, cell viability was significantly decreased in the APE1 NΔ33 cell clone but not in the APE1 WT clone, suggesting that the ectopic expression of APE1 WT protects cells against MMS-induced citotoxicity. Data shown are the means ± SD of three independent experiments. Panel F: Effect of H 2 O 2 on viability of HepG2 cell clones . HepG2 cell clones were treated with 2.5 mM hydrogen peroxide for 1 h, then cell viability was determined by the MTT assay. After exposure to 2.5 mM H 2 O 2 no significant decrease in cell viability was detected for APE1 WT clone compared to empty and APE1 NΔ33 cell clones. The histograms show the means ± SD of three independent experiments. Panel G: Quantification of γH2A.X foci in response to etoposide treatment. The γH2A.X foci were detected using immunohistochemistry and quantified by image analysis. Cells were treated with etoposide (50 µM) for 1 h and the number of double strand DNA breaks (DSBs) was determined at different times of release (0 h, 15 h and 24 h). γH2A.X foci levels remain significantly higher than controls at 15 h and 24 h in etoposide treated APE1 NΔ33 cell clone (triangle). DNA damage was weaker for APE1 WT clone (square) than empty (dot) and APE1 NΔ33 cell clones, suggesting a protective role of APE1 overexpression in DNA repair.

    Techniques Used: Expressing, Western Blot, Stable Transfection, Clone Assay, Transfection, SDS Page, Recombinant, Cell Culture, In Vitro, Mutagenesis, MTT Assay, Colorimetric Assay, Immunohistochemistry, Over Expression

    5) Product Images from "UBE2QL1 is Disrupted by a Constitutional Translocation Associated with Renal Tumor Predisposition and is a Novel Candidate Renal Tumor Suppressor Gene"

    Article Title: UBE2QL1 is Disrupted by a Constitutional Translocation Associated with Renal Tumor Predisposition and is a Novel Candidate Renal Tumor Suppressor Gene

    Journal: Human Mutation

    doi: 10.1002/humu.22433

    UBE2QL1 facilitates the degradation of FBXW7 targets mTOR and CCNE1. A: 10 μg of protein lysate extracted from SKRC 47 and SKRC 39 stable clones expressing pFLAG-CMV-4- wt UBE2QL1 (FLAG-UBE2QL1) and pFLAG-CMV-4 (FLAG-EV) were immunoblotted with antibodies against both mTOR and CCNE1 and demonstrated a reduction in their expression in UBE2QL1 expressing cells as compared with the EV control. Immunoblot controls for anti-ß-actin and anti-FLAG are also shown. B: HeLa cells were transfected with either myc tagged to an empty vector (myc-EV) or myc-UBE2QL1 as indicated. Twenty-four hours post transfection, cells were treated with 100 μg/ml cyclohexamide (CHX) and collected at the indicated times afterward. Upper panels, immunoblot analysis using antibodies against endogenous mTOR (left) and CCNE1 (right) indicated a reduction in protein levels compared with that of the housekeeping protein, β-actin. Input level of UBE2QL1 in the cell lysate is shown. Lower panels, relative densities of mTOR (left) and CCNE1 (right) to β-actin by densitometry, normalized to time point zero (unpaired t -test, error bars = SEM, n = 3, * P
    Figure Legend Snippet: UBE2QL1 facilitates the degradation of FBXW7 targets mTOR and CCNE1. A: 10 μg of protein lysate extracted from SKRC 47 and SKRC 39 stable clones expressing pFLAG-CMV-4- wt UBE2QL1 (FLAG-UBE2QL1) and pFLAG-CMV-4 (FLAG-EV) were immunoblotted with antibodies against both mTOR and CCNE1 and demonstrated a reduction in their expression in UBE2QL1 expressing cells as compared with the EV control. Immunoblot controls for anti-ß-actin and anti-FLAG are also shown. B: HeLa cells were transfected with either myc tagged to an empty vector (myc-EV) or myc-UBE2QL1 as indicated. Twenty-four hours post transfection, cells were treated with 100 μg/ml cyclohexamide (CHX) and collected at the indicated times afterward. Upper panels, immunoblot analysis using antibodies against endogenous mTOR (left) and CCNE1 (right) indicated a reduction in protein levels compared with that of the housekeeping protein, β-actin. Input level of UBE2QL1 in the cell lysate is shown. Lower panels, relative densities of mTOR (left) and CCNE1 (right) to β-actin by densitometry, normalized to time point zero (unpaired t -test, error bars = SEM, n = 3, * P

    Techniques Used: Clone Assay, Expressing, Transfection, Plasmid Preparation

    UBE2QL1 colocalizes and immunoprecipitates with FBXW7. A: HeLa cells were transfected with either myc-UBE2QL1 alone and stained with antibodies against α-tubulin (red) and myc (green), which showed a nuclear localization of UBE2QL1 (upper panel). When cotransfected with myc-UBE2QL1 and either FBXW7 γ (middle panel) or FBXW7α (lower panel) and stained with antibodies against FBXW7α or FBXW7γ (red) and myc (green) there was nuclear colocalization of UBE2QL1 with FBXW7α and FBXW7γ. Triple refers to DAPI nuclear staining (blue) and the merged images together. B: HEK-293 cells were transfected with either myc tagged to an empty vector (myc-EV) or myc-UBE2QL1 and FLAG-FBXW7 as indicated. Immunoprecipitation (IP) of myc-UBE2QL1 (upper panel) followed by immunoblot (IB) analysis with antibody against the FLAG tag identified FBXW7α and FBXW7γ as UBE2QL1 interacting proteins. The reciprocal experiment whereby IP of FLAG-FBXW7α and FLAG-FBXW7γ (lower panel) followed by IB analysis with antibody against the myc tag also identified FBXW7α and FBXW7γ as UBE2QL1 interacting proteins. Input levels of FBXW7α, FBXW7γ, and UBE2QL1 in the cell lysate are indicated.
    Figure Legend Snippet: UBE2QL1 colocalizes and immunoprecipitates with FBXW7. A: HeLa cells were transfected with either myc-UBE2QL1 alone and stained with antibodies against α-tubulin (red) and myc (green), which showed a nuclear localization of UBE2QL1 (upper panel). When cotransfected with myc-UBE2QL1 and either FBXW7 γ (middle panel) or FBXW7α (lower panel) and stained with antibodies against FBXW7α or FBXW7γ (red) and myc (green) there was nuclear colocalization of UBE2QL1 with FBXW7α and FBXW7γ. Triple refers to DAPI nuclear staining (blue) and the merged images together. B: HEK-293 cells were transfected with either myc tagged to an empty vector (myc-EV) or myc-UBE2QL1 and FLAG-FBXW7 as indicated. Immunoprecipitation (IP) of myc-UBE2QL1 (upper panel) followed by immunoblot (IB) analysis with antibody against the FLAG tag identified FBXW7α and FBXW7γ as UBE2QL1 interacting proteins. The reciprocal experiment whereby IP of FLAG-FBXW7α and FLAG-FBXW7γ (lower panel) followed by IB analysis with antibody against the myc tag also identified FBXW7α and FBXW7γ as UBE2QL1 interacting proteins. Input levels of FBXW7α, FBXW7γ, and UBE2QL1 in the cell lysate are indicated.

    Techniques Used: Transfection, Staining, Plasmid Preparation, Immunoprecipitation, FLAG-tag

    UBE2QL1 binds monoubiquitin in vivo. A: Schematic diagram of UBE2QL1 showing the ubiquitin conjugating (Ubc) domain containing an active-site cysteine at residue 88 and a FBXW7 recognition motif (residues 154–159). B: Transcription/translation lysate system produces wt UBE2QL1 at ∼26 kDa and UBE2QL1 C88A at ∼18 kDa suggests wt UBE2QL1 is monoubiquitinated (ubiquitin M r 8.5 kDa). C: HEK-293 cells were transfected with either FLAG-tagged UBE2QL1-wt or UBE2QL1-C88S or FLAG-UBE2QL1-C88A mutants and either His 6 -tagged ubiquitin (His-Ub) or empty vector (His-EV). His pulldown followed by immunoblot (IB) analysis demonstrated that UBE2QL1-wt is monoubiquitinated in vivo (bands at M r of ∼26 kDa). Input levels of UBE2QL1-wt, UBE2QL1-C88S, and UBE2QL1-C88A in the cell lysate are indicated (bands at M r of ∼18 kDa).
    Figure Legend Snippet: UBE2QL1 binds monoubiquitin in vivo. A: Schematic diagram of UBE2QL1 showing the ubiquitin conjugating (Ubc) domain containing an active-site cysteine at residue 88 and a FBXW7 recognition motif (residues 154–159). B: Transcription/translation lysate system produces wt UBE2QL1 at ∼26 kDa and UBE2QL1 C88A at ∼18 kDa suggests wt UBE2QL1 is monoubiquitinated (ubiquitin M r 8.5 kDa). C: HEK-293 cells were transfected with either FLAG-tagged UBE2QL1-wt or UBE2QL1-C88S or FLAG-UBE2QL1-C88A mutants and either His 6 -tagged ubiquitin (His-Ub) or empty vector (His-EV). His pulldown followed by immunoblot (IB) analysis demonstrated that UBE2QL1-wt is monoubiquitinated in vivo (bands at M r of ∼26 kDa). Input levels of UBE2QL1-wt, UBE2QL1-C88S, and UBE2QL1-C88A in the cell lysate are indicated (bands at M r of ∼18 kDa).

    Techniques Used: In Vivo, Transfection, Plasmid Preparation

    6) Product Images from "HAP1 can sequester a subset of TBP in cytoplasmic inclusions via specific interaction with the conserved TBPCORE"

    Article Title: HAP1 can sequester a subset of TBP in cytoplasmic inclusions via specific interaction with the conserved TBPCORE

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-8-76

    Co-immunoprecipitation assay. TBP/HAP1-B 155–582 interactions in co-transfected cells. (A) 293 cells were co-transfected with pCMV-HA-TBP-FL and pCMV-MYC-HAP1. Whole cell lysates (WCL) (lanes 1–2, where lane 1 and lane 2 represent 4% of each WCL used for immunoprecipitation in lanes 3 and 4, respectively) or immunoprecipitated samples (lanes 3–4) were assayed using western blots with anti-MYC antibody. MYC-tagged HAP1 co-precipitated with TBP in the presence of the anti-TBP antibody (lane 3), but not with the non-specific antibody (lane 4). (B) COS-7 cells were co-transfected with pFLAG-CMV-GFP-TBP-FL (lanes 1–4, 7–8) or pFLAG-CMV-GFP (lanes 5–6, 9) and pCMV-MYC-HAP1-B 155–582 (lanes 1–9). Whole cell lysates (lanes 1, 3, and 5, HAP1) or immunoprecipitated samples (lanes 2, 4, and 6, HAP1) were assayed using western blots and anti-MYC antibody. MYC-tagged HAP1 co-precipitated with FLAG-tagged-GFP-TBP in the presence of the anti-FLAG antibody (lane 2), but not with the non-specific antibody (lane 4). Myc-tagged HAP1 did not co-precipitate with FLAG-tagged-GFP in the presence of anti-FLAG antibody (lane 6). 30% of each immunoprecipitated sample was also blotted with anti-FLAG antibody (lanes 7–9) to verify the amount of FLAG-tagged protein that was captured in each co-precipitation assay (lanes 7–9 represent co-precipitated samples in lanes 2, 4, and 6, respectively).
    Figure Legend Snippet: Co-immunoprecipitation assay. TBP/HAP1-B 155–582 interactions in co-transfected cells. (A) 293 cells were co-transfected with pCMV-HA-TBP-FL and pCMV-MYC-HAP1. Whole cell lysates (WCL) (lanes 1–2, where lane 1 and lane 2 represent 4% of each WCL used for immunoprecipitation in lanes 3 and 4, respectively) or immunoprecipitated samples (lanes 3–4) were assayed using western blots with anti-MYC antibody. MYC-tagged HAP1 co-precipitated with TBP in the presence of the anti-TBP antibody (lane 3), but not with the non-specific antibody (lane 4). (B) COS-7 cells were co-transfected with pFLAG-CMV-GFP-TBP-FL (lanes 1–4, 7–8) or pFLAG-CMV-GFP (lanes 5–6, 9) and pCMV-MYC-HAP1-B 155–582 (lanes 1–9). Whole cell lysates (lanes 1, 3, and 5, HAP1) or immunoprecipitated samples (lanes 2, 4, and 6, HAP1) were assayed using western blots and anti-MYC antibody. MYC-tagged HAP1 co-precipitated with FLAG-tagged-GFP-TBP in the presence of the anti-FLAG antibody (lane 2), but not with the non-specific antibody (lane 4). Myc-tagged HAP1 did not co-precipitate with FLAG-tagged-GFP in the presence of anti-FLAG antibody (lane 6). 30% of each immunoprecipitated sample was also blotted with anti-FLAG antibody (lanes 7–9) to verify the amount of FLAG-tagged protein that was captured in each co-precipitation assay (lanes 7–9 represent co-precipitated samples in lanes 2, 4, and 6, respectively).

    Techniques Used: Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Western Blot

    7) Product Images from "The WHHERE coactivator complex is required for retinoic acid-dependent regulation of embryonic symmetry"

    Article Title: The WHHERE coactivator complex is required for retinoic acid-dependent regulation of embryonic symmetry

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00593-6

    The WHHERE complex acts as a coactivator for retinoic acid signaling. a - k RARE-Luciferase activity from NIH3T3 cells treated or not with 1 µM RA for 20 h. a Cells transfected with expression plasmids containing Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). b Cells transfected with expression plasmids containing Hdac1 , Hdac2 , or both ( n = 4). c Cells treated either with siRNA for Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). d Cells treated with siRNA for Hdac1 , Hdac2 or both ( n = 4). e Cells overexpressing Rere or Wdr5 and treated with siRNA against Hdac1 ( n = 4). f Cells overexpressing Rere or Wdr5 and treated with siRNA against both Hdac1 and Hdac2 ( n = 4). g Cells treated with the HDAC inhibitors Trichostatin A (TSA) (60 nM), sodium butyrate (SB) (3 mM), apicidin (Api) (300 nM), LAQ824 (LAQ) (60 nM) and Panobinostat (Pano) (30 nM) ( n = 4). h Cells overexpressing Rere or Wdr5 and treated with TSA (30 nM) ( n = 4). i Cells overexpressing Rere or Wdr5 and treated with SB (1.5 mM) ( n = 4). j Cells transfected with expression plasmids containing Rere , N-Rere ( Rere N-terminal domain) or Rere C ( Rere C-terminal domain) ( n = 3). k Cells overexpressing N-Rere ( Rere N-terminal domain) and treated with TSA (30 nM) or SB (1.5 mM) ( n = 4). l Cells transfected with expression plasmids containing Rere , Wdr5 , or both ( n = 4). m Cells overexpressing Rere and treated with siRNA for Wdr5 ( n = 4). In all graphs data represent mean ± s.e.m. NS—not significant, * P
    Figure Legend Snippet: The WHHERE complex acts as a coactivator for retinoic acid signaling. a - k RARE-Luciferase activity from NIH3T3 cells treated or not with 1 µM RA for 20 h. a Cells transfected with expression plasmids containing Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). b Cells transfected with expression plasmids containing Hdac1 , Hdac2 , or both ( n = 4). c Cells treated either with siRNA for Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). d Cells treated with siRNA for Hdac1 , Hdac2 or both ( n = 4). e Cells overexpressing Rere or Wdr5 and treated with siRNA against Hdac1 ( n = 4). f Cells overexpressing Rere or Wdr5 and treated with siRNA against both Hdac1 and Hdac2 ( n = 4). g Cells treated with the HDAC inhibitors Trichostatin A (TSA) (60 nM), sodium butyrate (SB) (3 mM), apicidin (Api) (300 nM), LAQ824 (LAQ) (60 nM) and Panobinostat (Pano) (30 nM) ( n = 4). h Cells overexpressing Rere or Wdr5 and treated with TSA (30 nM) ( n = 4). i Cells overexpressing Rere or Wdr5 and treated with SB (1.5 mM) ( n = 4). j Cells transfected with expression plasmids containing Rere , N-Rere ( Rere N-terminal domain) or Rere C ( Rere C-terminal domain) ( n = 3). k Cells overexpressing N-Rere ( Rere N-terminal domain) and treated with TSA (30 nM) or SB (1.5 mM) ( n = 4). l Cells transfected with expression plasmids containing Rere , Wdr5 , or both ( n = 4). m Cells overexpressing Rere and treated with siRNA for Wdr5 ( n = 4). In all graphs data represent mean ± s.e.m. NS—not significant, * P

    Techniques Used: Luciferase, Activity Assay, Transfection, Expressing

    8) Product Images from "Proteolytic Processing of the p75 Neurotrophin Receptor and Two Homologs Generates C-Terminal Fragments with Signaling Capability"

    Article Title: Proteolytic Processing of the p75 Neurotrophin Receptor and Two Homologs Generates C-Terminal Fragments with Signaling Capability

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.23-13-05425.2003

    Soluble intracellular domains of p75 NTR and NRH2 potentiate NF-κB activation by TRAF6. HEK293 cells were cotransfected with a κB-luciferase reporter and the normalization vector EF1-LacZ, and either TRAF6 (black bars) or an empty vector control (open bars), and full-length rat p75 NTR , rat p75 NTR ICD, full-length mouse NRH2 L -MT, mouse NRH2 ICD, or empty vector control. Twenty-four hours after transfection, cells were lysed and assayed for luciferase expression. In the absence of TRAF6 expression, mild activation of NF-κB resulted from the expression of the p75 NTR ICD compared with the empty vector control. This degree of activation was dwarfed by the basal activity seen in the presence of TRAF6 expression. When TRAF6 was coexpressed, activation of NF-κB by full-length p75 NTR and NRH2 did not significantly differ from the empty vector control. In contrast, soluble p75 NTR ICD and NRH2 ICD significantly potentiated NF-κB activation by TRAF6. Two-tailed t test; p75 NTR ICD versus vector: * p = 0.012; NRH2 ICD versus vector: * p = 0.007. Error bars represent SD; n = 3.
    Figure Legend Snippet: Soluble intracellular domains of p75 NTR and NRH2 potentiate NF-κB activation by TRAF6. HEK293 cells were cotransfected with a κB-luciferase reporter and the normalization vector EF1-LacZ, and either TRAF6 (black bars) or an empty vector control (open bars), and full-length rat p75 NTR , rat p75 NTR ICD, full-length mouse NRH2 L -MT, mouse NRH2 ICD, or empty vector control. Twenty-four hours after transfection, cells were lysed and assayed for luciferase expression. In the absence of TRAF6 expression, mild activation of NF-κB resulted from the expression of the p75 NTR ICD compared with the empty vector control. This degree of activation was dwarfed by the basal activity seen in the presence of TRAF6 expression. When TRAF6 was coexpressed, activation of NF-κB by full-length p75 NTR and NRH2 did not significantly differ from the empty vector control. In contrast, soluble p75 NTR ICD and NRH2 ICD significantly potentiated NF-κB activation by TRAF6. Two-tailed t test; p75 NTR ICD versus vector: * p = 0.012; NRH2 ICD versus vector: * p = 0.007. Error bars represent SD; n = 3.

    Techniques Used: Activation Assay, Luciferase, Plasmid Preparation, Transfection, Expressing, Activity Assay, Two Tailed Test

    9) Product Images from "Mutual regulation of c-Jun and ATF2 by transcriptional activation and subcellular localization"

    Article Title: Mutual regulation of c-Jun and ATF2 by transcriptional activation and subcellular localization

    Journal: The EMBO Journal

    doi: 10.1038/sj.emboj.7601020

    Subcellular localization of AP-1 dimers and proteins. ( A ) Plasmids encoding c-Fos, c-Jun and ATF2 fused to N-terminal residues 1–172 (VN), C-terminal residues 155–238 (VC) of Venus, or full-length Venus (Venus) were cotransfected into COS-1 cells. Representatives of fluorescent images of different AP-1 dimers and proteins captured at 12 h post-transfection are shown. Venus alone was included as a control. ( B ) Quantification of subcellular localization of different AP dimers and proteins from (A). The error bar indicates standard deviation.
    Figure Legend Snippet: Subcellular localization of AP-1 dimers and proteins. ( A ) Plasmids encoding c-Fos, c-Jun and ATF2 fused to N-terminal residues 1–172 (VN), C-terminal residues 155–238 (VC) of Venus, or full-length Venus (Venus) were cotransfected into COS-1 cells. Representatives of fluorescent images of different AP-1 dimers and proteins captured at 12 h post-transfection are shown. Venus alone was included as a control. ( B ) Quantification of subcellular localization of different AP dimers and proteins from (A). The error bar indicates standard deviation.

    Techniques Used: Transfection, Standard Deviation

    10) Product Images from "Smurf1 inhibits integrin activation by controlling Kindlin-2 ubiquitination and degradation"

    Article Title: Smurf1 inhibits integrin activation by controlling Kindlin-2 ubiquitination and degradation

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201609073

    Smurf1 has no effect on Talin-H degradation. (A) CFP-Talin-H plasmid (2 µg) was transfected into HEK293T cells together with increasing amounts of Smurf1 expression vector. Talin-H expression was determined by immunoblotting with an anti-GFP antibody 24 h after transfection. (B) Flag-Smurf1 was transfected into HEK293T cells together with Talin-H or mutants of Talin-H, and Talin-H expression was examined. (C) HEK293T cells transfected with Flag-Talin-H were treated with proteasome inhibitor MG132 (20 µM) or DMSO for 6 h, and Smurf1 and Flag-Talin-H protein expression were detected. (D) Flag-Talin-H and HA-Ub plasmids were cotransfected into HEK293T cells together with control vector, Myc-Smurf1 (WT), or Myc-Smurf1 (C699A) expression plasmid. Talin-H ubiquitination was detected by immunoprecipitation with anti-Flag M2 beads and immunoblotting with anti-HA antibody. (E) HEK293T cells were transfected with Flag-Talin-H, Myc-Smurf1, and K48R or K63R Ub mutant plasmids, and after 24 h, an in vivo ubiquitination assay was performed. (F) HEK293T cells were transfected with Flag-Talin-H, Myc-Smurf1, and different linkage Ub plasmids, and after 24 h, an in vivo ubiquitination assay was performed. (G) HEK293T cells were transfected with HA-Ub, Myc-Smurf1, and Flag-Talin-H K83+357 mutant plasmid, and then an in vivo ubiquitination assay was performed.
    Figure Legend Snippet: Smurf1 has no effect on Talin-H degradation. (A) CFP-Talin-H plasmid (2 µg) was transfected into HEK293T cells together with increasing amounts of Smurf1 expression vector. Talin-H expression was determined by immunoblotting with an anti-GFP antibody 24 h after transfection. (B) Flag-Smurf1 was transfected into HEK293T cells together with Talin-H or mutants of Talin-H, and Talin-H expression was examined. (C) HEK293T cells transfected with Flag-Talin-H were treated with proteasome inhibitor MG132 (20 µM) or DMSO for 6 h, and Smurf1 and Flag-Talin-H protein expression were detected. (D) Flag-Talin-H and HA-Ub plasmids were cotransfected into HEK293T cells together with control vector, Myc-Smurf1 (WT), or Myc-Smurf1 (C699A) expression plasmid. Talin-H ubiquitination was detected by immunoprecipitation with anti-Flag M2 beads and immunoblotting with anti-HA antibody. (E) HEK293T cells were transfected with Flag-Talin-H, Myc-Smurf1, and K48R or K63R Ub mutant plasmids, and after 24 h, an in vivo ubiquitination assay was performed. (F) HEK293T cells were transfected with Flag-Talin-H, Myc-Smurf1, and different linkage Ub plasmids, and after 24 h, an in vivo ubiquitination assay was performed. (G) HEK293T cells were transfected with HA-Ub, Myc-Smurf1, and Flag-Talin-H K83+357 mutant plasmid, and then an in vivo ubiquitination assay was performed.

    Techniques Used: Plasmid Preparation, Transfection, Expressing, Immunoprecipitation, Mutagenesis, In Vivo, Ubiquitin Assay

    11) Product Images from "Developing the IVIG biomimetic, Hexa-Fc, for drug and vaccine applications"

    Article Title: Developing the IVIG biomimetic, Hexa-Fc, for drug and vaccine applications

    Journal: Scientific Reports

    doi: 10.1038/srep09526

    Hexa-Fc binds Fc-receptors with high avidity. (a) Hexa-Fc binds to FcRL5 and FcγRIIb (CD32b). Binding of either heat-aggregated IgG1 (left panel) or hexa-Fc (right panel) to cells expressing FcRL5 (orange trace), FcγRIIb (blue trace), CD200R control (grey trace) or FcRL4 control (green trace). Binding to CD200R and FcRL4 (human IgA receptor) are included as two negative controls. Data are representative of duplicate experiments. (b) Improved binding of hexa-Fc when FcγRIIb and FcRL5 are simultaneously expressed on the surface of 293 cells. Binding of heat-aggregated IgG1 (left panel) or hexa-Fc (right panel) to FcRL5/FcγRIIb double transfectants (orange trace), FcRL5 single transfectants (red trace), FcRL4/FcγRIIb double transfectants (green trace) and FcγRIIb single transfectants (blue trace). CD200 transfected controls are omitted from the overlays for clarity. Cell surface expression of receptors was confirmed using FITC-conjugated anti-FLAG M2 mAb or anti-FcγRIIb antibodies (as shown in Figure S3 ). Data represent duplicate experiments.
    Figure Legend Snippet: Hexa-Fc binds Fc-receptors with high avidity. (a) Hexa-Fc binds to FcRL5 and FcγRIIb (CD32b). Binding of either heat-aggregated IgG1 (left panel) or hexa-Fc (right panel) to cells expressing FcRL5 (orange trace), FcγRIIb (blue trace), CD200R control (grey trace) or FcRL4 control (green trace). Binding to CD200R and FcRL4 (human IgA receptor) are included as two negative controls. Data are representative of duplicate experiments. (b) Improved binding of hexa-Fc when FcγRIIb and FcRL5 are simultaneously expressed on the surface of 293 cells. Binding of heat-aggregated IgG1 (left panel) or hexa-Fc (right panel) to FcRL5/FcγRIIb double transfectants (orange trace), FcRL5 single transfectants (red trace), FcRL4/FcγRIIb double transfectants (green trace) and FcγRIIb single transfectants (blue trace). CD200 transfected controls are omitted from the overlays for clarity. Cell surface expression of receptors was confirmed using FITC-conjugated anti-FLAG M2 mAb or anti-FcγRIIb antibodies (as shown in Figure S3 ). Data represent duplicate experiments.

    Techniques Used: Binding Assay, Expressing, Transfection

    12) Product Images from "Hydroxylase Activity of ASPH Promotes Hepatocellular Carcinoma Metastasis Through Epithelial-to-Mesenchymal Transition Pathway"

    Article Title: Hydroxylase Activity of ASPH Promotes Hepatocellular Carcinoma Metastasis Through Epithelial-to-Mesenchymal Transition Pathway

    Journal: EBioMedicine

    doi: 10.1016/j.ebiom.2018.05.004

    ASPH hydroxylase activity promotes HCC formation and metastasis in vivo. (a) Visible liver tumor formation or intrahepatic metastatic nodules in nude mice transplanted with Huh-7 cells over-expressing control vector, wild type and H679A in the liver (n = 25 for each group). Scale bar , 1 cm. (b) The quantification of intrahepatic metastasis in the mice with liver tumor formation. Left y axis : the number of mice with or without visible intrahepatic metastasis in each group as indicated; right y axis : the total number of observed metastatic nodules in each group as indicated. (c) Histological or immunohistochemical examination of the liver tumor. a , b , c , liver tumor formed by Huh-7 cells transfected with control, wild type and H679A, respectively, 100× magnification. d , e , microsatellite tumor and stromal infiltration found in the liver tumor in the group of ASPH, 200× magnification. f , g , h , immunostaining of vimentin in the liver tumors of indicated groups, 400× magnification. (d) Histological or immunohistochemical examination of metastatic nodules detected in the lungs of mice subcutaneously injected with MHCC-97L cells with ASPH silenced or transfected with control vector only (n = 25 for each group). a , metastatic nodules in the lungs of mice injected with MHCC-97L cells, 200× magnification. b , lungs without metastatic lesion in mice injected with control MHCC-97L cells, 200× magnification. c , immunostaining of vimentin in the lung metastatic nodules, 400× magnification. d , immunostaining of vimentin in the primary subcutaneous tumor, 400× magnification. (e) The counting of lung metastasis in the mice with subcutaneous tumor formation. Left y axis : the number of mice with or without detectable metastasis in each group as indicated; right y axis : the total number of observed micro-metastatic lesion in each group as indicated.
    Figure Legend Snippet: ASPH hydroxylase activity promotes HCC formation and metastasis in vivo. (a) Visible liver tumor formation or intrahepatic metastatic nodules in nude mice transplanted with Huh-7 cells over-expressing control vector, wild type and H679A in the liver (n = 25 for each group). Scale bar , 1 cm. (b) The quantification of intrahepatic metastasis in the mice with liver tumor formation. Left y axis : the number of mice with or without visible intrahepatic metastasis in each group as indicated; right y axis : the total number of observed metastatic nodules in each group as indicated. (c) Histological or immunohistochemical examination of the liver tumor. a , b , c , liver tumor formed by Huh-7 cells transfected with control, wild type and H679A, respectively, 100× magnification. d , e , microsatellite tumor and stromal infiltration found in the liver tumor in the group of ASPH, 200× magnification. f , g , h , immunostaining of vimentin in the liver tumors of indicated groups, 400× magnification. (d) Histological or immunohistochemical examination of metastatic nodules detected in the lungs of mice subcutaneously injected with MHCC-97L cells with ASPH silenced or transfected with control vector only (n = 25 for each group). a , metastatic nodules in the lungs of mice injected with MHCC-97L cells, 200× magnification. b , lungs without metastatic lesion in mice injected with control MHCC-97L cells, 200× magnification. c , immunostaining of vimentin in the lung metastatic nodules, 400× magnification. d , immunostaining of vimentin in the primary subcutaneous tumor, 400× magnification. (e) The counting of lung metastasis in the mice with subcutaneous tumor formation. Left y axis : the number of mice with or without detectable metastasis in each group as indicated; right y axis : the total number of observed micro-metastatic lesion in each group as indicated.

    Techniques Used: Activity Assay, In Vivo, Mouse Assay, Expressing, Plasmid Preparation, Immunohistochemistry, Transfection, Immunostaining, Injection

    ASPH hydroxylase activity regulate epithelial-to-mesenchymal transition of HCC cells. (a) The relative up- or down-regulation of EMT biomarkers and regulatory genes in EHBC-512 cells transfected with indicated constructs by the EMT PCR-array normalized by control cells transfected with vector only. (b) The validation of gene expression based on PCR-array results in EHBC-512 cells transfected with indicated constructs. (c) and (d) The immunoblot and immunostaining of EMT biomarker including γ-catenin, α-catenin, E-cadherin and vimentin in Huh-7 cells transfected with indicated constructs. Fluorescent images were taken under 600× magnification. (e) The activation of notch pathway genes in EHBC-512 cells transfected with indicated constructs. Empty vector served as control. *P
    Figure Legend Snippet: ASPH hydroxylase activity regulate epithelial-to-mesenchymal transition of HCC cells. (a) The relative up- or down-regulation of EMT biomarkers and regulatory genes in EHBC-512 cells transfected with indicated constructs by the EMT PCR-array normalized by control cells transfected with vector only. (b) The validation of gene expression based on PCR-array results in EHBC-512 cells transfected with indicated constructs. (c) and (d) The immunoblot and immunostaining of EMT biomarker including γ-catenin, α-catenin, E-cadherin and vimentin in Huh-7 cells transfected with indicated constructs. Fluorescent images were taken under 600× magnification. (e) The activation of notch pathway genes in EHBC-512 cells transfected with indicated constructs. Empty vector served as control. *P

    Techniques Used: Activity Assay, Transfection, Construct, Polymerase Chain Reaction, Plasmid Preparation, Expressing, Immunostaining, Biomarker Assay, Activation Assay

    The role of ASPH-vimentin interaction in promoting HCC cell migration. (a) and (b) Identification of exogenous ASPH-vimentin interaction. Left : The base-peak plot of mass spectrometry analysis of protein complex from pull-down assay in 293 cells over-expressed with FLAG-fusion ASPH or HA-fusion vimentin using protein tag antibodies. Right : identified peptide sequence belonging to vimentin and ASPH in the protein complex. (c) Validation of endogenous ASPH-vimentin interaction. The immunoblot (IB) of the protein immuno-precipitated (IP) with FE1 and anti-vimentin in MHCC-97 cells. (d) Validation of manipulated vimentin expression in MHCC-97L and Huh-7 cells. Left : complementary over-expression of vimentin control and ASPH-silenced MHCC-97L cells. Right : complementary silencing vimentin in control and ASPH-over-expressed Huh-7 cells. The relative quantification of blotting results is shown below. (e) The indispensable role of vimentin for ASPH in regulating cell migration. Left : functional blockade of cell migration by silencing vimentin in ASPH-over-expressed Huh-7 cells. Right : functional rescue cell migration by over-expressing vimentin in ASPH-silenced in MHCC-97L cells. (f) Effect of hydroxylase inhibition to vimentin-dependent cell migration. Left y axis : the statistical results of cell migration in vimentin-over-expressed MHCC-97L cells that is treated by DIPY (1 μM) and DMOG (100 nM). right y axis : the corresponding increased fold of cell migration by vimentin over-expression in comparison to control group. All data are shown as average ± SD based on at least three independent experiments after normalization to the control group. *P
    Figure Legend Snippet: The role of ASPH-vimentin interaction in promoting HCC cell migration. (a) and (b) Identification of exogenous ASPH-vimentin interaction. Left : The base-peak plot of mass spectrometry analysis of protein complex from pull-down assay in 293 cells over-expressed with FLAG-fusion ASPH or HA-fusion vimentin using protein tag antibodies. Right : identified peptide sequence belonging to vimentin and ASPH in the protein complex. (c) Validation of endogenous ASPH-vimentin interaction. The immunoblot (IB) of the protein immuno-precipitated (IP) with FE1 and anti-vimentin in MHCC-97 cells. (d) Validation of manipulated vimentin expression in MHCC-97L and Huh-7 cells. Left : complementary over-expression of vimentin control and ASPH-silenced MHCC-97L cells. Right : complementary silencing vimentin in control and ASPH-over-expressed Huh-7 cells. The relative quantification of blotting results is shown below. (e) The indispensable role of vimentin for ASPH in regulating cell migration. Left : functional blockade of cell migration by silencing vimentin in ASPH-over-expressed Huh-7 cells. Right : functional rescue cell migration by over-expressing vimentin in ASPH-silenced in MHCC-97L cells. (f) Effect of hydroxylase inhibition to vimentin-dependent cell migration. Left y axis : the statistical results of cell migration in vimentin-over-expressed MHCC-97L cells that is treated by DIPY (1 μM) and DMOG (100 nM). right y axis : the corresponding increased fold of cell migration by vimentin over-expression in comparison to control group. All data are shown as average ± SD based on at least three independent experiments after normalization to the control group. *P

    Techniques Used: Migration, Mass Spectrometry, Pull Down Assay, Sequencing, Expressing, Over Expression, Functional Assay, Inhibition

    13) Product Images from "Molecular cloning and expression of a human hST8Sia VI (?2,8-sialyltransferase) responsible for the synthesis of the diSia motif on O-glycosylproteins"

    Article Title: Molecular cloning and expression of a human hST8Sia VI (?2,8-sialyltransferase) responsible for the synthesis of the diSia motif on O-glycosylproteins

    Journal:

    doi: 10.1042/BJ20051120

    HPLC/DMB analysis of α2,8-linked-[ 14 C]-Neu5Ac on fetuin
    Figure Legend Snippet: HPLC/DMB analysis of α2,8-linked-[ 14 C]-Neu5Ac on fetuin

    Techniques Used: High Performance Liquid Chromatography

    14) Product Images from "Hepatitis C Virus NS5A Protein Interacts with Phosphatidylinositol 4-Kinase Type III? and Regulates Viral Propagation *"

    Article Title: Hepatitis C Virus NS5A Protein Interacts with Phosphatidylinositol 4-Kinase Type III? and Regulates Viral Propagation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.194472

    PI4KIIIα is a component of the HCV RNA replication complex. Huh7.5 cells were either mock-infected or infected with HCVcc. At 2 days postinfection, cells were transfected with plasmid expressing FLAG-tagged PI4KIIIα. At 36 h after transfection,
    Figure Legend Snippet: PI4KIIIα is a component of the HCV RNA replication complex. Huh7.5 cells were either mock-infected or infected with HCVcc. At 2 days postinfection, cells were transfected with plasmid expressing FLAG-tagged PI4KIIIα. At 36 h after transfection,

    Techniques Used: Infection, Transfection, Plasmid Preparation, Expressing

    Silencing of PI4KIIIα reduces both protein expression and RNA replication levels in HCV subgenomic replicon cells. A , Huh7 cells harboring HCV subgenomic replicon were transfected with PI4KIIIα siRNA pool or the indicated control siRNA
    Figure Legend Snippet: Silencing of PI4KIIIα reduces both protein expression and RNA replication levels in HCV subgenomic replicon cells. A , Huh7 cells harboring HCV subgenomic replicon were transfected with PI4KIIIα siRNA pool or the indicated control siRNA

    Techniques Used: Expressing, Transfection

    NS5A interacts with PI4KIIIα. Either Huh7.5 ( A ) or HEK293T ( B ) cells were transfected with Myc-tagged NS5A of HCV genotypes 1b or 2a in the absence or presence of FLAG-tagged PI4KIIIα. Total cell lysates were immunoprecipitated ( IP ) with
    Figure Legend Snippet: NS5A interacts with PI4KIIIα. Either Huh7.5 ( A ) or HEK293T ( B ) cells were transfected with Myc-tagged NS5A of HCV genotypes 1b or 2a in the absence or presence of FLAG-tagged PI4KIIIα. Total cell lysates were immunoprecipitated ( IP ) with

    Techniques Used: Transfection, Immunoprecipitation

    Knockdown of PI4KIIIα blocks HCV propagation. A , Huh7.5 cells were transfected with PI4KIIIα siRNAs or the indicated siRNA constructs and followed by HCV infection at 48 h after transfection. Total cell lysates harvested at 48 h after
    Figure Legend Snippet: Knockdown of PI4KIIIα blocks HCV propagation. A , Huh7.5 cells were transfected with PI4KIIIα siRNAs or the indicated siRNA constructs and followed by HCV infection at 48 h after transfection. Total cell lysates harvested at 48 h after

    Techniques Used: Transfection, Construct, Infection

    NS5A interacts with PI4KIIIα through aa 401–600 of PI4KIIIα and domain I of NS5A. A , schematic diagram of both wild-type and mutant constructs of PI4KIIIα protein. LKU , lipid kinase unique domain; PH , pleckstrin homology;
    Figure Legend Snippet: NS5A interacts with PI4KIIIα through aa 401–600 of PI4KIIIα and domain I of NS5A. A , schematic diagram of both wild-type and mutant constructs of PI4KIIIα protein. LKU , lipid kinase unique domain; PH , pleckstrin homology;

    Techniques Used: Mutagenesis, Construct

    15) Product Images from "Nuclear localization of actin requires AC102 in Autographa californica multiple nucleopolyhedrovirus-infected cells"

    Article Title: Nuclear localization of actin requires AC102 in Autographa californica multiple nucleopolyhedrovirus-infected cells

    Journal: The Journal of General Virology

    doi: 10.1099/vir.0.041848-0

    Comparative growth curves of WOBpos, AcΔ he65 and AcΔ 004 , and localization of HE65 and AC004. (a, b) One-step growth curves of WOBpos (•) and (a) AcΔ he65 (○) or (b) AcΔ 004 (○) in Sf 9 cells (m.o.i. = 10).
    Figure Legend Snippet: Comparative growth curves of WOBpos, AcΔ he65 and AcΔ 004 , and localization of HE65 and AC004. (a, b) One-step growth curves of WOBpos (•) and (a) AcΔ he65 (○) or (b) AcΔ 004 (○) in Sf 9 cells (m.o.i. = 10).

    Techniques Used:

    16) Product Images from "Identification of a Gypsy SHOX mutation (p.A170P) in L?ri-Weill dyschondrosteosis and Langer mesomelic dysplasia"

    Article Title: Identification of a Gypsy SHOX mutation (p.A170P) in L?ri-Weill dyschondrosteosis and Langer mesomelic dysplasia

    Journal: European Journal of Human Genetics

    doi: 10.1038/ejhg.2011.128

    Subcellular localization studies of wild-type and mutant A170P and A170D SHOX proteins. U2OS cells were transiently transfected with the SHOX wild-type and mutant constructs. SHOX expression was detected using a rabbit polyclonal SHOX antibody and the
    Figure Legend Snippet: Subcellular localization studies of wild-type and mutant A170P and A170D SHOX proteins. U2OS cells were transiently transfected with the SHOX wild-type and mutant constructs. SHOX expression was detected using a rabbit polyclonal SHOX antibody and the

    Techniques Used: Mutagenesis, Transfection, Construct, Expressing

    SHOX expression in the human fetal growth plate. Immunohistochemistry performed on the radius and ulna of a 22-week old LMD fetus homozygous for the A170P mutation (family 11, IV.9) and a 23-week old normal fetus. DAB immunostaining ( × 10 magnification)
    Figure Legend Snippet: SHOX expression in the human fetal growth plate. Immunohistochemistry performed on the radius and ulna of a 22-week old LMD fetus homozygous for the A170P mutation (family 11, IV.9) and a 23-week old normal fetus. DAB immunostaining ( × 10 magnification)

    Techniques Used: Expressing, Immunohistochemistry, Laser Capture Microdissection, Mutagenesis, Immunostaining

    Pedigrees of the 12 LWD/LMD families carrying the A170P SHOX mutation. Individuals with LWD are shown as gray filled symbols, whereas individuals with LMD are shown as black filled symbols. Individual IV.1 of family 1 was clinically and genetically diagnosed
    Figure Legend Snippet: Pedigrees of the 12 LWD/LMD families carrying the A170P SHOX mutation. Individuals with LWD are shown as gray filled symbols, whereas individuals with LMD are shown as black filled symbols. Individual IV.1 of family 1 was clinically and genetically diagnosed

    Techniques Used: Laser Capture Microdissection, Mutagenesis

    17) Product Images from "The small splice variant of HPV16 E6, E6*, reduces tumor formation in cervical carcinoma xenografts HPV16 E6* reduces tumor formation"

    Article Title: The small splice variant of HPV16 E6, E6*, reduces tumor formation in cervical carcinoma xenografts HPV16 E6* reduces tumor formation

    Journal: Virology

    doi: 10.1016/j.virol.2013.12.011

    Over-expression of E6* in C33A cells reduces tumor growth in a tumor xenograft model. A) A representative mouse bearing a tumor derived from C33A pFlag cells on the left side and a tumor derived from C33A E6* cells on the right side (upper panel). The bottom panel shows representative tumors following isolation on day 53 post-injection. B) The relative average tumor volume observed for the C33A pFlag and C33A pE6* tumors. The volume of tumor at day 7 was set at 100%. Error bars represent the standard error of the mean. ** indicates that the mean tumor volumes at day 53 were significantly different between the two groups.
    Figure Legend Snippet: Over-expression of E6* in C33A cells reduces tumor growth in a tumor xenograft model. A) A representative mouse bearing a tumor derived from C33A pFlag cells on the left side and a tumor derived from C33A E6* cells on the right side (upper panel). The bottom panel shows representative tumors following isolation on day 53 post-injection. B) The relative average tumor volume observed for the C33A pFlag and C33A pE6* tumors. The volume of tumor at day 7 was set at 100%. Error bars represent the standard error of the mean. ** indicates that the mean tumor volumes at day 53 were significantly different between the two groups.

    Techniques Used: Over Expression, Derivative Assay, Isolation, Injection

    Expression and activity of E6* in SiHa and C33A cells. A and C) Pooled SiHa pE6*(A) and C33A pE6* (C) cells express Flag-E6*. PVDF membranes carrying the SDS-separated proteins were probed with α-Flag-HRP antibodies, and α-β-actin antibodies were used to normalize for protein load or immunoprecipitation input, respectively (A and C) (bottom panels). B) The ratio between the levels of mRNA expression of E6 and E6* in SiHa pFlag and SiHa pE6* cells is presented as a fold-change relative to β-actin expression as determined by qRT-PCR. D, E, F and G) Expression of E6* in SiHa cells affects the level of expression of procaspase 8 and p53 as detected by immunoblot (D) and by p53-ELISA (E), as well as TNF-α-induced apoptosis (F) and expression of E-cadherin (G). D) Cell lysates prepared from SiHa pFlag and SiHa pE6* cells were treated with 10 uM MG 132 for 16 h prior to lysis. Detection of p53 and caspase 8 was performed by immunoblot, β-actin was used for normalization. E) 10 6 SiHa pFlag or SiHa pE6* cells were treated with either mitomycin C or DMSO (control) for 16 h prior to lysis. p53 ELISA was performed as described in Material and Methods. Data is presented as the optical density at 405 nm per mg protein in cells treated with mitomycin C, minus that same measurement in cells not treated with mitomycin C. Measurements were made in triplicate, and the error bars represent the standard deviation. * indicates a 0.98 level of confidence. F) 10 4 cells per well were seeded onto a 96-well plate. Cells were treated with 10 μg/ml of cycloheximide in the presence or absence of 50 ng/ml of TNF-α for 16 h. Cell viability was monitored using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). ** indicates a 0.99 level of confidence. G) The E-cadherin level was detected by immunoblot in lysates prepared from SiHa pFlag, SiHa pE6* and CaSki cells, normalized by β-actin.
    Figure Legend Snippet: Expression and activity of E6* in SiHa and C33A cells. A and C) Pooled SiHa pE6*(A) and C33A pE6* (C) cells express Flag-E6*. PVDF membranes carrying the SDS-separated proteins were probed with α-Flag-HRP antibodies, and α-β-actin antibodies were used to normalize for protein load or immunoprecipitation input, respectively (A and C) (bottom panels). B) The ratio between the levels of mRNA expression of E6 and E6* in SiHa pFlag and SiHa pE6* cells is presented as a fold-change relative to β-actin expression as determined by qRT-PCR. D, E, F and G) Expression of E6* in SiHa cells affects the level of expression of procaspase 8 and p53 as detected by immunoblot (D) and by p53-ELISA (E), as well as TNF-α-induced apoptosis (F) and expression of E-cadherin (G). D) Cell lysates prepared from SiHa pFlag and SiHa pE6* cells were treated with 10 uM MG 132 for 16 h prior to lysis. Detection of p53 and caspase 8 was performed by immunoblot, β-actin was used for normalization. E) 10 6 SiHa pFlag or SiHa pE6* cells were treated with either mitomycin C or DMSO (control) for 16 h prior to lysis. p53 ELISA was performed as described in Material and Methods. Data is presented as the optical density at 405 nm per mg protein in cells treated with mitomycin C, minus that same measurement in cells not treated with mitomycin C. Measurements were made in triplicate, and the error bars represent the standard deviation. * indicates a 0.98 level of confidence. F) 10 4 cells per well were seeded onto a 96-well plate. Cells were treated with 10 μg/ml of cycloheximide in the presence or absence of 50 ng/ml of TNF-α for 16 h. Cell viability was monitored using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). ** indicates a 0.99 level of confidence. G) The E-cadherin level was detected by immunoblot in lysates prepared from SiHa pFlag, SiHa pE6* and CaSki cells, normalized by β-actin.

    Techniques Used: Expressing, Activity Assay, Immunoprecipitation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Lysis, Standard Deviation, Cell Viability Assay

    Over-expression of E6* in SiHa cells reduces tumor growth in a tumor xenograft model. A) A representative mouse bearing a tumor derived from SiHa pFlag cells on the left side and a tumor derived from SiHa E6* cells on the right side (upper panel). The bottom panel shows representative tumors following isolation the 88 th day post-injection. B) The relative average tumor volume observed for the SiHa pFlag and SiHa pE6* tumors. The volume of the tumor at day 4 was set at 100%, and error bars represent the standard error of the mean. ** indicates that the mean tumor volumes at day 88 were significantly different between the two groups (P > 0.99). C) Expression of E6 and E6* at the mRNA level in dissected tumors derived from SiHa pFlag and SiHa pE6*. Expression of Flag-E6* and Flag-E6 transcripts in tumors was detected by RT-PCR using primers specific for Flag-E6* (Flag F and Flag R primers) (left and medium panels) and for E6 (E6-5′ and E6-3′) (right panel). 1, 3 – RNA; 2, 4, 5 and 6 – cDNA.
    Figure Legend Snippet: Over-expression of E6* in SiHa cells reduces tumor growth in a tumor xenograft model. A) A representative mouse bearing a tumor derived from SiHa pFlag cells on the left side and a tumor derived from SiHa E6* cells on the right side (upper panel). The bottom panel shows representative tumors following isolation the 88 th day post-injection. B) The relative average tumor volume observed for the SiHa pFlag and SiHa pE6* tumors. The volume of the tumor at day 4 was set at 100%, and error bars represent the standard error of the mean. ** indicates that the mean tumor volumes at day 88 were significantly different between the two groups (P > 0.99). C) Expression of E6 and E6* at the mRNA level in dissected tumors derived from SiHa pFlag and SiHa pE6*. Expression of Flag-E6* and Flag-E6 transcripts in tumors was detected by RT-PCR using primers specific for Flag-E6* (Flag F and Flag R primers) (left and medium panels) and for E6 (E6-5′ and E6-3′) (right panel). 1, 3 – RNA; 2, 4, 5 and 6 – cDNA.

    Techniques Used: Over Expression, Derivative Assay, Isolation, Injection, Expressing, Reverse Transcription Polymerase Chain Reaction

    18) Product Images from "Visualization of NO3−/NO2− Dynamics in Living Cells by Fluorescence Resonance Energy Transfer (FRET) Imaging Employing a Rhizobial Two-component Regulatory System *"

    Article Title: Visualization of NO3−/NO2− Dynamics in Living Cells by Fluorescence Resonance Energy Transfer (FRET) Imaging Employing a Rhizobial Two-component Regulatory System *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.687632

    Monitoring the cytoplasmic NO 3 − levels of HeLa cells. A, schematic diagram of pCMV-sNOOOpy, the plasmid for mammalian expression, contains a nuclear export signal fused to CFP-NasT and NasS-YFP, and they linked by a self-processing 2A peptide.
    Figure Legend Snippet: Monitoring the cytoplasmic NO 3 − levels of HeLa cells. A, schematic diagram of pCMV-sNOOOpy, the plasmid for mammalian expression, contains a nuclear export signal fused to CFP-NasT and NasS-YFP, and they linked by a self-processing 2A peptide.

    Techniques Used: Plasmid Preparation, Expressing

    19) Product Images from "Visualization of NO3−/NO2− Dynamics in Living Cells by Fluorescence Resonance Energy Transfer (FRET) Imaging Employing a Rhizobial Two-component Regulatory System *"

    Article Title: Visualization of NO3−/NO2− Dynamics in Living Cells by Fluorescence Resonance Energy Transfer (FRET) Imaging Employing a Rhizobial Two-component Regulatory System *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.687632

    Monitoring the cytoplasmic NO 3 − levels of HeLa cells. A, schematic diagram of pCMV-sNOOOpy, the plasmid for mammalian expression, contains a nuclear export signal fused to CFP-NasT and NasS-YFP, and they linked by a self-processing 2A peptide.
    Figure Legend Snippet: Monitoring the cytoplasmic NO 3 − levels of HeLa cells. A, schematic diagram of pCMV-sNOOOpy, the plasmid for mammalian expression, contains a nuclear export signal fused to CFP-NasT and NasS-YFP, and they linked by a self-processing 2A peptide.

    Techniques Used: Plasmid Preparation, Expressing

    20) Product Images from "Polo-like Kinase 1 (Plk1) Up-regulates Telomerase Activity by Affecting Human Telomerase Reverse Transcriptase (hTERT) Stability *"

    Article Title: Polo-like Kinase 1 (Plk1) Up-regulates Telomerase Activity by Affecting Human Telomerase Reverse Transcriptase (hTERT) Stability *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.635375

    Plk1 interacts with hTERT and active telomerase complexes. A , 293T cells were co-transfected with pCMV FLAG-hTERT and pCMV myc-Cdk1, pCMV myc-Cdk2, pCMV myc-Cdk4, or pCMV myc-Plk1 expression plasmids or empty vector as the control. The total cell lysates
    Figure Legend Snippet: Plk1 interacts with hTERT and active telomerase complexes. A , 293T cells were co-transfected with pCMV FLAG-hTERT and pCMV myc-Cdk1, pCMV myc-Cdk2, pCMV myc-Cdk4, or pCMV myc-Plk1 expression plasmids or empty vector as the control. The total cell lysates

    Techniques Used: Transfection, Expressing, Plasmid Preparation

    Plk1 decelerates the ubiquitination of hTERT. A , 293T cells were co-transfected with pCMV HA-ubiquitin ( ub )-, pCMV FLAG-hTERT-, and pCMV myc-Plk1-expressing plasmids for 24 h and then treated with or without 5 μ m MG132 for 16 h. The total cell
    Figure Legend Snippet: Plk1 decelerates the ubiquitination of hTERT. A , 293T cells were co-transfected with pCMV HA-ubiquitin ( ub )-, pCMV FLAG-hTERT-, and pCMV myc-Plk1-expressing plasmids for 24 h and then treated with or without 5 μ m MG132 for 16 h. The total cell

    Techniques Used: Transfection, Expressing

    Plk1 can prolong the half-life of hTERT protein. A , 293T cells were transfected with pCMV FLAG-hTERT and pCMV myc-Plk1 or empty vector as the control for 36 h. Then the cells were treated with 100 μg/ml cycloheximide ( CHX ) for the indicated time.
    Figure Legend Snippet: Plk1 can prolong the half-life of hTERT protein. A , 293T cells were transfected with pCMV FLAG-hTERT and pCMV myc-Plk1 or empty vector as the control for 36 h. Then the cells were treated with 100 μg/ml cycloheximide ( CHX ) for the indicated time.

    Techniques Used: Transfection, Plasmid Preparation

    21) Product Images from "PRRT2 Mutant Leads to Dysfunction of Glutamate Signaling"

    Article Title: PRRT2 Mutant Leads to Dysfunction of Glutamate Signaling

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms16059134

    Schematic representation of mutant PRRT2 affecting the glutamate signaling pathway.
    Figure Legend Snippet: Schematic representation of mutant PRRT2 affecting the glutamate signaling pathway.

    Techniques Used: Mutagenesis

    Knocking down Prrt2 increased glutamate level in the culture medium. ( A ) Representative HPLC chromatogram of glutamate and glycine in the culture medium; ( B ) Western blotting analysis was used to show the knockdown efficiency and the protein level of vGlut1 of both groups; ( C ) Summarized data (mean ± SD, n = 4) showed the level of glutamate and glycine detected by HPLC. * p
    Figure Legend Snippet: Knocking down Prrt2 increased glutamate level in the culture medium. ( A ) Representative HPLC chromatogram of glutamate and glycine in the culture medium; ( B ) Western blotting analysis was used to show the knockdown efficiency and the protein level of vGlut1 of both groups; ( C ) Summarized data (mean ± SD, n = 4) showed the level of glutamate and glycine detected by HPLC. * p

    Techniques Used: High Performance Liquid Chromatography, Western Blot

    ( A ) PRRT2 limits membrane distribution of GRIA1. The first row shows Flag-tagged wild type PRRT2 (red), live-labeling of the surface HA-tagged GRIA1 (green). The second row shows Flag-tagged p.A287T mutant form of PRRT2 (red), live-labeling of the surface HA-tagged GRIA1 (green). The last row shows Flag-tagged p.R217Pfs*8 mutant form of PRRT2 (red), live-labeling of the surface HA-tagged GRIA1 (green). Scale bar, 10 μm. DAPI (blue) was used to show nuclei; ( B ) Histogram shows the fold change of membrane GRIA1 intensity. Values are represented as mean ± SD, n = 10, ** p
    Figure Legend Snippet: ( A ) PRRT2 limits membrane distribution of GRIA1. The first row shows Flag-tagged wild type PRRT2 (red), live-labeling of the surface HA-tagged GRIA1 (green). The second row shows Flag-tagged p.A287T mutant form of PRRT2 (red), live-labeling of the surface HA-tagged GRIA1 (green). The last row shows Flag-tagged p.R217Pfs*8 mutant form of PRRT2 (red), live-labeling of the surface HA-tagged GRIA1 (green). Scale bar, 10 μm. DAPI (blue) was used to show nuclei; ( B ) Histogram shows the fold change of membrane GRIA1 intensity. Values are represented as mean ± SD, n = 10, ** p

    Techniques Used: Labeling, Mutagenesis

    Mutant PRRT2 interfered interactions between PRRT2 and its partners. ( A ) In vitro co-immunoprecipitation using cell extracts from HEK293T cells co-transfected with Myc-tagged SNAP25 and Flag-tagged different forms of PRRT2. After pull-down with Flag antibody, western blotting results demonstrated interactions between SNAP25 and different forms of PRRT2. Histogram showed the fold change of SNAP25 protein level after co-immunoprecipitation with Flag antibody; ( B ) In vitro co-immunoprecipitation with cell extracts from HEK293T cells co-transfected with Myc-tagged Prrt2 and HA-tagged Gria1. After pull-down with HA antibody, western blotting results showed interactions between Prrt2 and Gria1; ( C ) In vitro immunoprecipitation of Prrt2 and Gria1 in mouse brain extract using anti-Gria1 antibody. Western blotting was used to visualize protein signals; ( D ) In vitro co-immunoprecipitation using cell extract from HEK293T cells co-transfected with HA-tagged GRIA1 and Flag-tagged different forms of PRRT2. After pull-down with HA antibody, western blotting results showed interactions between GRIA1 and different forms of PRRT2. Histogram shows the fold change of PRRT2 protein levels after co-immunoprecipitation with HA antibody. Values are represented as mean ± SD, n = 3, ** p
    Figure Legend Snippet: Mutant PRRT2 interfered interactions between PRRT2 and its partners. ( A ) In vitro co-immunoprecipitation using cell extracts from HEK293T cells co-transfected with Myc-tagged SNAP25 and Flag-tagged different forms of PRRT2. After pull-down with Flag antibody, western blotting results demonstrated interactions between SNAP25 and different forms of PRRT2. Histogram showed the fold change of SNAP25 protein level after co-immunoprecipitation with Flag antibody; ( B ) In vitro co-immunoprecipitation with cell extracts from HEK293T cells co-transfected with Myc-tagged Prrt2 and HA-tagged Gria1. After pull-down with HA antibody, western blotting results showed interactions between Prrt2 and Gria1; ( C ) In vitro immunoprecipitation of Prrt2 and Gria1 in mouse brain extract using anti-Gria1 antibody. Western blotting was used to visualize protein signals; ( D ) In vitro co-immunoprecipitation using cell extract from HEK293T cells co-transfected with HA-tagged GRIA1 and Flag-tagged different forms of PRRT2. After pull-down with HA antibody, western blotting results showed interactions between GRIA1 and different forms of PRRT2. Histogram shows the fold change of PRRT2 protein levels after co-immunoprecipitation with HA antibody. Values are represented as mean ± SD, n = 3, ** p

    Techniques Used: Mutagenesis, In Vitro, Immunoprecipitation, Transfection, Western Blot

    Prrt2 colocalized with presynaptic and postsynaptic markers of glutamatergic neurons of mouse cortex. ( A , B ) Prrt2 (green) colocalized with both vGlut1 (red) and PSD95 (red) in the cortex. Scale bar, 20 μm; ( C ) Schematic diagram illustrates the protein structure of wild type (WT) and the mutant type (p.A287T and p.R217Pfs*8) of PRRT2. Black rectangles represent two putative C -terminal TM domains of PRRT2. Black arrows indicate the positions of mutations. Red lines represent protein sequence produced by missense or frameshift mutations; ( D ) Sequencing maps of both c.859G > A and c.649_650insC; ( E ) COS-7 cells transfected with Flag-tagged wild type (WT) PRRT2 (red); ( F ) COS-7 cells transfected with Flag-tagged p.A287T PRRT2 (red). Scale bar, 10 μm. DAPI (blue) was used to show nuclei.
    Figure Legend Snippet: Prrt2 colocalized with presynaptic and postsynaptic markers of glutamatergic neurons of mouse cortex. ( A , B ) Prrt2 (green) colocalized with both vGlut1 (red) and PSD95 (red) in the cortex. Scale bar, 20 μm; ( C ) Schematic diagram illustrates the protein structure of wild type (WT) and the mutant type (p.A287T and p.R217Pfs*8) of PRRT2. Black rectangles represent two putative C -terminal TM domains of PRRT2. Black arrows indicate the positions of mutations. Red lines represent protein sequence produced by missense or frameshift mutations; ( D ) Sequencing maps of both c.859G > A and c.649_650insC; ( E ) COS-7 cells transfected with Flag-tagged wild type (WT) PRRT2 (red); ( F ) COS-7 cells transfected with Flag-tagged p.A287T PRRT2 (red). Scale bar, 10 μm. DAPI (blue) was used to show nuclei.

    Techniques Used: Mutagenesis, Sequencing, Produced, Transfection

    22) Product Images from "Identification and characterization of a human mitochondrial NAD kinase"

    Article Title: Identification and characterization of a human mitochondrial NAD kinase

    Journal: Nature Communications

    doi: 10.1038/ncomms2262

    NADK activity of C5orf33 protein. ( a ) In vivo assay of NADK activity of C5orf33 protein. S. cerevisiae MK1598 cells (an NADK triple mutant having YCplac33- UTR1 ) carrying the indicated plasmids were spotted onto the solid media and were incubated at 30 °C for 4 days. C5orf33 protein was less effective than Δ62C5orf33 protein in reverting the lethality. We speculate that this is because in the yeast, human C5orf33 is less able to supply cytosolic NADP + than the yeast mitochondrial Pos5 itself. ( b ) SDS–PAGE of purified C5orf33 protein (arrowhead; 43 kDa). ( c ) NADK activity of purified C5orf33 protein analysed by TLC in the presence (+) or absence (−) of indicated compounds as described in the Methods. ( d ) Saturation curves for NAD + of purified human NADK (dashed line) 29 and C5orf33 protein (line) determined under 8 and 2 mM ATP, respectively. The specific activity (U μmol−1; 1 μmol NADP + produced per 1 min and 1 μmol subunit of the enzyme) was calculated using the subunit molecular mass of C5orf33 protein (45 kDa) or human NADK (43 kDa) ( Table 1 ). Each point represents the average of three determinations; error bars represent s.d.
    Figure Legend Snippet: NADK activity of C5orf33 protein. ( a ) In vivo assay of NADK activity of C5orf33 protein. S. cerevisiae MK1598 cells (an NADK triple mutant having YCplac33- UTR1 ) carrying the indicated plasmids were spotted onto the solid media and were incubated at 30 °C for 4 days. C5orf33 protein was less effective than Δ62C5orf33 protein in reverting the lethality. We speculate that this is because in the yeast, human C5orf33 is less able to supply cytosolic NADP + than the yeast mitochondrial Pos5 itself. ( b ) SDS–PAGE of purified C5orf33 protein (arrowhead; 43 kDa). ( c ) NADK activity of purified C5orf33 protein analysed by TLC in the presence (+) or absence (−) of indicated compounds as described in the Methods. ( d ) Saturation curves for NAD + of purified human NADK (dashed line) 29 and C5orf33 protein (line) determined under 8 and 2 mM ATP, respectively. The specific activity (U μmol−1; 1 μmol NADP + produced per 1 min and 1 μmol subunit of the enzyme) was calculated using the subunit molecular mass of C5orf33 protein (45 kDa) or human NADK (43 kDa) ( Table 1 ). Each point represents the average of three determinations; error bars represent s.d.

    Techniques Used: Activity Assay, In Vivo, Mutagenesis, Incubation, SDS Page, Purification, Thin Layer Chromatography, Produced

    Structure of C5orf33 protein. ( a ) Primary structures of the C5orf33 protein and its truncations. Predicted mitochondrial-targeting sequence and NADK motif are in black and grey, respectively. The amino-acid residue numbers are indicated on the structures. Asterisk in parentheses (*) indicates the start codon found in pMK3270 and pMK3243, but not in the sequence of C5orf33 variant 1. ( b ) mRNA structures of C5orf33 transcript variants 1 and 2. Grey arrows indicate open reading frames encoding the indicated proteins. The nucleotide (nt) base and amino-acid (aa) residue numbers are shown. The nucleotide sequences indicated by double-headed arrows are identical between variants 1 and 2. The putative start codon (ATG) is denoted by an asterisk ( a , b ). The nucleotide sequence of C5orf33 variant 2 ( 62 CTTGCATTGAAAGGCTCTAGTTAC 85 ) corresponds to the N-terminal region of the Δ100C5orf33 protein ( 101 LALKGSSY 108 ) ( a , b ).
    Figure Legend Snippet: Structure of C5orf33 protein. ( a ) Primary structures of the C5orf33 protein and its truncations. Predicted mitochondrial-targeting sequence and NADK motif are in black and grey, respectively. The amino-acid residue numbers are indicated on the structures. Asterisk in parentheses (*) indicates the start codon found in pMK3270 and pMK3243, but not in the sequence of C5orf33 variant 1. ( b ) mRNA structures of C5orf33 transcript variants 1 and 2. Grey arrows indicate open reading frames encoding the indicated proteins. The nucleotide (nt) base and amino-acid (aa) residue numbers are shown. The nucleotide sequences indicated by double-headed arrows are identical between variants 1 and 2. The putative start codon (ATG) is denoted by an asterisk ( a , b ). The nucleotide sequence of C5orf33 variant 2 ( 62 CTTGCATTGAAAGGCTCTAGTTAC 85 ) corresponds to the N-terminal region of the Δ100C5orf33 protein ( 101 LALKGSSY 108 ) ( a , b ).

    Techniques Used: Sequencing, Variant Assay

    Localization of C5orf33 protein in mitochondria of human cells. HEK293A cells were transiently transfected with plasmid expressing C terminally FLAG-tagged C5orf33 or Δ62C5orf33 protein. The cells were fixed and immunostained with a rabbit anti-FLAG primary antibody and AlexaFluor 488-conjugated anti-rabbit secondary antibody. Mitochondria were stained with MitoTracker Red.
    Figure Legend Snippet: Localization of C5orf33 protein in mitochondria of human cells. HEK293A cells were transiently transfected with plasmid expressing C terminally FLAG-tagged C5orf33 or Δ62C5orf33 protein. The cells were fixed and immunostained with a rabbit anti-FLAG primary antibody and AlexaFluor 488-conjugated anti-rabbit secondary antibody. Mitochondria were stained with MitoTracker Red.

    Techniques Used: Transfection, Plasmid Preparation, Expressing, Staining

    Tissue-specific mRNA levels determined by absolute qPCR. mRNAs of C5orf33 protein (dark grey), human NADK (light grey) and GAPDH (white bars) ( a ); only those of the C5orf33 protein and human NADK are shown in panel b . Means and s.d. of three determinations are shown.
    Figure Legend Snippet: Tissue-specific mRNA levels determined by absolute qPCR. mRNAs of C5orf33 protein (dark grey), human NADK (light grey) and GAPDH (white bars) ( a ); only those of the C5orf33 protein and human NADK are shown in panel b . Means and s.d. of three determinations are shown.

    Techniques Used: Real-time Polymerase Chain Reaction

    siRNA transfection. HEK293A cells were transfected with siRNA#2 against C5orf33 protein (C5orf33 siRNA) or control siRNA, and incubated for 1, 2 and 3 days. ( a ) Levels of C5orf33 mRNA in the transfected cells are shown as relative values normalized against the level in control siRNA-transfected cells incubated for 1 day after transfection. Knockdowns of 69, 63 and 79% relative to the control, as indicated, were obtained. ( b ) Expression of C5orf33 protein in the transfected cells. Proteins were analysed by western blotting using anti-C5orf33 and anti-GAPDH antibodies. ( c ) Viability. Transfected cells incubated for 3 days were treated with 12.5 μM menadione (black bar) or vehicle (0.62% (v/v) dimethyl sulfoxide (DMSO), grey bar) for 20 h, and viability was measured using calcein AM as in Supplementary Methods . Viability was also measured using MTT as in Supplementary Fig. S5 . ( d ) Intracellular ROS levels. Transfected cells incubated for 3 days were incubated with 10 μM 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) for 30 min, and then treated without (grey bar) or with (black bar) 100 μM menadione for 30 min; intracellular ROS was measured as described in Supplementary Methods . t -test; * P =0.0085, ** P =0.0026, *** P =0.0022, **** P =0.0044 × 10 −4 . Viability and intracellular ROS levels are presented as relative values normalized against their respective levels in control siRNA-transfected cells not treated with menadione; each independent experiment was conducted in duplicate ( c , d ). ( e ) Mitochondrial and cytosolic fractions of HEK293A cells that had been incubated for 3 days after transfections. Mitochondrial (M; 1.9 μg) and cytosolic (C; 1.9 μg) fractions and whole cells (W; from 3.3 × 10 4 transfected HEK293A cells) were analysed by western blotting using anti-CoxII, anti-GAPDH and anti-C5orf33 antibodies. CoxII and GAPDH are mitochondrial and cytosolic markers, respectively 49 . ( f ) NADK activity of mitochondrial fraction obtained in panel e . Mitochondrial NADK activity is expressed as pmol of NADP + formed in 1 h. NADK activity was decreased to 47% upon knockdown of C5orf33. t -test; * P =0.024. Means and s.d. of three independent determinations are shown ( a , c , d , f ).
    Figure Legend Snippet: siRNA transfection. HEK293A cells were transfected with siRNA#2 against C5orf33 protein (C5orf33 siRNA) or control siRNA, and incubated for 1, 2 and 3 days. ( a ) Levels of C5orf33 mRNA in the transfected cells are shown as relative values normalized against the level in control siRNA-transfected cells incubated for 1 day after transfection. Knockdowns of 69, 63 and 79% relative to the control, as indicated, were obtained. ( b ) Expression of C5orf33 protein in the transfected cells. Proteins were analysed by western blotting using anti-C5orf33 and anti-GAPDH antibodies. ( c ) Viability. Transfected cells incubated for 3 days were treated with 12.5 μM menadione (black bar) or vehicle (0.62% (v/v) dimethyl sulfoxide (DMSO), grey bar) for 20 h, and viability was measured using calcein AM as in Supplementary Methods . Viability was also measured using MTT as in Supplementary Fig. S5 . ( d ) Intracellular ROS levels. Transfected cells incubated for 3 days were incubated with 10 μM 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) for 30 min, and then treated without (grey bar) or with (black bar) 100 μM menadione for 30 min; intracellular ROS was measured as described in Supplementary Methods . t -test; * P =0.0085, ** P =0.0026, *** P =0.0022, **** P =0.0044 × 10 −4 . Viability and intracellular ROS levels are presented as relative values normalized against their respective levels in control siRNA-transfected cells not treated with menadione; each independent experiment was conducted in duplicate ( c , d ). ( e ) Mitochondrial and cytosolic fractions of HEK293A cells that had been incubated for 3 days after transfections. Mitochondrial (M; 1.9 μg) and cytosolic (C; 1.9 μg) fractions and whole cells (W; from 3.3 × 10 4 transfected HEK293A cells) were analysed by western blotting using anti-CoxII, anti-GAPDH and anti-C5orf33 antibodies. CoxII and GAPDH are mitochondrial and cytosolic markers, respectively 49 . ( f ) NADK activity of mitochondrial fraction obtained in panel e . Mitochondrial NADK activity is expressed as pmol of NADP + formed in 1 h. NADK activity was decreased to 47% upon knockdown of C5orf33. t -test; * P =0.024. Means and s.d. of three independent determinations are shown ( a , c , d , f ).

    Techniques Used: Transfection, Incubation, Expressing, Western Blot, MTT Assay, Activity Assay

    23) Product Images from "Orientia tsutsugamushi Ank9 is a multifunctional effector that utilizes a novel GRIP-like Golgi localization domain for Golgi-to-endoplasmic reticulum trafficking and interacts with host COPB2"

    Article Title: Orientia tsutsugamushi Ank9 is a multifunctional effector that utilizes a novel GRIP-like Golgi localization domain for Golgi-to-endoplasmic reticulum trafficking and interacts with host COPB2

    Journal: Cellular microbiology

    doi: 10.1111/cmi.12727

    COPB2 levels are unchanged in cells expressing FLAG-Ank9 or infected with O. tsutsugamushi . Whole cell lysates of HeLa cells that were transfected to express FLAG-Ank9 versus FLAG-BAP (A) or that were uninfected or O. tsutsugamushi infected (C) were analyzed by Western blot with antibodies to detect COPB2, GAPDH or β-actin as a loading control, FLAG to confirm FLAG-tagged protein expression, and/or O. tsutsugamushi outer membrane protein A (OmpA). The mean ± SD COPB2 to GAPDH or β-actin ratios for pairs of lysates from at least three separate experiments were determined using densitometry (B and D). ns, not significant.
    Figure Legend Snippet: COPB2 levels are unchanged in cells expressing FLAG-Ank9 or infected with O. tsutsugamushi . Whole cell lysates of HeLa cells that were transfected to express FLAG-Ank9 versus FLAG-BAP (A) or that were uninfected or O. tsutsugamushi infected (C) were analyzed by Western blot with antibodies to detect COPB2, GAPDH or β-actin as a loading control, FLAG to confirm FLAG-tagged protein expression, and/or O. tsutsugamushi outer membrane protein A (OmpA). The mean ± SD COPB2 to GAPDH or β-actin ratios for pairs of lysates from at least three separate experiments were determined using densitometry (B and D). ns, not significant.

    Techniques Used: Expressing, Infection, Transfection, Western Blot

    Ectopically expressed Ank9 induces ATF4, but not XBP1. Whole cell lysates of HeLa cells expressing GFP, GFP-Ank9, or GFP-Ank9ΔF-box were analyzed by Western blotting with antibodies to ATF4 (A) or XBP1 (C). The blots were stripped and reprobed with antibodies against GFP and β-actin to confirm expression of GFP-tagged proteins and as a loading control, respectively. Arrowheads mark the expected apparent molecular weights for noted proteins. Normalized ratios of ATF4 to β-actin (B), XBP1 to β-actin (D), and GFP to β-actin (B and D) were calculated using densitometry. Statistically significant (* P
    Figure Legend Snippet: Ectopically expressed Ank9 induces ATF4, but not XBP1. Whole cell lysates of HeLa cells expressing GFP, GFP-Ank9, or GFP-Ank9ΔF-box were analyzed by Western blotting with antibodies to ATF4 (A) or XBP1 (C). The blots were stripped and reprobed with antibodies against GFP and β-actin to confirm expression of GFP-tagged proteins and as a loading control, respectively. Arrowheads mark the expected apparent molecular weights for noted proteins. Normalized ratios of ATF4 to β-actin (B), XBP1 to β-actin (D), and GFP to β-actin (B and D) were calculated using densitometry. Statistically significant (* P

    Techniques Used: Expressing, Western Blot

    Ank9 and O. tsutsugamushi each inhibit host cell protein secretion. (A) Ank9 inhibits host cell protein secretion in a GLD-dependent and F-box independent manner. Culture media from HeLa cells co-expressing FLAG-tagged BAP, Ank9, Ank9 47–422 (lacks GLD), or AnkΔF-box together with luciferase was assayed for the presence of secreted luciferase. Each condition was transfected in quadruplicate and each cell supernatant assayed in quadruplicate. (B) O. tsutsugamushi impairs host cell protein secretion. HeLa cells transfected to express a secreted luciferase reporter were mock infected or infected with O. tsutsugamushi at an MOI of 5, 17.5, or 35. Cell culture media was collected and analyzed for secreted luciferase activity. Relative luciferase activity in the media recovered from infected cells was normalized to that in media from mock infected cells. Data are representative of three experiments with similar results. Statistically significant (** P
    Figure Legend Snippet: Ank9 and O. tsutsugamushi each inhibit host cell protein secretion. (A) Ank9 inhibits host cell protein secretion in a GLD-dependent and F-box independent manner. Culture media from HeLa cells co-expressing FLAG-tagged BAP, Ank9, Ank9 47–422 (lacks GLD), or AnkΔF-box together with luciferase was assayed for the presence of secreted luciferase. Each condition was transfected in quadruplicate and each cell supernatant assayed in quadruplicate. (B) O. tsutsugamushi impairs host cell protein secretion. HeLa cells transfected to express a secreted luciferase reporter were mock infected or infected with O. tsutsugamushi at an MOI of 5, 17.5, or 35. Cell culture media was collected and analyzed for secreted luciferase activity. Relative luciferase activity in the media recovered from infected cells was normalized to that in media from mock infected cells. Data are representative of three experiments with similar results. Statistically significant (** P

    Techniques Used: Expressing, Luciferase, Transfection, Infection, Cell Culture, Activity Assay

    The Ank9 N-terminus is necessary for localization to Golgi- and ER-positive cellular fractions. Lysates of HeLa cells transfected to express GFP-tagged Ank9, Ank9ΔF-box, or Ank9 47–422 for 4 h or 16 h were subjected to density gradient fractionation. Western blots of nine successive fractions were screened with GFP, GM130, and calreticulin antibodies to confirm the Ank9 proteins’ subcellular trafficking patterns. Results are representative of two experiments with similar results.
    Figure Legend Snippet: The Ank9 N-terminus is necessary for localization to Golgi- and ER-positive cellular fractions. Lysates of HeLa cells transfected to express GFP-tagged Ank9, Ank9ΔF-box, or Ank9 47–422 for 4 h or 16 h were subjected to density gradient fractionation. Western blots of nine successive fractions were screened with GFP, GM130, and calreticulin antibodies to confirm the Ank9 proteins’ subcellular trafficking patterns. Results are representative of two experiments with similar results.

    Techniques Used: Transfection, Fractionation, Western Blot

    Ectopically expressed Ank9 localizes to and disrupts the morphology of the ER. HeLa cells expressing GFP-Ank9 (A) or GFP (B) were fixed and screened at 16 h post transfection with GFP antibody and antibody against one of the ER lumenal markers, calreticulin or PDI, or ER transmembrane proteins, calnexin or derlin-1, prior to examination by confocal microscopy. Representative fluorescence images of cells viewed for GFP, ER marker, and merged images plus DAPI, which stains the nucleus, are presented. White arrows denote representative points of GFP and ER marker signal colocalization. Because the cell cycles of the HeLa cells were not synchronized, the timing by which GFP-Ank9 localizes to and disrupts the ER could not be discerned. Results are representative of three independent experiments with similar results. Scale bars, 20 μm.
    Figure Legend Snippet: Ectopically expressed Ank9 localizes to and disrupts the morphology of the ER. HeLa cells expressing GFP-Ank9 (A) or GFP (B) were fixed and screened at 16 h post transfection with GFP antibody and antibody against one of the ER lumenal markers, calreticulin or PDI, or ER transmembrane proteins, calnexin or derlin-1, prior to examination by confocal microscopy. Representative fluorescence images of cells viewed for GFP, ER marker, and merged images plus DAPI, which stains the nucleus, are presented. White arrows denote representative points of GFP and ER marker signal colocalization. Because the cell cycles of the HeLa cells were not synchronized, the timing by which GFP-Ank9 localizes to and disrupts the ER could not be discerned. Results are representative of three independent experiments with similar results. Scale bars, 20 μm.

    Techniques Used: Expressing, Transfection, Confocal Microscopy, Fluorescence, Marker

    Ectopically expressed Ank9 exhibits temporal localization phenotypes that are consistent with Golgi-to-ER retrograde trafficking. Serum starved HeLa cells were transfected to express GFP-Ank9 (A and B). At 4, 8, or 12 h post transfection, the cells were fixed and examined by confocal microscopy (A–C). In some cases, fixed cells were screened with antibody against the cis-Golgi marker, GM130, or the ER protein, derlin-1 prior to confocal microscopic analyses (B). Representative fluorescence images of cells viewed for GFP; GM130 or derlin-1; and merged images plus DAPI are presented. White arrows in B denote representative points of GFP and organelle marker signal colocalization. (A) GFP-Ank9 exhibits subcellular localization patterns reminiscent of the Golgi at 4 h and destabilized ER at 8 and 12 h. (B) Immunofluorescent labeling confirms that GFP-Ank9 localizes to the Golgi at 4 h and subsequently traffics to the ER at 8 h and 12 h. Destabilization of GFP-Ank9-positive Golgi and ER is apparent at the 8 and 12 h time points. Representative cells exhibiting GFP-Ank9 Golgi like (Golgi) and ER-like (ER) subcellular localization patterns are denoted. (C and D) GFP-Ank9 does not require an intact Golgi to localize to the Golgi and ER. HeLa cells were treated with brefeldin A (BFA) or vehicle control. At 4 h, the cells were immunolabeled with GM130 antibody, stained with DAPI, and visualized using confocal microscopy to confirm that BFA destabilizes the Golgi (C). (D) Serum starved HeLa cells were treated with BFA- or vehicle control just prior to transfection with GFP-Ank9 plasmid. The cells were examined for GFP-Ank9 subcellular localization at 4, 8, and 16 h. Data are presented as the percentage of cells in which GFP-Ank9 signal was diffuse in the cytosol (Diffuse), localized to and disrupted the Golgi (Golgi), or localized to and altered the morphology of the ER to yield vesicular or ring-like structures (ER vesicles/rings). Results are representative of at least two separate experiments performed in triplicate, each yielding similar results. Scale bars, 20 μm. ns, not significant.
    Figure Legend Snippet: Ectopically expressed Ank9 exhibits temporal localization phenotypes that are consistent with Golgi-to-ER retrograde trafficking. Serum starved HeLa cells were transfected to express GFP-Ank9 (A and B). At 4, 8, or 12 h post transfection, the cells were fixed and examined by confocal microscopy (A–C). In some cases, fixed cells were screened with antibody against the cis-Golgi marker, GM130, or the ER protein, derlin-1 prior to confocal microscopic analyses (B). Representative fluorescence images of cells viewed for GFP; GM130 or derlin-1; and merged images plus DAPI are presented. White arrows in B denote representative points of GFP and organelle marker signal colocalization. (A) GFP-Ank9 exhibits subcellular localization patterns reminiscent of the Golgi at 4 h and destabilized ER at 8 and 12 h. (B) Immunofluorescent labeling confirms that GFP-Ank9 localizes to the Golgi at 4 h and subsequently traffics to the ER at 8 h and 12 h. Destabilization of GFP-Ank9-positive Golgi and ER is apparent at the 8 and 12 h time points. Representative cells exhibiting GFP-Ank9 Golgi like (Golgi) and ER-like (ER) subcellular localization patterns are denoted. (C and D) GFP-Ank9 does not require an intact Golgi to localize to the Golgi and ER. HeLa cells were treated with brefeldin A (BFA) or vehicle control. At 4 h, the cells were immunolabeled with GM130 antibody, stained with DAPI, and visualized using confocal microscopy to confirm that BFA destabilizes the Golgi (C). (D) Serum starved HeLa cells were treated with BFA- or vehicle control just prior to transfection with GFP-Ank9 plasmid. The cells were examined for GFP-Ank9 subcellular localization at 4, 8, and 16 h. Data are presented as the percentage of cells in which GFP-Ank9 signal was diffuse in the cytosol (Diffuse), localized to and disrupted the Golgi (Golgi), or localized to and altered the morphology of the ER to yield vesicular or ring-like structures (ER vesicles/rings). Results are representative of at least two separate experiments performed in triplicate, each yielding similar results. Scale bars, 20 μm. ns, not significant.

    Techniques Used: Transfection, Confocal Microscopy, Marker, Fluorescence, Labeling, Immunolabeling, Staining, Plasmid Preparation

    GFP-Ank9 localization to and perturbation of Golgi and ER morphology is F-box-independent. HeLa cells expressing GFP-Ank9ΔF-box were fixed, screened with GM130, derlin-1, and LAMP-1 antibodies, stained with DAPI, and examined by confocal microscopy. Representative fluorescence images of cells displaying GFP-Ank9ΔF-box Golgi-like (Golgi) and ER-like (ER) subcellular localization patterns viewed for GFP, organelle marker, and merged images plus DAPI are presented. Scale bars, 20 μm. Results shown are representative of three experiments with similar results.
    Figure Legend Snippet: GFP-Ank9 localization to and perturbation of Golgi and ER morphology is F-box-independent. HeLa cells expressing GFP-Ank9ΔF-box were fixed, screened with GM130, derlin-1, and LAMP-1 antibodies, stained with DAPI, and examined by confocal microscopy. Representative fluorescence images of cells displaying GFP-Ank9ΔF-box Golgi-like (Golgi) and ER-like (ER) subcellular localization patterns viewed for GFP, organelle marker, and merged images plus DAPI are presented. Scale bars, 20 μm. Results shown are representative of three experiments with similar results.

    Techniques Used: Expressing, Staining, Confocal Microscopy, Fluorescence, Marker

    24) Product Images from "Homeobox Protein Msx2 Acts as a Molecular Defense Mechanism for Preventing Ossification in Ligament Fibroblasts"

    Article Title: Homeobox Protein Msx2 Acts as a Molecular Defense Mechanism for Preventing Ossification in Ligament Fibroblasts

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.24.8.3460-3472.2004

    Msx2 repressed Runx2/Osf2 transcriptional activity. Transcriptional activity frome the OSE2 sequence of Runx2/Osf2 was assayed with luciferase reporter assays. Each cell line was transfected with p6OSE2-Luc, in which luciferase expression is controlled by six copies of the Runx2 binding OSE2 site of the OCN promoter, followed by the minimal promoter, and the indicated expression constructs. Luciferase activity was determined 24 h after transfection. The relative amount used for the transfection of each construct is indicated as × N , where N is 1, 2, or 4. Note that the reduction of endogenous Msx2 by transfection with the Msx2 antisense (Msx2 AS) RNA expression plasmid (×2) enhanced Runx2/Osf2 transcriptional activity in PDL-L2 cells (D). See the text for details.
    Figure Legend Snippet: Msx2 repressed Runx2/Osf2 transcriptional activity. Transcriptional activity frome the OSE2 sequence of Runx2/Osf2 was assayed with luciferase reporter assays. Each cell line was transfected with p6OSE2-Luc, in which luciferase expression is controlled by six copies of the Runx2 binding OSE2 site of the OCN promoter, followed by the minimal promoter, and the indicated expression constructs. Luciferase activity was determined 24 h after transfection. The relative amount used for the transfection of each construct is indicated as × N , where N is 1, 2, or 4. Note that the reduction of endogenous Msx2 by transfection with the Msx2 antisense (Msx2 AS) RNA expression plasmid (×2) enhanced Runx2/Osf2 transcriptional activity in PDL-L2 cells (D). See the text for details.

    Techniques Used: Activity Assay, Sequencing, Luciferase, Transfection, Expressing, Binding Assay, Construct, RNA Expression, Plasmid Preparation

    Msx2 interacts and colocalizes with Runx2/Osf2. (A) The interaction of Msx2 with Runx2/Osf2 was assessed by GST interaction. Flag-tagged Runx2/Osf2-expressing C3H10T1/2 cell lysates were combined with a GST-Msx2 fusion protein and tested for the presence of Runx2/Osf2 with a Flag antibody. (B) The interaction of Msx2 with Runx2/Osf2 was assessed in coimmunoprecipitation assays. Cell lysates from transfected C2C12 cells expressing the indicated tagged proteins were used for immunoprecipitations (IP), followed by Western blotting (WB) with the indicated antibody (Ab). (C) Schematic representations of Runx2/Osf2 deletion mutants expressed as GST fusion proteins. (D) Flag-tagged Msx2-expressing C3H10T1/2 cell lysates were combined with the various GST-Runx2/Osf2 protein indicated in C. An anti-Flag antibody was used to detect the presence of Msx2. Photographs of Coomassie brilliant blue (CBB)-stained gels are shown to confirm the integrity and nearly equal loading of the fusion proteins. (E) Colocalization of Msx2 with Runx2/Osf2 was assessed by double-label immunofluorescence microscopy. Runx2/Osf2 was cotransfected with Myc-tagged Msx2 into PDL-L2 and C2C12 cells, and the cells were stained with anti-Runx2/Osf2 and anti-Myc antibodies. (F) In vivo expression of Msx2 and Runx2/Osf2 was detected in periodontal ligament fibroblasts of 7-week-old C57BL/6J mice by double-label in situ hybridization. See the text for details.
    Figure Legend Snippet: Msx2 interacts and colocalizes with Runx2/Osf2. (A) The interaction of Msx2 with Runx2/Osf2 was assessed by GST interaction. Flag-tagged Runx2/Osf2-expressing C3H10T1/2 cell lysates were combined with a GST-Msx2 fusion protein and tested for the presence of Runx2/Osf2 with a Flag antibody. (B) The interaction of Msx2 with Runx2/Osf2 was assessed in coimmunoprecipitation assays. Cell lysates from transfected C2C12 cells expressing the indicated tagged proteins were used for immunoprecipitations (IP), followed by Western blotting (WB) with the indicated antibody (Ab). (C) Schematic representations of Runx2/Osf2 deletion mutants expressed as GST fusion proteins. (D) Flag-tagged Msx2-expressing C3H10T1/2 cell lysates were combined with the various GST-Runx2/Osf2 protein indicated in C. An anti-Flag antibody was used to detect the presence of Msx2. Photographs of Coomassie brilliant blue (CBB)-stained gels are shown to confirm the integrity and nearly equal loading of the fusion proteins. (E) Colocalization of Msx2 with Runx2/Osf2 was assessed by double-label immunofluorescence microscopy. Runx2/Osf2 was cotransfected with Myc-tagged Msx2 into PDL-L2 and C2C12 cells, and the cells were stained with anti-Runx2/Osf2 and anti-Myc antibodies. (F) In vivo expression of Msx2 and Runx2/Osf2 was detected in periodontal ligament fibroblasts of 7-week-old C57BL/6J mice by double-label in situ hybridization. See the text for details.

    Techniques Used: Expressing, Transfection, Western Blot, Staining, Immunofluorescence, Microscopy, In Vivo, Mouse Assay, In Situ Hybridization

    Model for Msx2 function in osteoblasts and ligament fibroblasts. (A) Runx2/Osf2 transcriptional activity is cooperatively repressed by two corepressors, Msx2 and TLE1, recruiting the HDAC complex. Attenuation of Msx2 expression after the middle stage of osteoblast differentiation is important for further Runx2/Osf2 activation, which induces differentiation and maximal matrix mineralization. Msx2 also has a direct function on the cell cycle by regulating target genes such as cyclin D1. (B) In ligament fibroblasts, Msx2 acts as a molecular defense mechanism for preventing ossification, as expression of the Msx2 gene is highly maintained. See the Discussion for details.
    Figure Legend Snippet: Model for Msx2 function in osteoblasts and ligament fibroblasts. (A) Runx2/Osf2 transcriptional activity is cooperatively repressed by two corepressors, Msx2 and TLE1, recruiting the HDAC complex. Attenuation of Msx2 expression after the middle stage of osteoblast differentiation is important for further Runx2/Osf2 activation, which induces differentiation and maximal matrix mineralization. Msx2 also has a direct function on the cell cycle by regulating target genes such as cyclin D1. (B) In ligament fibroblasts, Msx2 acts as a molecular defense mechanism for preventing ossification, as expression of the Msx2 gene is highly maintained. See the Discussion for details.

    Techniques Used: Activity Assay, Expressing, Activation Assay

    25) Product Images from "The E7 Oncoprotein Is Translated from Spliced E6*I Transcripts in High-Risk Human Papillomavirus Type 16- or Type 18-Positive Cervical Cancer Cell Lines via Translation Reinitiation"

    Article Title: The E7 Oncoprotein Is Translated from Spliced E6*I Transcripts in High-Risk Human Papillomavirus Type 16- or Type 18-Positive Cervical Cancer Cell Lines via Translation Reinitiation

    Journal:

    doi: 10.1128/JVI.80.9.4249-4263.2006

    Efficient production of E7 from spliced E6*I mRNAs. (A and B) Diagram of the E6 and E7 ORFs of HPV16 (A) and HPV18 (B) and their major bicistronic RNA products (as described in parentheses) transcribed from individual plasmids in this study. Primary
    Figure Legend Snippet: Efficient production of E7 from spliced E6*I mRNAs. (A and B) Diagram of the E6 and E7 ORFs of HPV16 (A) and HPV18 (B) and their major bicistronic RNA products (as described in parentheses) transcribed from individual plasmids in this study. Primary

    Techniques Used:

    Shortening the distance of E7 ORF from upstream E6*I ORF prevents E7 translation. (A and B) Diagram of E6*I RNA transcripts showing E6*I and E7 ORFs, splice junctions (dashed vertical lines), intercistronic space (central gray
    Figure Legend Snippet: Shortening the distance of E7 ORF from upstream E6*I ORF prevents E7 translation. (A and B) Diagram of E6*I RNA transcripts showing E6*I and E7 ORFs, splice junctions (dashed vertical lines), intercistronic space (central gray

    Techniques Used:

    26) Product Images from "A Mobile Functional Region of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein Independently Regulates DNA Binding and Protein Abundance ▿"

    Article Title: A Mobile Functional Region of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein Independently Regulates DNA Binding and Protein Abundance ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.00862-08

    The 46-aa DBIS is dominant and position independent. (A) Diagram of ORF50 fusion constructs used in EMSA. (B and C, top panels) EMSAs were carried out with extracts prepared from HKB5/B5 cells transfected with the indicated plasmids. (B and C, bottom panels) Expression of ORF50 mutant proteins in cell extracts detected by antibody to FLAG.
    Figure Legend Snippet: The 46-aa DBIS is dominant and position independent. (A) Diagram of ORF50 fusion constructs used in EMSA. (B and C, top panels) EMSAs were carried out with extracts prepared from HKB5/B5 cells transfected with the indicated plasmids. (B and C, bottom panels) Expression of ORF50 mutant proteins in cell extracts detected by antibody to FLAG.

    Techniques Used: Construct, Transfection, Expressing, Mutagenesis

    Basic amino acids upstream of the KKRK motif contribute to the DNA-binding inhibitory function. (A) Amino acid sequence of the minimal DNA-binding inhibitory sequence in the ORF50 protein. The basic motifs in the regulatory region are boxed. (B and C, top panels) DNA binding of ORF50 mutants. EMSAs were carried out by ORF50 mutants in the context of ORF50(1-564) (B) or full-length ORF50 (C). The expression of ORF50 mutants detected by antibody to FLAG is shown in the bottom panels.
    Figure Legend Snippet: Basic amino acids upstream of the KKRK motif contribute to the DNA-binding inhibitory function. (A) Amino acid sequence of the minimal DNA-binding inhibitory sequence in the ORF50 protein. The basic motifs in the regulatory region are boxed. (B and C, top panels) DNA binding of ORF50 mutants. EMSAs were carried out by ORF50 mutants in the context of ORF50(1-564) (B) or full-length ORF50 (C). The expression of ORF50 mutants detected by antibody to FLAG is shown in the bottom panels.

    Techniques Used: Binding Assay, Sequencing, Expressing

    Abundant ORF50 expression controlled by the KKRK motif is linked to a second component located in aa 590 to 650 of ORF50 protein. (A) Diagram of ORF50 and ORF50 deletion mutants. (B and C) Expression of ORF50 deletion mutant proteins without or with the KK/EE mutation. (D) DNA binding of ORF50 mutants was analyzed in EMSA using the same cell extracts as in panel C.
    Figure Legend Snippet: Abundant ORF50 expression controlled by the KKRK motif is linked to a second component located in aa 590 to 650 of ORF50 protein. (A) Diagram of ORF50 and ORF50 deletion mutants. (B and C) Expression of ORF50 deletion mutant proteins without or with the KK/EE mutation. (D) DNA binding of ORF50 mutants was analyzed in EMSA using the same cell extracts as in panel C.

    Techniques Used: Expressing, Mutagenesis, Binding Assay

    An extra copy of the 46-aa regulatory region of ORF50 protein mediates inhibition of expression of full-length ORF50 protein containing the KK/EE mutation. (A) Diagram of wild-type ORF50, ORF50(KK/EE), and constructs in which the minimal regulatory sequence or portions thereof were fused to FLAG-tagged ORF50(KK/EE). (B) Protein expression of ORF50 derivatives detected by anti-FLAG antibody. (C) An EMSA was performed with the extracts shown in panel B.
    Figure Legend Snippet: An extra copy of the 46-aa regulatory region of ORF50 protein mediates inhibition of expression of full-length ORF50 protein containing the KK/EE mutation. (A) Diagram of wild-type ORF50, ORF50(KK/EE), and constructs in which the minimal regulatory sequence or portions thereof were fused to FLAG-tagged ORF50(KK/EE). (B) Protein expression of ORF50 derivatives detected by anti-FLAG antibody. (C) An EMSA was performed with the extracts shown in panel B.

    Techniques Used: Inhibition, Expressing, Mutagenesis, Construct, Sequencing

    The 46-aa regulatory region promotes autodegradation when positioned at the N terminus of ORF50(KK/EE). (A) Diagram of FLAG-tagged ORF50 constructs. A second copy of the regulatory sequence without or with the KK/EE mutant was added to full-length ORF50(KK/EE). The minimal DBIS (or component I of PARS) is shaded. Protein expression and the DNA-binding function of the ORF50 constructs were analyzed by immunoblotting (B) and by EMSA (C).
    Figure Legend Snippet: The 46-aa regulatory region promotes autodegradation when positioned at the N terminus of ORF50(KK/EE). (A) Diagram of FLAG-tagged ORF50 constructs. A second copy of the regulatory sequence without or with the KK/EE mutant was added to full-length ORF50(KK/EE). The minimal DBIS (or component I of PARS) is shaded. Protein expression and the DNA-binding function of the ORF50 constructs were analyzed by immunoblotting (B) and by EMSA (C).

    Techniques Used: Construct, Sequencing, Mutagenesis, Expressing, Binding Assay

    The C-terminal 200 aa of ORF50 protein inhibits expression of a heterologous protein. (A) Diagram of FLAG-tagged ORF50 deletion mutants, FLAG-tagged GST, and chimeric GST-ORF50. The constructs contained ORF50 aa 490 to 691, which encompasses both components of the PARS. (B) Expression of ORF50 deletions and GST fusion proteins detected by anti-FLAG antibody.
    Figure Legend Snippet: The C-terminal 200 aa of ORF50 protein inhibits expression of a heterologous protein. (A) Diagram of FLAG-tagged ORF50 deletion mutants, FLAG-tagged GST, and chimeric GST-ORF50. The constructs contained ORF50 aa 490 to 691, which encompasses both components of the PARS. (B) Expression of ORF50 deletions and GST fusion proteins detected by anti-FLAG antibody.

    Techniques Used: Expressing, Construct

    Amino acid substitutions in the KKRK motif discriminate its function in regulating protein abundance and DNA binding. (A) Diagram of wild-type ORF50 and ORF50 mutants. Putative domains are indicated as follows: LZ, leucine zipper; black bar, regulatory region; AD, activation domain. (B) Northern blot analysis of ORF50 mRNA in HKB5/B5 cells. At 48 h after transfection total RNA from transfected HKB5/B5 cells was analyzed by Northern blotting with a specific probe to detect ORF50 mRNA. Hybridization with H1 RNA of RNaseP served as a loading control. (C) Expression of ORF50 and ORF50 mutant proteins. Extracts of transfected HKB5/B5 cells were analyzed by immunoblotting with anti-FLAG antibody. (D) DNA-binding activity of ORF50 and ORF50 mutants. The same cell extracts shown in panel C were used in an EMSA. The probe in the EMSA was the ORF50 response element of the PAN promoter. Antibody to FLAG was used for supershift tests.
    Figure Legend Snippet: Amino acid substitutions in the KKRK motif discriminate its function in regulating protein abundance and DNA binding. (A) Diagram of wild-type ORF50 and ORF50 mutants. Putative domains are indicated as follows: LZ, leucine zipper; black bar, regulatory region; AD, activation domain. (B) Northern blot analysis of ORF50 mRNA in HKB5/B5 cells. At 48 h after transfection total RNA from transfected HKB5/B5 cells was analyzed by Northern blotting with a specific probe to detect ORF50 mRNA. Hybridization with H1 RNA of RNaseP served as a loading control. (C) Expression of ORF50 and ORF50 mutant proteins. Extracts of transfected HKB5/B5 cells were analyzed by immunoblotting with anti-FLAG antibody. (D) DNA-binding activity of ORF50 and ORF50 mutants. The same cell extracts shown in panel C were used in an EMSA. The probe in the EMSA was the ORF50 response element of the PAN promoter. Antibody to FLAG was used for supershift tests.

    Techniques Used: Binding Assay, Activation Assay, Northern Blot, Transfection, Hybridization, Expressing, Mutagenesis, Activity Assay

    A proteasome inhibitor stabilizes ORF50B expression. HKB5/B5 cells were transfected with plasmids expressing FLAG-tagged wild-type ORF50 or KK/EE mutant. Four hours after transfection, cells were suspended in medium containing DMSO or different amounts of MG132 dissolved in DMSO. After 20 h cell the lysates were resolved by SDS-polyacrylamide gel electrophoresis and analyzed by immunoblotting with anti-FLAG antibody. The ratio of expression of ORF50B to ORF50A in each sample was determined by densitometry.
    Figure Legend Snippet: A proteasome inhibitor stabilizes ORF50B expression. HKB5/B5 cells were transfected with plasmids expressing FLAG-tagged wild-type ORF50 or KK/EE mutant. Four hours after transfection, cells were suspended in medium containing DMSO or different amounts of MG132 dissolved in DMSO. After 20 h cell the lysates were resolved by SDS-polyacrylamide gel electrophoresis and analyzed by immunoblotting with anti-FLAG antibody. The ratio of expression of ORF50B to ORF50A in each sample was determined by densitometry.

    Techniques Used: Expressing, Transfection, Mutagenesis, Polyacrylamide Gel Electrophoresis

    aa 490 to 535 define a functional DBIS of ORF50 protein. (A) Summary of DNA-binding activity of ORF50 deletion mutants without or with the KK/EE substitution. NA, not applicable. (B and C, top panels) EMSAs were performed using cell extracts of HKB5/B5 cells transfected with the indicated plasmids. (Bottom panels) Expression of ORF50 deletion mutant proteins in cell extracts was detected by antibody to FLAG.
    Figure Legend Snippet: aa 490 to 535 define a functional DBIS of ORF50 protein. (A) Summary of DNA-binding activity of ORF50 deletion mutants without or with the KK/EE substitution. NA, not applicable. (B and C, top panels) EMSAs were performed using cell extracts of HKB5/B5 cells transfected with the indicated plasmids. (Bottom panels) Expression of ORF50 deletion mutant proteins in cell extracts was detected by antibody to FLAG.

    Techniques Used: Functional Assay, Binding Assay, Activity Assay, Transfection, Expressing, Mutagenesis

    The DBIS of ORF50 protein does not alter the binding of EBV Rta to DNA. (A) Diagram of EBV Rta and fusion constructs. The DNA-binding domain (DBD) of EBV Rta was from aa 1 to 350 (E-R350). The coding sequences between aa 440 and 564 containing the DNA-binding inhibitory region of the ORF50 protein without or with the KK/EE mutation were added downstream of the Rta DBD. (B) EMSA using the Rta response element from the BMLF1 promoter as a probe. (C) Protein expression of the fusion constructs detected by antibody to FLAG.
    Figure Legend Snippet: The DBIS of ORF50 protein does not alter the binding of EBV Rta to DNA. (A) Diagram of EBV Rta and fusion constructs. The DNA-binding domain (DBD) of EBV Rta was from aa 1 to 350 (E-R350). The coding sequences between aa 440 and 564 containing the DNA-binding inhibitory region of the ORF50 protein without or with the KK/EE mutation were added downstream of the Rta DBD. (B) EMSA using the Rta response element from the BMLF1 promoter as a probe. (C) Protein expression of the fusion constructs detected by antibody to FLAG.

    Techniques Used: Binding Assay, Construct, Mutagenesis, Expressing

    27) Product Images from "Interaction of Infectious Spleen and Kidney Necrosis Virus ORF119L with PINCH Leads to Dominant-Negative Inhibition of Integrin-Linked Kinase and Cardiovascular Defects in Zebrafish"

    Article Title: Interaction of Infectious Spleen and Kidney Necrosis Virus ORF119L with PINCH Leads to Dominant-Negative Inhibition of Integrin-Linked Kinase and Cardiovascular Defects in Zebrafish

    Journal: Journal of Virology

    doi: 10.1128/JVI.01955-14

    ORF119 interacts with PINCH to affect the PINCH-ILK interaction. (A) In GST pulldown assays, the expression of FLAG-PINCH fusion proteins from transfected HEK293T cells was detected by anti-FLAG antibody Western blotting. After incubation with the GST-,
    Figure Legend Snippet: ORF119 interacts with PINCH to affect the PINCH-ILK interaction. (A) In GST pulldown assays, the expression of FLAG-PINCH fusion proteins from transfected HEK293T cells was detected by anti-FLAG antibody Western blotting. After incubation with the GST-,

    Techniques Used: Expressing, Transfection, Western Blot, Incubation

    28) Product Images from "A role for activated Cdc42 in glioblastoma multiforme invasion"

    Article Title: A role for activated Cdc42 in glioblastoma multiforme invasion

    Journal: Oncotarget

    doi: 10.18632/oncotarget.10925

    CA-Cdc42 increases three-dimensional spheroid invasion A. CA- and DN-Cdc42 expression induced by doxycycline treatment. B. Real time imaging of cellular invasion of spheroids embedded in Matrigel was performed using fluorescence imaging. C. Quantitative analysis of the 3-D spheroid invasion assay.
    Figure Legend Snippet: CA-Cdc42 increases three-dimensional spheroid invasion A. CA- and DN-Cdc42 expression induced by doxycycline treatment. B. Real time imaging of cellular invasion of spheroids embedded in Matrigel was performed using fluorescence imaging. C. Quantitative analysis of the 3-D spheroid invasion assay.

    Techniques Used: Expressing, Imaging, Fluorescence, Invasion Assay

    A. Confocal microscope images experiments demonstrate IQGAP1 co-localization to filopodia and focal adhesions Scale bar, 22μm. B. IQGAP1 expression in U87MG inducible cell lines. C. Pull-down assay with FLAG antibody in FLAG-Cdc42 expressing U87MG.
    Figure Legend Snippet: A. Confocal microscope images experiments demonstrate IQGAP1 co-localization to filopodia and focal adhesions Scale bar, 22μm. B. IQGAP1 expression in U87MG inducible cell lines. C. Pull-down assay with FLAG antibody in FLAG-Cdc42 expressing U87MG.

    Techniques Used: Microscopy, Expressing, Pull Down Assay

    A. Change in morphology and actin cytoskeleton of U87MG CA-Cdc42 inducible cells F-actin and nuclei were stained with phalloidin 594 and DAPI, respectively. CA-Cdc42 expressing inducible cell clones show robust filopodia formation (arrow) and an increased number of focal adhesions (arrow head) compared to uninduced. Interestingly, the CA-Cdc42 cells have an increased cell surface area in the presence of doxycycline. Scale bar, 20μm. B. CA-Cdc42 localizes on the membrane, in filopodia, and within focal adhesion structures. A examples depicting immunofluorescence of U87MG cells stably expressing FLAG-CA-Cdc42 show Cdc42 (green) is co-localized at the cell membrane with filopodia (red, Phalloidin 594), and also accumulates at focal adhesions (green dots). The arrangement of images in each panel is indicated: nuclei (DAPI, blue); FLAG-Cdc42 (green); Phalloidin 594 (red). Scale bar, 21μm. C. pFAK co-localizes with focal adhesion structures. pFAK (green) co-localizes with focal adhesion structures (red) on CA-Cdc42 expressing U87MG. *; focal adhesion structures, arrow; pFAK localizes cell edges. Scale bar, 20 μm.
    Figure Legend Snippet: A. Change in morphology and actin cytoskeleton of U87MG CA-Cdc42 inducible cells F-actin and nuclei were stained with phalloidin 594 and DAPI, respectively. CA-Cdc42 expressing inducible cell clones show robust filopodia formation (arrow) and an increased number of focal adhesions (arrow head) compared to uninduced. Interestingly, the CA-Cdc42 cells have an increased cell surface area in the presence of doxycycline. Scale bar, 20μm. B. CA-Cdc42 localizes on the membrane, in filopodia, and within focal adhesion structures. A examples depicting immunofluorescence of U87MG cells stably expressing FLAG-CA-Cdc42 show Cdc42 (green) is co-localized at the cell membrane with filopodia (red, Phalloidin 594), and also accumulates at focal adhesions (green dots). The arrangement of images in each panel is indicated: nuclei (DAPI, blue); FLAG-Cdc42 (green); Phalloidin 594 (red). Scale bar, 21μm. C. pFAK co-localizes with focal adhesion structures. pFAK (green) co-localizes with focal adhesion structures (red) on CA-Cdc42 expressing U87MG. *; focal adhesion structures, arrow; pFAK localizes cell edges. Scale bar, 20 μm.

    Techniques Used: Staining, Expressing, Clone Assay, Immunofluorescence, Stable Transfection

    IQGAP1 siRNA on CA-Cdc42 inducible U251MG A. IQGAP1 knockdown with and without doxycycline. B. Proliferation assay after IQGAP1 knockdown. C. Migration assay after IQGAP1 knockdown *; p
    Figure Legend Snippet: IQGAP1 siRNA on CA-Cdc42 inducible U251MG A. IQGAP1 knockdown with and without doxycycline. B. Proliferation assay after IQGAP1 knockdown. C. Migration assay after IQGAP1 knockdown *; p

    Techniques Used: Proliferation Assay, Migration

    Doxycycline inducible cell lines expressing WT-, CA-, and DN-Cdc42 in U87MG and U251MG The total amount of Cdc42 is increased in the presence of doxycycline in all cell lines. Activated Cdc42 (Cdc42-GTP) is increased in WT- and is even higher in CA-Cdc42 in the presence of doxycycline. However, Cdc42-GTP in DN-Cdc42 cells treated with doxycycline has the same expression level as doxycycline negative cultures despite an increased expression of total amount of Cdc42.
    Figure Legend Snippet: Doxycycline inducible cell lines expressing WT-, CA-, and DN-Cdc42 in U87MG and U251MG The total amount of Cdc42 is increased in the presence of doxycycline in all cell lines. Activated Cdc42 (Cdc42-GTP) is increased in WT- and is even higher in CA-Cdc42 in the presence of doxycycline. However, Cdc42-GTP in DN-Cdc42 cells treated with doxycycline has the same expression level as doxycycline negative cultures despite an increased expression of total amount of Cdc42.

    Techniques Used: Expressing

    Doxycycline treatment to induce Cdc42 does not increase proliferation A. All three U251 MG cell clones demonstrated a similar decrease in cell proliferation by day six. B. The U87MG inducible cells also demonstrated a similar decrease in cell proliferation in CA- and DN-cell clones but not in WT.
    Figure Legend Snippet: Doxycycline treatment to induce Cdc42 does not increase proliferation A. All three U251 MG cell clones demonstrated a similar decrease in cell proliferation by day six. B. The U87MG inducible cells also demonstrated a similar decrease in cell proliferation in CA- and DN-cell clones but not in WT.

    Techniques Used: Clone Assay

    Induced aberrant cdc42 activity alters cell migration and invasion in U87MG and U251MG glioma cells A, B. Migration assay of Cdc42 expressing inducible U87MG (A) and U251MG (B) cells after 72 hrs of treatment with or without (+ or −) doxycycline. WT- and CA-Cdc42 expressing cell clones significantly increase migration of U87MG and U251MG cells. DN-Cdc42 significantly reduces migration of U87MG cells but does not change migration potential of U251MG cells ( p = 0.21). * p
    Figure Legend Snippet: Induced aberrant cdc42 activity alters cell migration and invasion in U87MG and U251MG glioma cells A, B. Migration assay of Cdc42 expressing inducible U87MG (A) and U251MG (B) cells after 72 hrs of treatment with or without (+ or −) doxycycline. WT- and CA-Cdc42 expressing cell clones significantly increase migration of U87MG and U251MG cells. DN-Cdc42 significantly reduces migration of U87MG cells but does not change migration potential of U251MG cells ( p = 0.21). * p

    Techniques Used: Activity Assay, Migration, Expressing, Clone Assay

    CA-Cdc42 expressing U251 MG cells decrease xenograft survival, whereas DN-Cdc42 expressing cells increase survival Kaplan-Meier survival curves of orthotopic mouse tumor xenografts of U251MG CA-Cdc42 A. and U251MG DN-Cdc42 B. treated + versus - doxycycline. CA-Cdc42 overexpression resulted in significantly decreased survival ( p
    Figure Legend Snippet: CA-Cdc42 expressing U251 MG cells decrease xenograft survival, whereas DN-Cdc42 expressing cells increase survival Kaplan-Meier survival curves of orthotopic mouse tumor xenografts of U251MG CA-Cdc42 A. and U251MG DN-Cdc42 B. treated + versus - doxycycline. CA-Cdc42 overexpression resulted in significantly decreased survival ( p

    Techniques Used: Expressing, Over Expression

    Knockdown of Cdc42 modulates morphology, suppress migration, and invasion of GBM cells A. Knockdown of Cdc42 by siRNA in A172, U87MG, and U118MG cells. B. Morphological alterations of A172, U87MG and U118MG cells after knocking down Cdc42 siRNA. The cells were labeled with F-actin and immunostained with anti-Cdc42 antibody. Scale Bar, 15 μm. C. Results of cell migration assays. Bar graphs show the average migration rate calculated as the change in the diameter of the circle circumscribing the cell population over a 24 hrs period. (* p
    Figure Legend Snippet: Knockdown of Cdc42 modulates morphology, suppress migration, and invasion of GBM cells A. Knockdown of Cdc42 by siRNA in A172, U87MG, and U118MG cells. B. Morphological alterations of A172, U87MG and U118MG cells after knocking down Cdc42 siRNA. The cells were labeled with F-actin and immunostained with anti-Cdc42 antibody. Scale Bar, 15 μm. C. Results of cell migration assays. Bar graphs show the average migration rate calculated as the change in the diameter of the circle circumscribing the cell population over a 24 hrs period. (* p

    Techniques Used: Migration, Labeling

    Cdc42 expression level does not predict patient survival with GBM but is associated with poor progression free survival A. Kaplan-Meir Survival curve analysis comparing overall survival of Cdc42 high versus low expressing patients in TCGA dataset. High Cdc42 expression is not associated with overall survival of patients with GBM. ( p = 0.60) B. In contrast, high Cdc42 expression is significantly associated with poor progression free survival ( p
    Figure Legend Snippet: Cdc42 expression level does not predict patient survival with GBM but is associated with poor progression free survival A. Kaplan-Meir Survival curve analysis comparing overall survival of Cdc42 high versus low expressing patients in TCGA dataset. High Cdc42 expression is not associated with overall survival of patients with GBM. ( p = 0.60) B. In contrast, high Cdc42 expression is significantly associated with poor progression free survival ( p

    Techniques Used: Expressing

    29) Product Images from "Functional analysis of tanshinone IIA that blocks the redox function of human apurinic/apyrimidinic endonuclease 1/redox factor-1"

    Article Title: Functional analysis of tanshinone IIA that blocks the redox function of human apurinic/apyrimidinic endonuclease 1/redox factor-1

    Journal: Drug Design, Development and Therapy

    doi: 10.2147/DDDT.S71124

    Effects of T2A on the redox function and expression of APE1. Notes: In ( A ), ( C ), ( E ), and ( G ), the nuclear extracts of APE1 wt , APE1 shRNA , and APE1 C65S cells were treated with T2A at indicated dose for 30 minutes, respectively. DNA-binding activity of NF-κB ( A ), AP-1 ( C ), HIF-1α ( E ), and SP-1 ( G ) were assessed by EMSA. In ( B ), ( D ), ( F ), and ( H ), the quantification of DNA-binding levels of NF-κB ( B ), AP-1 ( D ), HIF-1α ( F ), and SP-1 ( H ) was performed by densitometry. Each point represents the mean ± standard deviation of three experiments. * P
    Figure Legend Snippet: Effects of T2A on the redox function and expression of APE1. Notes: In ( A ), ( C ), ( E ), and ( G ), the nuclear extracts of APE1 wt , APE1 shRNA , and APE1 C65S cells were treated with T2A at indicated dose for 30 minutes, respectively. DNA-binding activity of NF-κB ( A ), AP-1 ( C ), HIF-1α ( E ), and SP-1 ( G ) were assessed by EMSA. In ( B ), ( D ), ( F ), and ( H ), the quantification of DNA-binding levels of NF-κB ( B ), AP-1 ( D ), HIF-1α ( F ), and SP-1 ( H ) was performed by densitometry. Each point represents the mean ± standard deviation of three experiments. * P

    Techniques Used: Expressing, shRNA, Binding Assay, Activity Assay, Standard Deviation

    Binding affinity and docking simulation of T2A–APE1 interaction. Notes: ( A ) Real-time DPI measurements of change in mass of immobilized APE1 protein after injection of increased concentrations of T2A. ( B ) Real-time DPI measurements of thickness, density, and mass during addition of T2A to immobilized APE1. ( C ) The assessment of disassociation and association kinetic constants and the dissociation constant K D for the interaction between T2A and APE1. ( D ), ( E ) The detailed 3D ( D ) and 2D ( E ) docking model showing hydrogen-bonding interaction of T2A with Glu-137 of APE1. Abbreviations: T2A, tanshinone IIA; APE, apurinic/apyrimidinic endonuclease; Asp, asparagine; DPI, dual polarization interferometry; Gln, glutamine; Leu, leucine; Ser, serine; 3D, three-dimensional; 2D, two-dimensional.
    Figure Legend Snippet: Binding affinity and docking simulation of T2A–APE1 interaction. Notes: ( A ) Real-time DPI measurements of change in mass of immobilized APE1 protein after injection of increased concentrations of T2A. ( B ) Real-time DPI measurements of thickness, density, and mass during addition of T2A to immobilized APE1. ( C ) The assessment of disassociation and association kinetic constants and the dissociation constant K D for the interaction between T2A and APE1. ( D ), ( E ) The detailed 3D ( D ) and 2D ( E ) docking model showing hydrogen-bonding interaction of T2A with Glu-137 of APE1. Abbreviations: T2A, tanshinone IIA; APE, apurinic/apyrimidinic endonuclease; Asp, asparagine; DPI, dual polarization interferometry; Gln, glutamine; Leu, leucine; Ser, serine; 3D, three-dimensional; 2D, two-dimensional.

    Techniques Used: Binding Assay, Injection, Dual Polarization Interferometry

    Effects of T2A on AP site incision and interaction activity of APE1. Notes: ( A ) 500 pg purified human APE1 protein was exposed to T2A and CRT0044876 at indicated dose prior to measuring DNA strand cleavage activity via the radiolabeled assay. The upper band (substrate) represents uncleaved AP oligonucleotides; whereas, the lower band (product) is the reacted oligonucleotide. ( B ) 30 ng purified human APE1 protein was exposed to T2A and CRT0044876 at indicated dose prior to measuring AP site interaction activity via the radiolabeled assay. The upper band indicates APE1-bound AP oligonucleotides while the lower band is the unbound AP oligonucleotide. ( C ), ( D ) Quantification of cleaved AP oligonucleotides ( C ) and APE1-bound AP oligonucleotides ( D ) was performed by densitometry after normalization to DMSO control. Each point represents the mean ± standard deviation of three experiments. * P
    Figure Legend Snippet: Effects of T2A on AP site incision and interaction activity of APE1. Notes: ( A ) 500 pg purified human APE1 protein was exposed to T2A and CRT0044876 at indicated dose prior to measuring DNA strand cleavage activity via the radiolabeled assay. The upper band (substrate) represents uncleaved AP oligonucleotides; whereas, the lower band (product) is the reacted oligonucleotide. ( B ) 30 ng purified human APE1 protein was exposed to T2A and CRT0044876 at indicated dose prior to measuring AP site interaction activity via the radiolabeled assay. The upper band indicates APE1-bound AP oligonucleotides while the lower band is the unbound AP oligonucleotide. ( C ), ( D ) Quantification of cleaved AP oligonucleotides ( C ) and APE1-bound AP oligonucleotides ( D ) was performed by densitometry after normalization to DMSO control. Each point represents the mean ± standard deviation of three experiments. * P

    Techniques Used: Activity Assay, Purification, Standard Deviation

    Effect of APE1 knockdown or its redox mutation on the T2A activities in cell growth. Notes: ( A ) APE1 wt , APE1 shRNA , and APE1 C65S cells were treated with T2A at indicated dose for 48 hours, respectively. Proliferation was assessed by MTT assay. ( B ) APE1 wt , APE1 shRNA , and APE1 C65S cells were treated with T2A at indicated dose for 24 hours, respectively. Protein level of cleaved PARP (c-PARP) was assessed by Western blot assay. ( C ) Quantification of c-PARP protein level by densitometry after normalization to β-actin. Each point represents the mean ± standard deviation of three experiments. * P
    Figure Legend Snippet: Effect of APE1 knockdown or its redox mutation on the T2A activities in cell growth. Notes: ( A ) APE1 wt , APE1 shRNA , and APE1 C65S cells were treated with T2A at indicated dose for 48 hours, respectively. Proliferation was assessed by MTT assay. ( B ) APE1 wt , APE1 shRNA , and APE1 C65S cells were treated with T2A at indicated dose for 24 hours, respectively. Protein level of cleaved PARP (c-PARP) was assessed by Western blot assay. ( C ) Quantification of c-PARP protein level by densitometry after normalization to β-actin. Each point represents the mean ± standard deviation of three experiments. * P

    Techniques Used: Mutagenesis, shRNA, MTT Assay, Western Blot, Standard Deviation

    30) Product Images from "Fragile X mental retardation protein FMRP and the RNA export factor NXF2 associate with and destabilize Nxf1 mRNA in neuronal cells"

    Article Title: Fragile X mental retardation protein FMRP and the RNA export factor NXF2 associate with and destabilize Nxf1 mRNA in neuronal cells

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0700169104

    FMRP contributes to Nxf1 mRNA destabilization induced by NXF2. ( A ) The mouse Fmr1 gene is specifically down-regulated by siRNA. An siRNA specific for the Fmr1 gene or a control siRNA was transfected into N2a cells. Twenty-four hours after transfection, RNAs were isolated and analyzed by qRT-PCR using primers specific for the indicated mRNAs. mRNA levels from Fmr1-specific siRNA-treated cells are shown relative to those treated with control siRNA. Each bar indicates mean ± SEM ( n = 3≈6). ( B ) Inhibition of FMRP expression abolishes the Nxf1 mRNA destabilization effect induced by NXF2. Fmr1-specific siRNA or control siRNA, together with FLAG-NXF2 or empty vector, was transfected into N2a cells. Seventy-two hours after transfection, RNAs were extracted, and levels were measured by qRT-PCR. The levels of mRNAs from FLAG-NXF2-transfected cells are shown relative to those from empty vector-transfected cells, which were arbitrarily set as 100%. Each bar represents mean ± SEM ( n = 3≈4).
    Figure Legend Snippet: FMRP contributes to Nxf1 mRNA destabilization induced by NXF2. ( A ) The mouse Fmr1 gene is specifically down-regulated by siRNA. An siRNA specific for the Fmr1 gene or a control siRNA was transfected into N2a cells. Twenty-four hours after transfection, RNAs were isolated and analyzed by qRT-PCR using primers specific for the indicated mRNAs. mRNA levels from Fmr1-specific siRNA-treated cells are shown relative to those treated with control siRNA. Each bar indicates mean ± SEM ( n = 3≈6). ( B ) Inhibition of FMRP expression abolishes the Nxf1 mRNA destabilization effect induced by NXF2. Fmr1-specific siRNA or control siRNA, together with FLAG-NXF2 or empty vector, was transfected into N2a cells. Seventy-two hours after transfection, RNAs were extracted, and levels were measured by qRT-PCR. The levels of mRNAs from FLAG-NXF2-transfected cells are shown relative to those from empty vector-transfected cells, which were arbitrarily set as 100%. Each bar represents mean ± SEM ( n = 3≈4).

    Techniques Used: Transfection, Isolation, Quantitative RT-PCR, Inhibition, Expressing, Plasmid Preparation

    NXF2 expression results in the destabilization of Nxf1 mRNA. ( A ) ( Upper ) Representative Western blots showing NXF2 expression levels in empty vector-transfected (lane 1) or FLAG-NXF2-transfected (lane 2) N2a cells or in the mouse testis (lane 3). ( Lower ) β-Actin was used as a loading control. ( B ) N2a cells were transfected with FLAG-NXF2 or empty vector, together with a YFP expression vector. Forty-eight hours after the transfection, cells were harvested and subjected to FACS. YFP-positive cells were collected followed by RNA extraction and qRT-PCR using primers specific for the indicated mRNAs. The levels of mRNAs from FLAG-NXF2-transfected cells are shown relative to those from empty vector-transfected cells, which were arbitrarily set as 100%. Each bar represents mean ± SEM ( n = 3≈5). ( C ) N2a cells were transfected with FLAG-NXF2 or empty vector. Twenty-four hours after transfection, actinomycin D was added to inhibit transcription, and Nxf1 mRNA levels at 0 h, 3 h, and 6 h time points, respectively, were measured by qRT-PCR. The mRNA levels at the 0 h time point were arbitrarily set as 100%. Each time point represents mean ± SEM ( n = 4).
    Figure Legend Snippet: NXF2 expression results in the destabilization of Nxf1 mRNA. ( A ) ( Upper ) Representative Western blots showing NXF2 expression levels in empty vector-transfected (lane 1) or FLAG-NXF2-transfected (lane 2) N2a cells or in the mouse testis (lane 3). ( Lower ) β-Actin was used as a loading control. ( B ) N2a cells were transfected with FLAG-NXF2 or empty vector, together with a YFP expression vector. Forty-eight hours after the transfection, cells were harvested and subjected to FACS. YFP-positive cells were collected followed by RNA extraction and qRT-PCR using primers specific for the indicated mRNAs. The levels of mRNAs from FLAG-NXF2-transfected cells are shown relative to those from empty vector-transfected cells, which were arbitrarily set as 100%. Each bar represents mean ± SEM ( n = 3≈5). ( C ) N2a cells were transfected with FLAG-NXF2 or empty vector. Twenty-four hours after transfection, actinomycin D was added to inhibit transcription, and Nxf1 mRNA levels at 0 h, 3 h, and 6 h time points, respectively, were measured by qRT-PCR. The mRNA levels at the 0 h time point were arbitrarily set as 100%. Each time point represents mean ± SEM ( n = 4).

    Techniques Used: Expressing, Western Blot, Plasmid Preparation, Transfection, FACS, RNA Extraction, Quantitative RT-PCR

    FMRP and NXF2 preferentially associate with Nxf1 mRNA-containing RNPs. FLAG-NXF2 was transfected into N2a cells, and IP was carried out 48 h after transfection. ( A ) Proteins from purified IP complexes or from 3% of supernatants were resolved on SDS/10% PAGE. The presence of the FMRP and NXF2 proteins in the IP complexes was confirmed by Western blot analyses. ( Upper ) IP with anti-FMRP (αFMRP) using mouse IgG as a negative control, followed by Western blotting using anti-FMRP. FMRP was in the anti-FMRP IP complexes (lane 4) but not in the IgG IP complexes (lane 3). ( Lower ) IP with anti-NXF2 (αNXF2) using preimmune serum as a negative control followed by Western blotting using anti-NXF2. NXF2 was in the anti-NXF2 IP complexes (lane 4) but not in the preimmune IP complexes (lane 3). Lanes 1 and 2 indicate that FMRP and NXF2 were present in the cell lysates. ( B and C ) RNAs were extracted from purified IP complexes followed by qRT-PCR. mRNA levels associated with FMRP (white bars) or NXF2 (gray bars) RNPs are indicated relative to those with negative control IP samples, which were arbitrarily set as 1. ( B ) A polyclonal anti-NXF2 antibody was used. ( C ) A monoclonal anti-FLAG antibody was used to immunoprecipitate the transfected FLAG-NXF2. Each bar represents mean ± SEM ( B , n = 4; C , n = 2). ( D ) mRNA expression levels. RNAs were extracted from 10% of IP supernatants, and qRT-PCR was carried out using primers specific for each mRNA. Levels are plotted relative to Gapdh mRNA levels, which were arbitrarily set a value of 100. Each bar represents mean ± SEM ( n = 4).
    Figure Legend Snippet: FMRP and NXF2 preferentially associate with Nxf1 mRNA-containing RNPs. FLAG-NXF2 was transfected into N2a cells, and IP was carried out 48 h after transfection. ( A ) Proteins from purified IP complexes or from 3% of supernatants were resolved on SDS/10% PAGE. The presence of the FMRP and NXF2 proteins in the IP complexes was confirmed by Western blot analyses. ( Upper ) IP with anti-FMRP (αFMRP) using mouse IgG as a negative control, followed by Western blotting using anti-FMRP. FMRP was in the anti-FMRP IP complexes (lane 4) but not in the IgG IP complexes (lane 3). ( Lower ) IP with anti-NXF2 (αNXF2) using preimmune serum as a negative control followed by Western blotting using anti-NXF2. NXF2 was in the anti-NXF2 IP complexes (lane 4) but not in the preimmune IP complexes (lane 3). Lanes 1 and 2 indicate that FMRP and NXF2 were present in the cell lysates. ( B and C ) RNAs were extracted from purified IP complexes followed by qRT-PCR. mRNA levels associated with FMRP (white bars) or NXF2 (gray bars) RNPs are indicated relative to those with negative control IP samples, which were arbitrarily set as 1. ( B ) A polyclonal anti-NXF2 antibody was used. ( C ) A monoclonal anti-FLAG antibody was used to immunoprecipitate the transfected FLAG-NXF2. Each bar represents mean ± SEM ( B , n = 4; C , n = 2). ( D ) mRNA expression levels. RNAs were extracted from 10% of IP supernatants, and qRT-PCR was carried out using primers specific for each mRNA. Levels are plotted relative to Gapdh mRNA levels, which were arbitrarily set a value of 100. Each bar represents mean ± SEM ( n = 4).

    Techniques Used: Transfection, Purification, Polyacrylamide Gel Electrophoresis, Western Blot, Negative Control, Quantitative RT-PCR, Expressing

    31) Product Images from "IL-1 receptor accessory protein is essential for IL-33-induced activation of T lymphocytes and mast cells"

    Article Title: IL-1 receptor accessory protein is essential for IL-33-induced activation of T lymphocytes and mast cells

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0705939104

    The interaction of IL-1RAcP with the IL-33Rα chain depends on IL-33. ( A ) Membrane IL-33Rα-chain and IL-1RAcP form a complex in the presence of IL-33. HEK293RI cells were transiently transfected with plasmids encoding FLAG-tagged mIL-1RAcP
    Figure Legend Snippet: The interaction of IL-1RAcP with the IL-33Rα chain depends on IL-33. ( A ) Membrane IL-33Rα-chain and IL-1RAcP form a complex in the presence of IL-33. HEK293RI cells were transiently transfected with plasmids encoding FLAG-tagged mIL-1RAcP

    Techniques Used: Transfection

    32) Product Images from "A Translational Regulator, PUM2, Promotes Both Protein Stability and Kinase Activity of Aurora-A"

    Article Title: A Translational Regulator, PUM2, Promotes Both Protein Stability and Kinase Activity of Aurora-A

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0019718

    Binding of PUM2 to Aurora-A protects Aurora-A from APC/C Cdh1 -mediated degradation. (A) PUM2 blocks the ubiquitination of Aurora-A. HEK293T cells were transfected with FLAG-tagged Aurora-A, together with different amounts of FLAG-tagged PUM2. Myc-tagged ubiquitin was also added to reveal the ubiquitination of Aurora-A. 24 hrs after transfection, the cells were synchronized in the G2/M phase by treatment with nocodazole for 16 hrs. Subsequently, the synchronized cells were released into cell cycle progression in the presence of a proteasome inhibitor (MG132) for 9 hrs. High molecular weight ubiquitinated Aurora-A accumulated in the transfected cells that were treated with MG132, as shown. The relative intensity of protein bands represented the steady-state protein level of Aurora-A on immunoblotting analysis were quantified and normalized to GAPDH. (B) The D-box of Aurora-A mediates its association with PUM2. HEK293T cells were transfected with FLAG-tagged PUM2 and various HA-tagged Aurora-A fragments. The cell lysates were immunoprecipitated with an anti-HA antibody and immunoblotted with an anti-FLAG antibody to detect PUM2.
    Figure Legend Snippet: Binding of PUM2 to Aurora-A protects Aurora-A from APC/C Cdh1 -mediated degradation. (A) PUM2 blocks the ubiquitination of Aurora-A. HEK293T cells were transfected with FLAG-tagged Aurora-A, together with different amounts of FLAG-tagged PUM2. Myc-tagged ubiquitin was also added to reveal the ubiquitination of Aurora-A. 24 hrs after transfection, the cells were synchronized in the G2/M phase by treatment with nocodazole for 16 hrs. Subsequently, the synchronized cells were released into cell cycle progression in the presence of a proteasome inhibitor (MG132) for 9 hrs. High molecular weight ubiquitinated Aurora-A accumulated in the transfected cells that were treated with MG132, as shown. The relative intensity of protein bands represented the steady-state protein level of Aurora-A on immunoblotting analysis were quantified and normalized to GAPDH. (B) The D-box of Aurora-A mediates its association with PUM2. HEK293T cells were transfected with FLAG-tagged PUM2 and various HA-tagged Aurora-A fragments. The cell lysates were immunoprecipitated with an anti-HA antibody and immunoblotted with an anti-FLAG antibody to detect PUM2.

    Techniques Used: Binding Assay, Transfection, Molecular Weight, Immunoprecipitation

    Increase of Aurora-A kinase activity by PUM2 in a dose-dependent manner. Recombinant His-tagged Aurora-A or kinase-inactive Aurora-A mutant protein (K162I) was incubated with the indicated amount of GST-PUM2 for 20 min at 30°C in kinase reaction buffer containing histone-H3 and ATP. The activity of Aurora-A was detected by immunoblotting using the anti-phospho-Aurora-A-T288 and the anti-phospho-Histone-H3 antibodies.
    Figure Legend Snippet: Increase of Aurora-A kinase activity by PUM2 in a dose-dependent manner. Recombinant His-tagged Aurora-A or kinase-inactive Aurora-A mutant protein (K162I) was incubated with the indicated amount of GST-PUM2 for 20 min at 30°C in kinase reaction buffer containing histone-H3 and ATP. The activity of Aurora-A was detected by immunoblotting using the anti-phospho-Aurora-A-T288 and the anti-phospho-Histone-H3 antibodies.

    Techniques Used: Activity Assay, Recombinant, Mutagenesis, Incubation

    PUM2 is able to enhance the protein stability of Aurora-A, which is indispensable for the interaction between Aurora-A and PUM2. (A) The stability of Aurora-A is regulated by PUM2. HEK293T cells were transfected with FLAG-tagged Aurora-A, either alone or with different amounts of FLAG-tagged PUM2. The cell lysates were analyzed by immunoblotting. (B) Knock-down of PUM2 results in the down-regulation of both PUM2 and Aurora-A. HEK293T cells were transfected with PUM2 specific siRNA or in combination with siRNA-R-FLAG-PUM2 and the effect of steady-state protein level of Aurora-A was determined using immunoblotting analysis. The relative intensity of protein bands on immunoblotting were quantified and normalized to GAPDH. (C) PUM2 protects Aurora-A from protein degradation when the cells exit from mitosis. HEK293T cells were transiently transfected with an empty vector or with FLAG-tagged PUM2. 24 hrs after transfection, the cells were synchronized in mitosis by nocodazole. For the collection of cells exiting from M phase, the cells were released into the cell cycle progression by removing the mitosis-synchronizing reagent and subsequently incubated with fresh medium containing cycloheximide, which blocks de novo protein synthesis. For the collection of M phase cells, the cells were also treated with nocodazole but this mitosis-synchronizing reagent was not removed when incubating with cycloheximide-containing medium. At the indicated time points, the cells were harvested and the lysates were immunoblotted with anti-PUM2, anti-FLAG, anti-Aurora-A and anti-GAPDH antibodies. Asynchronously (Asy) growing cells were analyzed in parallel. (D) Overexpression of PUM2 mutant, which failed to interact with Aurora-A, leads to the destabilization of this kinase.
    Figure Legend Snippet: PUM2 is able to enhance the protein stability of Aurora-A, which is indispensable for the interaction between Aurora-A and PUM2. (A) The stability of Aurora-A is regulated by PUM2. HEK293T cells were transfected with FLAG-tagged Aurora-A, either alone or with different amounts of FLAG-tagged PUM2. The cell lysates were analyzed by immunoblotting. (B) Knock-down of PUM2 results in the down-regulation of both PUM2 and Aurora-A. HEK293T cells were transfected with PUM2 specific siRNA or in combination with siRNA-R-FLAG-PUM2 and the effect of steady-state protein level of Aurora-A was determined using immunoblotting analysis. The relative intensity of protein bands on immunoblotting were quantified and normalized to GAPDH. (C) PUM2 protects Aurora-A from protein degradation when the cells exit from mitosis. HEK293T cells were transiently transfected with an empty vector or with FLAG-tagged PUM2. 24 hrs after transfection, the cells were synchronized in mitosis by nocodazole. For the collection of cells exiting from M phase, the cells were released into the cell cycle progression by removing the mitosis-synchronizing reagent and subsequently incubated with fresh medium containing cycloheximide, which blocks de novo protein synthesis. For the collection of M phase cells, the cells were also treated with nocodazole but this mitosis-synchronizing reagent was not removed when incubating with cycloheximide-containing medium. At the indicated time points, the cells were harvested and the lysates were immunoblotted with anti-PUM2, anti-FLAG, anti-Aurora-A and anti-GAPDH antibodies. Asynchronously (Asy) growing cells were analyzed in parallel. (D) Overexpression of PUM2 mutant, which failed to interact with Aurora-A, leads to the destabilization of this kinase.

    Techniques Used: Transfection, Plasmid Preparation, Incubation, Over Expression, Mutagenesis

    The cell cycle-regulated protein, PUM2, is a novel substrate of Aurora-A kinase. (A) PUM2 exhibites remarkably variations both in protein quantity and phosphorylation state during exit from the G2/M block. HeLa cells were synchronized in the G2/M phase by treatment with nocodazole for 16 hrs and subsequently released into cell cycle progression by removal of the nocodazole. At the indicated time points, the cells were harvested and analyzed by immunoblotting. Asynchronously (Asy) growing cells were analyzed in parallel. (B) PUM2 was localized at the centrosomes from S phase to metaphase. The CL 1–5 cells were fixed and probed with anti-PUM2 antibody (green) and anti-Aurora-A antibody (red), and the DNA was stained with DAPI (blue). The cells were visualized using confocal fluorescence microscopy. (C) PUM2 is a novel substrate for Aurora-A. HEK293T cells were transfected with FLAG-tagged PUM2 in combination with FLAG-tagged Aurora-A (the wild-type or kinase-inactive mutant). To confirm whether the gel mobility up-shift was derived from phosphorylated PUM2, the cell lysates were treated with and without λ protein phosphatase. (D) The M phase-specific electrophoretic mobility shift of PUM2 is abolished in Aurora-A-depleted cells. HeLa cells were transfected with Aurora-A specific siRNA (siAur-A) and synchronized in the G2/M phase by treatment with nocodazole for 16 hrs. The cells were harvested and analyzed by immunoblotting. (E, F) PUM2 is an in vitro substrate of Aurora-A. GST-tagged PUM2 (E) or FLAG-tagged PUM2 immunoprecipitated from cell lysates (F) was incubated, either alone or in combination with recombinant His-tagged Aurora-A, in the presence of [γ-32P]-ATP. The samples were electrophoresed using SDS-PAGE and transferred to a PVDF membrane. They were then either autoradiographed or immunoblotted.
    Figure Legend Snippet: The cell cycle-regulated protein, PUM2, is a novel substrate of Aurora-A kinase. (A) PUM2 exhibites remarkably variations both in protein quantity and phosphorylation state during exit from the G2/M block. HeLa cells were synchronized in the G2/M phase by treatment with nocodazole for 16 hrs and subsequently released into cell cycle progression by removal of the nocodazole. At the indicated time points, the cells were harvested and analyzed by immunoblotting. Asynchronously (Asy) growing cells were analyzed in parallel. (B) PUM2 was localized at the centrosomes from S phase to metaphase. The CL 1–5 cells were fixed and probed with anti-PUM2 antibody (green) and anti-Aurora-A antibody (red), and the DNA was stained with DAPI (blue). The cells were visualized using confocal fluorescence microscopy. (C) PUM2 is a novel substrate for Aurora-A. HEK293T cells were transfected with FLAG-tagged PUM2 in combination with FLAG-tagged Aurora-A (the wild-type or kinase-inactive mutant). To confirm whether the gel mobility up-shift was derived from phosphorylated PUM2, the cell lysates were treated with and without λ protein phosphatase. (D) The M phase-specific electrophoretic mobility shift of PUM2 is abolished in Aurora-A-depleted cells. HeLa cells were transfected with Aurora-A specific siRNA (siAur-A) and synchronized in the G2/M phase by treatment with nocodazole for 16 hrs. The cells were harvested and analyzed by immunoblotting. (E, F) PUM2 is an in vitro substrate of Aurora-A. GST-tagged PUM2 (E) or FLAG-tagged PUM2 immunoprecipitated from cell lysates (F) was incubated, either alone or in combination with recombinant His-tagged Aurora-A, in the presence of [γ-32P]-ATP. The samples were electrophoresed using SDS-PAGE and transferred to a PVDF membrane. They were then either autoradiographed or immunoblotted.

    Techniques Used: Blocking Assay, Staining, Fluorescence, Microscopy, Transfection, Mutagenesis, Derivative Assay, Electrophoretic Mobility Shift Assay, In Vitro, Immunoprecipitation, Incubation, Recombinant, SDS Page

    The mechanism by which PUM2 regulates the cell cycle progression. Through recruitment of the Aurora-A activator and by protecting Aurora-A from attack by APC/C Cdh1 , PUM2 might trigger an increase in the amount of Aurora-A and increase its kinase activity dramatically, causing mitotic entry.
    Figure Legend Snippet: The mechanism by which PUM2 regulates the cell cycle progression. Through recruitment of the Aurora-A activator and by protecting Aurora-A from attack by APC/C Cdh1 , PUM2 might trigger an increase in the amount of Aurora-A and increase its kinase activity dramatically, causing mitotic entry.

    Techniques Used: Activity Assay

    PUM2 interacts physically with Aurora-A, and the S motifs, not the PUM-HD motif, of PUM2 are required for this interaction. (A) PUM2 forms a complex with Aurora-A in HEK293T cells. HEK293T cells were transfected with HA-tagged Aurora-A, either alone or in combination with FLAG-tagged PUM2. The samples were immunoprecipitated using an anti-FLAG antibody and then immunoblotted with an anti-HA antibody to detect Aurora-A. (B) Recombinant Aurora-A and PUM2 form a complex as determined using a GST pull down assay. Purified GST-PUM2 fusion protein or a control (GST immobilized on glutathione-Sepharose 4B beads) was incubated with purified His-tagged Aurora-A or kinase-inactive mutant protein (Aurora-A-K162I). Bead-bound proteins were immunoblotted against an anti-His antibody, and the gel was also stained with coomassie blue. His-tagged Aurora-A and kinase-inactive mutant protein alone are also shown. (C) Detection of endogenous PUM2-Aurora-A complexes by in situ proximity ligation assay (PLA). Complexes between endogenous PUM2 and Aurora-A were visualized by staining CL 1–5 cells with anti-PUM2 and anti-Aurora-A antibodies. Each red dot represented an interaction detected by the PLA assay. DNA was stained with DAPI (blue) and the cells were visualized using confocal fluorescence microscopy. (D) The S motifs of PUM2 are required for the interaction with Aurora-A. Five PUM2 truncation mutants and three deleted PUM2 mutants were generated based on the putative domains present in PUM2. HEK293T cells were transfected with HA-tagged Aurora-A and various FLAG-tagged PUM2 mutants. The cell lysates were immunoprecipitated with an anti-FLAG antibody and then immunoblotted with an anti-HA antibody to detect Aurora-A.
    Figure Legend Snippet: PUM2 interacts physically with Aurora-A, and the S motifs, not the PUM-HD motif, of PUM2 are required for this interaction. (A) PUM2 forms a complex with Aurora-A in HEK293T cells. HEK293T cells were transfected with HA-tagged Aurora-A, either alone or in combination with FLAG-tagged PUM2. The samples were immunoprecipitated using an anti-FLAG antibody and then immunoblotted with an anti-HA antibody to detect Aurora-A. (B) Recombinant Aurora-A and PUM2 form a complex as determined using a GST pull down assay. Purified GST-PUM2 fusion protein or a control (GST immobilized on glutathione-Sepharose 4B beads) was incubated with purified His-tagged Aurora-A or kinase-inactive mutant protein (Aurora-A-K162I). Bead-bound proteins were immunoblotted against an anti-His antibody, and the gel was also stained with coomassie blue. His-tagged Aurora-A and kinase-inactive mutant protein alone are also shown. (C) Detection of endogenous PUM2-Aurora-A complexes by in situ proximity ligation assay (PLA). Complexes between endogenous PUM2 and Aurora-A were visualized by staining CL 1–5 cells with anti-PUM2 and anti-Aurora-A antibodies. Each red dot represented an interaction detected by the PLA assay. DNA was stained with DAPI (blue) and the cells were visualized using confocal fluorescence microscopy. (D) The S motifs of PUM2 are required for the interaction with Aurora-A. Five PUM2 truncation mutants and three deleted PUM2 mutants were generated based on the putative domains present in PUM2. HEK293T cells were transfected with HA-tagged Aurora-A and various FLAG-tagged PUM2 mutants. The cell lysates were immunoprecipitated with an anti-FLAG antibody and then immunoblotted with an anti-HA antibody to detect Aurora-A.

    Techniques Used: Transfection, Immunoprecipitation, Recombinant, Pull Down Assay, Purification, Incubation, Mutagenesis, Staining, In Situ, Proximity Ligation Assay, Fluorescence, Microscopy, Generated

    33) Product Images from "Bump-and-Hole Engineering Identifies Specific Substrates of Glycosyltransferases in Living Cells"

    Article Title: Bump-and-Hole Engineering Identifies Specific Substrates of Glycosyltransferases in Living Cells

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2020.03.030

    Engineered GalNAc-Ts Localize to the Golgi Compartment and Glycosylate Protein Substrates (A) Expression construct for full-length GalNAc-Ts under the control of a Dox-inducible promoter. Inverted tandem repeats (ITRs) are recognized by Sleeping Beauty transposase. WT-T2 and BH-T2 were expressed by stably transfected HepG2 cells in a Dox-inducible fashion. (B) Fluorescence microscopy of HepG2 cells stably transfected with T2 constructs, induced with 0.2 μg/mL Dox, and subsequently stained. Inset: magnification of a single cell. Scale bar, 10 μm. (C)  In vitro  glycosylation of proteins in a membrane fraction by full-length GalNAc-Ts using UDP-GalNAc analogs. Data are from one representative out of two independent experiments. Experiments were repeated with the membrane fraction of non-transfected cells and soluble, purified GalNAc-Ts as an enzyme source. DIC, differential interference contrast; rtTA, reverse tetracycline transcriptional activator. See also   Figure S2 .
    Figure Legend Snippet: Engineered GalNAc-Ts Localize to the Golgi Compartment and Glycosylate Protein Substrates (A) Expression construct for full-length GalNAc-Ts under the control of a Dox-inducible promoter. Inverted tandem repeats (ITRs) are recognized by Sleeping Beauty transposase. WT-T2 and BH-T2 were expressed by stably transfected HepG2 cells in a Dox-inducible fashion. (B) Fluorescence microscopy of HepG2 cells stably transfected with T2 constructs, induced with 0.2 μg/mL Dox, and subsequently stained. Inset: magnification of a single cell. Scale bar, 10 μm. (C) In vitro glycosylation of proteins in a membrane fraction by full-length GalNAc-Ts using UDP-GalNAc analogs. Data are from one representative out of two independent experiments. Experiments were repeated with the membrane fraction of non-transfected cells and soluble, purified GalNAc-Ts as an enzyme source. DIC, differential interference contrast; rtTA, reverse tetracycline transcriptional activator. See also Figure S2 .

    Techniques Used: Expressing, Construct, Stable Transfection, Transfection, Fluorescence, Microscopy, Staining, In Vitro, Purification

    34) Product Images from "Newcastle Disease Virus V Protein Targets Phosphorylated STAT1 to Block IFN-I Signaling"

    Article Title: Newcastle Disease Virus V Protein Targets Phosphorylated STAT1 to Block IFN-I Signaling

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0148560

    The reduction of total and phosphorylated STAT1 in NDV-infected cells was inhibited after treatment with Ub E1 inhibitor PYR-41 at different time points. (A) STAT1 and phospho-STAT1 expression levels in PYR-41 treated Vero cells at 6 hpi. (B) Phospho-STAT1 levels in PYR-41 treated Vero cells at 4, 6, 8 hpi. (C) Exogenous mutant STAT1 lacking 701aa phosphorylation site were not degraded in the course of NDV infection. One microgram pFlag-STAT1 or pFlag-Y701F was transfected into A549 cells cultured in 6-well plates. At 12 h post transfection, the cells were subsequently infected with NDVs at a MOI of 3. The cells were harvested at 24 hpi. (D) The expression levels of IFN-responsive genes in V-expressing A549 cells after stimulation of IFN-α. A549 cells in 6-well plates were transfected with 3 μg pCI-V or pCI-neo for each well as above-described. At 4 h and 8 h post-transfection, the cells were harvested following the treatment with 500 U/ml IFN-α for 30 min.
    Figure Legend Snippet: The reduction of total and phosphorylated STAT1 in NDV-infected cells was inhibited after treatment with Ub E1 inhibitor PYR-41 at different time points. (A) STAT1 and phospho-STAT1 expression levels in PYR-41 treated Vero cells at 6 hpi. (B) Phospho-STAT1 levels in PYR-41 treated Vero cells at 4, 6, 8 hpi. (C) Exogenous mutant STAT1 lacking 701aa phosphorylation site were not degraded in the course of NDV infection. One microgram pFlag-STAT1 or pFlag-Y701F was transfected into A549 cells cultured in 6-well plates. At 12 h post transfection, the cells were subsequently infected with NDVs at a MOI of 3. The cells were harvested at 24 hpi. (D) The expression levels of IFN-responsive genes in V-expressing A549 cells after stimulation of IFN-α. A549 cells in 6-well plates were transfected with 3 μg pCI-V or pCI-neo for each well as above-described. At 4 h and 8 h post-transfection, the cells were harvested following the treatment with 500 U/ml IFN-α for 30 min.

    Techniques Used: Infection, Expressing, Mutagenesis, Transfection, Cell Culture

    STAT1 expression in NDV infected or V-expressing plasmids transfected cells. (A) No STAT1 reduction was observed in Vero cells infected with NDV ZJ1, 9a5b or LaSota at MOI 3 at 6, 12 or 24 hpi. (B) Over-expression of ZJ1, 9a5b and LaSota V protein did not effect on STAT1 expression in Vero cells transfected with V-expressing plasmids. (C) STAT1 was reduced at 48 h post-transfection in NDV-infected Vero cells (MOI = 3) transfected in advance with V-expressing plasmids. (D) STAT1 expression in A549 cells transfected with V expressing plasmids or infected with ZJ1 or LaSota was detected at 48 h post-transfection or 12 h post-infection by indirect fluorescence assay. These infected A549 cells were fixed and detected for P/V/W proteins with a mixture of anti-serum Pab-V1 and Pab-V2; while the presence of STAT1 was determined by anti-STAT1 antibody (ab31369). Cellular nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI).
    Figure Legend Snippet: STAT1 expression in NDV infected or V-expressing plasmids transfected cells. (A) No STAT1 reduction was observed in Vero cells infected with NDV ZJ1, 9a5b or LaSota at MOI 3 at 6, 12 or 24 hpi. (B) Over-expression of ZJ1, 9a5b and LaSota V protein did not effect on STAT1 expression in Vero cells transfected with V-expressing plasmids. (C) STAT1 was reduced at 48 h post-transfection in NDV-infected Vero cells (MOI = 3) transfected in advance with V-expressing plasmids. (D) STAT1 expression in A549 cells transfected with V expressing plasmids or infected with ZJ1 or LaSota was detected at 48 h post-transfection or 12 h post-infection by indirect fluorescence assay. These infected A549 cells were fixed and detected for P/V/W proteins with a mixture of anti-serum Pab-V1 and Pab-V2; while the presence of STAT1 was determined by anti-STAT1 antibody (ab31369). Cellular nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI).

    Techniques Used: Expressing, Infection, Transfection, Over Expression, Fluorescence, Staining

    Newcastle disease virus infection impaired IFN-α-induced STAT1 phosphorylation. (A) IFN-α-induced phosphorylated STAT1 degradation in NDV-infected A549 and Vero cells. A549 or Vero cells were infected with NDV strains ZJ1 at MOI 3. At indicated time points post infection, A549 and Vero cells were stimulated with 500 U/ml human IFN-α or IFN-γ in 1 ml DMEM at 37°C for 15 min. Uninfected cells were stimulated with IFN as negative controls (IFNα+/infection-). IFN-α-induced phospho-STAT1 was observed (IFNα+/infection+) for reduction in total STAT1 proteins. IFN-γ-induced phospho-STAT1 proteins were not reduced. (B) Phospho-STAT1 in A549 cells transfected with V-expressing plasmids after stimulation with IFN-α. (C) Expression level of STAT1 and phospho-STAT1 decreased in V-expressing Vero cells after IFN-α stimulation. Vero cells were mock transfected with pCI-neo plasmids. Cells on glass coverlips were transfected with pCI-V/ZJ1 plasmids. At 48 h post-transfection, cells were treated with IFN-α for 15 min prior to fixation as in “Material and methods”. V protein was detected by a mixture of anti-serum Pab-V1 and Pab-V2; STAT1 and phosphorylation were determined by anti-STAT1 antibody (ab31369) and anti-phospho-STAT1 antibody (ab30645). Cellular nuclei were stained with DAPI.
    Figure Legend Snippet: Newcastle disease virus infection impaired IFN-α-induced STAT1 phosphorylation. (A) IFN-α-induced phosphorylated STAT1 degradation in NDV-infected A549 and Vero cells. A549 or Vero cells were infected with NDV strains ZJ1 at MOI 3. At indicated time points post infection, A549 and Vero cells were stimulated with 500 U/ml human IFN-α or IFN-γ in 1 ml DMEM at 37°C for 15 min. Uninfected cells were stimulated with IFN as negative controls (IFNα+/infection-). IFN-α-induced phospho-STAT1 was observed (IFNα+/infection+) for reduction in total STAT1 proteins. IFN-γ-induced phospho-STAT1 proteins were not reduced. (B) Phospho-STAT1 in A549 cells transfected with V-expressing plasmids after stimulation with IFN-α. (C) Expression level of STAT1 and phospho-STAT1 decreased in V-expressing Vero cells after IFN-α stimulation. Vero cells were mock transfected with pCI-neo plasmids. Cells on glass coverlips were transfected with pCI-V/ZJ1 plasmids. At 48 h post-transfection, cells were treated with IFN-α for 15 min prior to fixation as in “Material and methods”. V protein was detected by a mixture of anti-serum Pab-V1 and Pab-V2; STAT1 and phosphorylation were determined by anti-STAT1 antibody (ab31369) and anti-phospho-STAT1 antibody (ab30645). Cellular nuclei were stained with DAPI.

    Techniques Used: Infection, Transfection, Expressing, Staining

    Infection with rZJ1-VS did not result in degradation of phospho-STAT1. A549 cells were infected with rZJ1-VS or wt ZJ1 at a MOI of 1 or 3. At indicated time points, cells were stimulated with 500 U/mL IFN-α for 15 min and harvested for Western blot. Phospho-STAT1 and STAT1 was observed in A549 cells infected with ZJ1 or rZJ1-VS, which expressed incomplete V protein.
    Figure Legend Snippet: Infection with rZJ1-VS did not result in degradation of phospho-STAT1. A549 cells were infected with rZJ1-VS or wt ZJ1 at a MOI of 1 or 3. At indicated time points, cells were stimulated with 500 U/mL IFN-α for 15 min and harvested for Western blot. Phospho-STAT1 and STAT1 was observed in A549 cells infected with ZJ1 or rZJ1-VS, which expressed incomplete V protein.

    Techniques Used: Infection, Western Blot

    35) Product Images from "The WHHERE coactivator complex is required for retinoic acid-dependent regulation of embryonic symmetry"

    Article Title: The WHHERE coactivator complex is required for retinoic acid-dependent regulation of embryonic symmetry

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00593-6

    Ehmt2 controls retinoic acid signaling and symmetric somite formation. a , b RARE-LacZ activity in control Ehmt2 +/+ a and Ehmt2 gt/gt b embryos at E8.75-E9.0 ( dorsal views ). c , d In situ hybridization for Uncx4.1 in wild-type Ehmt2 +/+ c and Ehmt2 gt/gt d embryos at E8.75-E9.0 ( dorsal views ). e Graph representing the number of 7- somite to 15-somite stage Ehmt2 gt/gt embryos with left-sided ( orange ), symmetric ( blue ), or right-sided ( green ) delay in somite formation. f – i RARE-Luciferase activity from NIH3T3 cells treated with or without 1 µM RA for 20 h. f Cells treated with siRNA for Ehmt2 ( n = 4). g Cells transfected with an Ehmt2 expression plasmid ( n = 4). h Cells co-transfected with Rere and Ehmt2 expression plasmids ( n = 4). i Cells overexpressing Rere or Hdac1 and treated with siRNA against Ehmt2 ( n = 4). j ChIP of the Rarβ promoter with a specific antibody for Ehmt2 using NIH3T3 cells treated or not with 1 µM RA during 1 h ( n = 3). k , l ChIP analysis of the Rarβ promoter in NIH3T3 cells transfected with siRNA for Ehmt2 and treated with 1 µM RA during 1 h. ChIP was performed with antibodies specific to Rere, Wdr5, Hdac1, and Hdac2 k or Pol II l ( n = 3). In all graphs data represent mean ± s.e.m. NS—not significant, * P
    Figure Legend Snippet: Ehmt2 controls retinoic acid signaling and symmetric somite formation. a , b RARE-LacZ activity in control Ehmt2 +/+ a and Ehmt2 gt/gt b embryos at E8.75-E9.0 ( dorsal views ). c , d In situ hybridization for Uncx4.1 in wild-type Ehmt2 +/+ c and Ehmt2 gt/gt d embryos at E8.75-E9.0 ( dorsal views ). e Graph representing the number of 7- somite to 15-somite stage Ehmt2 gt/gt embryos with left-sided ( orange ), symmetric ( blue ), or right-sided ( green ) delay in somite formation. f – i RARE-Luciferase activity from NIH3T3 cells treated with or without 1 µM RA for 20 h. f Cells treated with siRNA for Ehmt2 ( n = 4). g Cells transfected with an Ehmt2 expression plasmid ( n = 4). h Cells co-transfected with Rere and Ehmt2 expression plasmids ( n = 4). i Cells overexpressing Rere or Hdac1 and treated with siRNA against Ehmt2 ( n = 4). j ChIP of the Rarβ promoter with a specific antibody for Ehmt2 using NIH3T3 cells treated or not with 1 µM RA during 1 h ( n = 3). k , l ChIP analysis of the Rarβ promoter in NIH3T3 cells transfected with siRNA for Ehmt2 and treated with 1 µM RA during 1 h. ChIP was performed with antibodies specific to Rere, Wdr5, Hdac1, and Hdac2 k or Pol II l ( n = 3). In all graphs data represent mean ± s.e.m. NS—not significant, * P

    Techniques Used: Activity Assay, In Situ Hybridization, Luciferase, Transfection, Expressing, Plasmid Preparation, Chromatin Immunoprecipitation

    Kat2a but not Ep300 acts as a coactivator for retinoic acid signaling. a – e RARE-Luciferase activity from NIH3T3 cells treated or not with 1 µM RA for 20 h. a Cells transfected with expression plasmids containing Ep300 , Hdac1 , or both ( n = 4). b Cells transfected with expression plasmids containing human Hdac1 (H1-WT) or Hdac1 mutant (H1-6R) ( n = 4). c Cells transfected with expression plasmids containing Rarα , Rarα , and Ep300 or Rarα and Kat2a ( n = 3). d Cells transfected with expression plasmids containing Rere , Rere and Ep300 or Rere and Kat2a ( n = 3). e Cells treated either with siRNA for Rere, Ep300 , or Kat2a ( n = 4). In all graphs data represent mean ± s.e.m. NS—not significant, * P
    Figure Legend Snippet: Kat2a but not Ep300 acts as a coactivator for retinoic acid signaling. a – e RARE-Luciferase activity from NIH3T3 cells treated or not with 1 µM RA for 20 h. a Cells transfected with expression plasmids containing Ep300 , Hdac1 , or both ( n = 4). b Cells transfected with expression plasmids containing human Hdac1 (H1-WT) or Hdac1 mutant (H1-6R) ( n = 4). c Cells transfected with expression plasmids containing Rarα , Rarα , and Ep300 or Rarα and Kat2a ( n = 3). d Cells transfected with expression plasmids containing Rere , Rere and Ep300 or Rere and Kat2a ( n = 3). e Cells treated either with siRNA for Rere, Ep300 , or Kat2a ( n = 4). In all graphs data represent mean ± s.e.m. NS—not significant, * P

    Techniques Used: Luciferase, Activity Assay, Transfection, Expressing, Mutagenesis

    The WHHERE complex acts as a coactivator for retinoic acid signaling. a - k RARE-Luciferase activity from NIH3T3 cells treated or not with 1 µM RA for 20 h. a Cells transfected with expression plasmids containing Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). b Cells transfected with expression plasmids containing Hdac1 , Hdac2 , or both ( n = 4). c Cells treated either with siRNA for Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). d Cells treated with siRNA for Hdac1 , Hdac2 or both ( n = 4). e Cells overexpressing Rere or Wdr5 and treated with siRNA against Hdac1 ( n = 4). f Cells overexpressing Rere or Wdr5 and treated with siRNA against both Hdac1 and Hdac2 ( n = 4). g Cells treated with the HDAC inhibitors Trichostatin A (TSA) (60 nM), sodium butyrate (SB) (3 mM), apicidin (Api) (300 nM), LAQ824 (LAQ) (60 nM) and Panobinostat (Pano) (30 nM) ( n = 4). h Cells overexpressing Rere or Wdr5 and treated with TSA (30 nM) ( n = 4). i Cells overexpressing Rere or Wdr5 and treated with SB (1.5 mM) ( n = 4). j Cells transfected with expression plasmids containing Rere , N-Rere ( Rere N-terminal domain) or Rere C ( Rere C-terminal domain) ( n = 3). k Cells overexpressing N-Rere ( Rere N-terminal domain) and treated with TSA (30 nM) or SB (1.5 mM) ( n = 4). l Cells transfected with expression plasmids containing Rere , Wdr5 , or both ( n = 4). m Cells overexpressing Rere and treated with siRNA for Wdr5 ( n = 4). In all graphs data represent mean ± s.e.m. NS—not significant, * P
    Figure Legend Snippet: The WHHERE complex acts as a coactivator for retinoic acid signaling. a - k RARE-Luciferase activity from NIH3T3 cells treated or not with 1 µM RA for 20 h. a Cells transfected with expression plasmids containing Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). b Cells transfected with expression plasmids containing Hdac1 , Hdac2 , or both ( n = 4). c Cells treated either with siRNA for Rere, Wdr5 , Hdac1 , or Hdac2 ( n = 4). d Cells treated with siRNA for Hdac1 , Hdac2 or both ( n = 4). e Cells overexpressing Rere or Wdr5 and treated with siRNA against Hdac1 ( n = 4). f Cells overexpressing Rere or Wdr5 and treated with siRNA against both Hdac1 and Hdac2 ( n = 4). g Cells treated with the HDAC inhibitors Trichostatin A (TSA) (60 nM), sodium butyrate (SB) (3 mM), apicidin (Api) (300 nM), LAQ824 (LAQ) (60 nM) and Panobinostat (Pano) (30 nM) ( n = 4). h Cells overexpressing Rere or Wdr5 and treated with TSA (30 nM) ( n = 4). i Cells overexpressing Rere or Wdr5 and treated with SB (1.5 mM) ( n = 4). j Cells transfected with expression plasmids containing Rere , N-Rere ( Rere N-terminal domain) or Rere C ( Rere C-terminal domain) ( n = 3). k Cells overexpressing N-Rere ( Rere N-terminal domain) and treated with TSA (30 nM) or SB (1.5 mM) ( n = 4). l Cells transfected with expression plasmids containing Rere , Wdr5 , or both ( n = 4). m Cells overexpressing Rere and treated with siRNA for Wdr5 ( n = 4). In all graphs data represent mean ± s.e.m. NS—not significant, * P

    Techniques Used: Luciferase, Activity Assay, Transfection, Expressing

    The WHHERE complex is recruited to the promoter of retinoic acid target genes. a RARE-Luciferase activity, b qPCR analysis of Rarβ expression of NIH3T3 treated with 1 µM RA ( blue ) or 1 µM RA and 100 nM TSA ( green ) ( n = 4 each). c , d Rarβ -promoter ChIP analysis from E8.75 RARE-LacZ mouse embryos with antibodies against Rarα c or Rere, Wdr5, Hdac1, and Hdac2 d . Top panels c , d : RARE element of the Rarβ promoter ChIP ( n = 3). Bottom panels : control ChIP from Rarβ promoter upstream region (−3 Kb). e , f ChIP analysis of the RARE sequence in the RARE-LacZ reporter with antibodies against Rarα e or Rere, Wdr5, Hdac1, and Hdac2 f using E8.75 RARE-LacZ mouse embryos ( n = 3). g – i ChIP analysis of Rarβ promoter in NIH3T3 treated or not during 1 h with 1 µM RA using antibodies for Rarα g , Rere, Wdr5, Hdac1, and Hdac2 h , Pol II i . Top panels h , i : ChIP of the RARE element in the Rarβ -promoter ( n = 3). Bottom panels : control ChIP from Rarβ -promoter -upstream region (−3 Kb). j ChIP of the Rarβ promoter with Pol II antibody using NIH3T3 cells treated with 1 µM RA or 1 µM RA and 100 nM TSA for 1 h ( n = 3). k ChIP with Pol II antibody from NIH3T3 transfected with siRNA for Hdac1 and treated with 1 µM RA during 1 h ( n = 3). l – n Co-immunoprecipitation using NIH3T3 transfected with Flag-Hdac1 l , Rere-HA and Flag-Hdac1 m , n , with anti-Flag l , m or anti-HA n antibody and immunoblots (IB) for Flag-Hdac1, Rere-HA, and Rarα. o Rarβ -promoter ChIP analysis from E8.75 RARE-LacZ mouse embryos with an anti-Ehmt2. Top panel o : RARE element ChIP of the Rarβ promoter ( n = 3). Bottom panel : control ChIP from Rarβ promoter upstream region (−3 Kb). p ChIP analysis of the RARE sequence in the RARE-LacZ reporter with an anti- Ehmt2 using E8.75 RARE-LacZ mouse embryos ( n = 3). Data represent mean ± s.e.m. unless otherwise specified. NS—not significant, * P
    Figure Legend Snippet: The WHHERE complex is recruited to the promoter of retinoic acid target genes. a RARE-Luciferase activity, b qPCR analysis of Rarβ expression of NIH3T3 treated with 1 µM RA ( blue ) or 1 µM RA and 100 nM TSA ( green ) ( n = 4 each). c , d Rarβ -promoter ChIP analysis from E8.75 RARE-LacZ mouse embryos with antibodies against Rarα c or Rere, Wdr5, Hdac1, and Hdac2 d . Top panels c , d : RARE element of the Rarβ promoter ChIP ( n = 3). Bottom panels : control ChIP from Rarβ promoter upstream region (−3 Kb). e , f ChIP analysis of the RARE sequence in the RARE-LacZ reporter with antibodies against Rarα e or Rere, Wdr5, Hdac1, and Hdac2 f using E8.75 RARE-LacZ mouse embryos ( n = 3). g – i ChIP analysis of Rarβ promoter in NIH3T3 treated or not during 1 h with 1 µM RA using antibodies for Rarα g , Rere, Wdr5, Hdac1, and Hdac2 h , Pol II i . Top panels h , i : ChIP of the RARE element in the Rarβ -promoter ( n = 3). Bottom panels : control ChIP from Rarβ -promoter -upstream region (−3 Kb). j ChIP of the Rarβ promoter with Pol II antibody using NIH3T3 cells treated with 1 µM RA or 1 µM RA and 100 nM TSA for 1 h ( n = 3). k ChIP with Pol II antibody from NIH3T3 transfected with siRNA for Hdac1 and treated with 1 µM RA during 1 h ( n = 3). l – n Co-immunoprecipitation using NIH3T3 transfected with Flag-Hdac1 l , Rere-HA and Flag-Hdac1 m , n , with anti-Flag l , m or anti-HA n antibody and immunoblots (IB) for Flag-Hdac1, Rere-HA, and Rarα. o Rarβ -promoter ChIP analysis from E8.75 RARE-LacZ mouse embryos with an anti-Ehmt2. Top panel o : RARE element ChIP of the Rarβ promoter ( n = 3). Bottom panel : control ChIP from Rarβ promoter upstream region (−3 Kb). p ChIP analysis of the RARE sequence in the RARE-LacZ reporter with an anti- Ehmt2 using E8.75 RARE-LacZ mouse embryos ( n = 3). Data represent mean ± s.e.m. unless otherwise specified. NS—not significant, * P

    Techniques Used: Luciferase, Activity Assay, Real-time Polymerase Chain Reaction, Expressing, Chromatin Immunoprecipitation, Sequencing, Transfection, Immunoprecipitation, Western Blot

    The WHHERE complex controls somite bilateral symmetry. a – d RARE-LacZ expression in wild-type a , Rere om/om b , Hdac1 −/− c and Wdr5 fl/+ ; T-Cre d embryos at E8.75-E9.0 ( dorsal views ). e – h In situ hybridization showing somites labeled with Uncx4.1 in wild-type e , Rere om/om f , Hdac1 –/– g and Wdr5 fl/+ ;T-Cre h embryos at E8.75-E9.0 ( dorsal views ). i – k Graphs representing the number of 7- somite to 15-somite stage embryos with left-sided ( orange ), symmetric ( blue ) or right-sided ( green ) delay in somite formation: Rere om/om i , Hdac1 –/– j and Rere om/om ;Wdr5 fl/+ ;T-Cre k . l – o In situ hybridization for Uncx4.1 in wild-type l , Wdr5 fl/+ ;T-Cre m , Rere om/om ;Wdr5 +/+ n and Rere om/om ;Wdr5 fl/+ ;T-Cre o embryos at E8.75-E9.0 ( dorsal views ). For each genotype at least 5–10 embryos were analyzed. Bar = 100 microns
    Figure Legend Snippet: The WHHERE complex controls somite bilateral symmetry. a – d RARE-LacZ expression in wild-type a , Rere om/om b , Hdac1 −/− c and Wdr5 fl/+ ; T-Cre d embryos at E8.75-E9.0 ( dorsal views ). e – h In situ hybridization showing somites labeled with Uncx4.1 in wild-type e , Rere om/om f , Hdac1 –/– g and Wdr5 fl/+ ;T-Cre h embryos at E8.75-E9.0 ( dorsal views ). i – k Graphs representing the number of 7- somite to 15-somite stage embryos with left-sided ( orange ), symmetric ( blue ) or right-sided ( green ) delay in somite formation: Rere om/om i , Hdac1 –/– j and Rere om/om ;Wdr5 fl/+ ;T-Cre k . l – o In situ hybridization for Uncx4.1 in wild-type l , Wdr5 fl/+ ;T-Cre m , Rere om/om ;Wdr5 +/+ n and Rere om/om ;Wdr5 fl/+ ;T-Cre o embryos at E8.75-E9.0 ( dorsal views ). For each genotype at least 5–10 embryos were analyzed. Bar = 100 microns

    Techniques Used: Expressing, In Situ Hybridization, Labeling

    36) Product Images from "hADA3 is required for p53 activity"

    Article Title: hADA3 is required for p53 activity

    Journal: The EMBO Journal

    doi: 10.1093/emboj/20.22.6404

    Fig. 3. The physical interaction of hADA3 and p53 in human cells requires the N-terminal half of hADA3 and is enhanced by DNA damage. ( A ) The N-terminus of hADA3 interacts with p53. FLAG-tagged full-length hADA3, the N-terminal half of hADA3 or the C-terminal half with NLS were expressed in 293 cells. Co-immunoprecipitation and immunoblotting of cell lysates were performed as in Figure 2C, except for the indicated antibodies. SV40 large T antigen and N-terminally truncated 53BP1 served as positive controls; the vector control was pFLAG-CMV2. ( B ) γ-irradiation markedly increases the amount of p53 co-immunoprecipitated with hADA3. Experiments were performed as in (A), except for the exposure to 80 Gy of γ-irradiation and lysis 1.5 h later. SV40 large T antigen was used as a control that did not show enhanced interaction with p53 after γ-irradiation. ( C ) UV-irradiation markedly increases the amount of p53 co-immunoprecipitated with hADA3. Experiments were performed as in (A) and (B), except for the exposure to 50 J/m 2 UV-irradiation and lysis of cells 3 h later. p53 -negative H1299 cells with transiently transfected p53 (pC53-SN3) do not show an increase of p53 protein after UV-irradiation due to high baseline p53 levels, while U2OS cells with endogenous wild-type p53 do. For H1299 cells, the enhanced p53–hADA3 interaction is seen despite unequal levels of FLAG-tagged hADA3 favoring the lane without UV-irradiation. ( D and E ) Endogenous hADA3 and p53 physically interact in human cells. To induce DNA damage, U2OS cells were exposed to 50 J/m 2 UV-irradiation prior to lysis 3 h later (D) and A549 cells to 0.4 µg/ml doxorubicin for 12 h (E). After lysis, a mixture of five monoclonal anti-p53 antibodies, cross-linked to protein A– or protein G–agarose, was used to immunprecipitate p53, followed by detection of hADA3 by immunoblotting.
    Figure Legend Snippet: Fig. 3. The physical interaction of hADA3 and p53 in human cells requires the N-terminal half of hADA3 and is enhanced by DNA damage. ( A ) The N-terminus of hADA3 interacts with p53. FLAG-tagged full-length hADA3, the N-terminal half of hADA3 or the C-terminal half with NLS were expressed in 293 cells. Co-immunoprecipitation and immunoblotting of cell lysates were performed as in Figure 2C, except for the indicated antibodies. SV40 large T antigen and N-terminally truncated 53BP1 served as positive controls; the vector control was pFLAG-CMV2. ( B ) γ-irradiation markedly increases the amount of p53 co-immunoprecipitated with hADA3. Experiments were performed as in (A), except for the exposure to 80 Gy of γ-irradiation and lysis 1.5 h later. SV40 large T antigen was used as a control that did not show enhanced interaction with p53 after γ-irradiation. ( C ) UV-irradiation markedly increases the amount of p53 co-immunoprecipitated with hADA3. Experiments were performed as in (A) and (B), except for the exposure to 50 J/m 2 UV-irradiation and lysis of cells 3 h later. p53 -negative H1299 cells with transiently transfected p53 (pC53-SN3) do not show an increase of p53 protein after UV-irradiation due to high baseline p53 levels, while U2OS cells with endogenous wild-type p53 do. For H1299 cells, the enhanced p53–hADA3 interaction is seen despite unequal levels of FLAG-tagged hADA3 favoring the lane without UV-irradiation. ( D and E ) Endogenous hADA3 and p53 physically interact in human cells. To induce DNA damage, U2OS cells were exposed to 50 J/m 2 UV-irradiation prior to lysis 3 h later (D) and A549 cells to 0.4 µg/ml doxorubicin for 12 h (E). After lysis, a mixture of five monoclonal anti-p53 antibodies, cross-linked to protein A– or protein G–agarose, was used to immunprecipitate p53, followed by detection of hADA3 by immunoblotting.

    Techniques Used: Immunoprecipitation, Plasmid Preparation, Irradiation, Lysis, Transfection

    37) Product Images from "HDM2 Promotes NEDDylation of Hepatitis B Virus HBx To Enhance Its Stability and Function"

    Article Title: HDM2 Promotes NEDDylation of Hepatitis B Virus HBx To Enhance Its Stability and Function

    Journal: Journal of Virology

    doi: 10.1128/JVI.00340-17

    HDM2 enhances HBx stability. (A) 293T cells were transfected with pFLAG-CMV2-HBx and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h and then treated with cycloheximide (100 ng/ml) for the indicated periods of time (1, 2, and 3 h). The cell lysates were collected for immunoblotting (left), and the relative protein levels were quantified (right) in three independent experiments. (B) 293T cells were transfected with pFLAG-CMV2-HBx and si-HDM2 with or without pCMV-Myc-HDM2 and then treated with cycloheximide for the indicated time. The cell lysates were harvested and subjected to immunoblotting (left), and the relative protein levels were quantified (right) in three independent experiments using ImageJ. (C) 293T cells were transfected with pFLAG-CMV2-HBx, pEF-His-Ub, and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h. The cell lysates were harvested for His-pulldown assay, followed by immunoblotting with anti-FLAG antibody. (D) 293T cells were transfected with pFLAG-CMV2-HBx and pFLAG-CMV2-Siah-1 with or without pCMV-Myc-HDM2, and then the cell lysates were harvested and subjected to His-pulldown assay. (E and F) Of the HBV-positive HCC liver tissues, 160 were collected and subjected to IHC staining with anti-HBx and anti-HDM2 antibodies. The correlation of HBx and HDM2 was evaluated (E), and representative images from immunohistochemical staining of HBx and HDM2 from the same HCC liver tissues are shown (F). The results are shown as means ± the standard deviations (SD). *, P
    Figure Legend Snippet: HDM2 enhances HBx stability. (A) 293T cells were transfected with pFLAG-CMV2-HBx and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h and then treated with cycloheximide (100 ng/ml) for the indicated periods of time (1, 2, and 3 h). The cell lysates were collected for immunoblotting (left), and the relative protein levels were quantified (right) in three independent experiments. (B) 293T cells were transfected with pFLAG-CMV2-HBx and si-HDM2 with or without pCMV-Myc-HDM2 and then treated with cycloheximide for the indicated time. The cell lysates were harvested and subjected to immunoblotting (left), and the relative protein levels were quantified (right) in three independent experiments using ImageJ. (C) 293T cells were transfected with pFLAG-CMV2-HBx, pEF-His-Ub, and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h. The cell lysates were harvested for His-pulldown assay, followed by immunoblotting with anti-FLAG antibody. (D) 293T cells were transfected with pFLAG-CMV2-HBx and pFLAG-CMV2-Siah-1 with or without pCMV-Myc-HDM2, and then the cell lysates were harvested and subjected to His-pulldown assay. (E and F) Of the HBV-positive HCC liver tissues, 160 were collected and subjected to IHC staining with anti-HBx and anti-HDM2 antibodies. The correlation of HBx and HDM2 was evaluated (E), and representative images from immunohistochemical staining of HBx and HDM2 from the same HCC liver tissues are shown (F). The results are shown as means ± the standard deviations (SD). *, P

    Techniques Used: Transfection, Immunohistochemistry, Staining

    HBx Lys91 and Lys95 are the major NEDDylation sites. (A) Schematic map of HBx. Five lysines (91, 95, 113, 118, and 140) on HBx are highly conserved in different HBV subtypes. (B) 293T cells were cotransfected with pEF-His-NEDD8 and either pFLAG-CMV2-HBx-WT, -K91R, -K95R, -K113R, -K118R, or -K140R, and the cell lysates were collected for His-pulldown assay, followed by immunoblotting with anti-FLAG antibody. (C) 293T cells were transfected with pFLAG-CMV2-HBx (left) or pFLAG-CMV2-HBx-K95R (right) and pEF-His-NEDD8 for 48 h. The cell lysates were then collected, and NEDDylated-HBx was enriched by Ni beads and subjected to mass spectrometry. The tandem mass spectra of the GlyGly-modified peptides VLHK(95)R and METTVNAHQVLPK(91) are shown. b and y ion designations are shown. (D) Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, Huh7-GFP-HBx-K91/95R, and Huh7-control cells were transfected with pEF-His-NEDD8. After 48 h, the cell lysates were collected and subjected to a His-pulldown assay. (E) 293T cells were transfected with pFLAG-CMV2-HBx-WT or with pFLAG-CMV2-HBx-K91R, -K95R, or -K91R/95R with pEF-His-NEDD8 for 48 h and then treated with cycloheximide for the indicated time. The cell lysates were harvested and subjected to an immunoblotting assay (left), and the relative protein levels were quantified (right) in three independent experiments.
    Figure Legend Snippet: HBx Lys91 and Lys95 are the major NEDDylation sites. (A) Schematic map of HBx. Five lysines (91, 95, 113, 118, and 140) on HBx are highly conserved in different HBV subtypes. (B) 293T cells were cotransfected with pEF-His-NEDD8 and either pFLAG-CMV2-HBx-WT, -K91R, -K95R, -K113R, -K118R, or -K140R, and the cell lysates were collected for His-pulldown assay, followed by immunoblotting with anti-FLAG antibody. (C) 293T cells were transfected with pFLAG-CMV2-HBx (left) or pFLAG-CMV2-HBx-K95R (right) and pEF-His-NEDD8 for 48 h. The cell lysates were then collected, and NEDDylated-HBx was enriched by Ni beads and subjected to mass spectrometry. The tandem mass spectra of the GlyGly-modified peptides VLHK(95)R and METTVNAHQVLPK(91) are shown. b and y ion designations are shown. (D) Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, Huh7-GFP-HBx-K91/95R, and Huh7-control cells were transfected with pEF-His-NEDD8. After 48 h, the cell lysates were collected and subjected to a His-pulldown assay. (E) 293T cells were transfected with pFLAG-CMV2-HBx-WT or with pFLAG-CMV2-HBx-K91R, -K95R, or -K91R/95R with pEF-His-NEDD8 for 48 h and then treated with cycloheximide for the indicated time. The cell lysates were harvested and subjected to an immunoblotting assay (left), and the relative protein levels were quantified (right) in three independent experiments.

    Techniques Used: Transfection, Mass Spectrometry, Modification

    NEDDylation of HBx favors its chromatin localization and transcriptional regulation activity. (A) 293T cells were transfected with pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R for 48 h. The cells were then fixed and subjected to immunofluorescence with FLAG antibody. (B) Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, and Huh7-GFP-HBx-K91/95R cells were collected for subcellular fractionation. The total cell lysates and chromatin-bound proteins were extracted with appropriate lysis buffers and subjected to immunoblotting with the indicated antibodies. (C) 293T cells were transfected with pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R, respectively. The cell lysates were harvested for immunoprecipitation assay. (D) The total RNAs were extracted from Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, and Huh7-GFP-HBx-K91/95R cells, with Huh7-control cells used as a control, and subjected to real-time PCR with primers specific for IL-8, MMP9, or YAP mRNAs. (E) Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, and Huh7-GFP-HBx-K91/95R cells were collected and subjected to ChIP assay with anti-FLAG antibody (IgG as the negative control). Real-time PCR was performed to quantify expression of IL-8, MMP9, and YAP. (F) 293T cells were cotransfected with pHBV-Enhancer, pRL-TK, and either pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R, respectively. The cell lysates were harvested and subjected to a dual-luciferase assay. (G) 293T cells were cotransfected with prcccDNA, pCMV-Cre, and either pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R, respectively. The cells were harvested, and total RNA was extracted for real-time PCR to detect the amount of pgRNA. The results are shown as means ± the SD. *, P
    Figure Legend Snippet: NEDDylation of HBx favors its chromatin localization and transcriptional regulation activity. (A) 293T cells were transfected with pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R for 48 h. The cells were then fixed and subjected to immunofluorescence with FLAG antibody. (B) Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, and Huh7-GFP-HBx-K91/95R cells were collected for subcellular fractionation. The total cell lysates and chromatin-bound proteins were extracted with appropriate lysis buffers and subjected to immunoblotting with the indicated antibodies. (C) 293T cells were transfected with pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R, respectively. The cell lysates were harvested for immunoprecipitation assay. (D) The total RNAs were extracted from Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, and Huh7-GFP-HBx-K91/95R cells, with Huh7-control cells used as a control, and subjected to real-time PCR with primers specific for IL-8, MMP9, or YAP mRNAs. (E) Huh7-GFP-HBx-WT, Huh7-GFP-HBx-K91R, Huh7-GFP-HBx-K95R, and Huh7-GFP-HBx-K91/95R cells were collected and subjected to ChIP assay with anti-FLAG antibody (IgG as the negative control). Real-time PCR was performed to quantify expression of IL-8, MMP9, and YAP. (F) 293T cells were cotransfected with pHBV-Enhancer, pRL-TK, and either pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R, respectively. The cell lysates were harvested and subjected to a dual-luciferase assay. (G) 293T cells were cotransfected with prcccDNA, pCMV-Cre, and either pFLAG-CMV2-HBx-WT, -K91R, -K95R, or -K91/95R, respectively. The cells were harvested, and total RNA was extracted for real-time PCR to detect the amount of pgRNA. The results are shown as means ± the SD. *, P

    Techniques Used: Activity Assay, Transfection, Immunofluorescence, Fractionation, Lysis, Immunoprecipitation, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Negative Control, Expressing, Luciferase

    HBx is specifically NEDDylated by HDM2. (A) 293T cells were cotransfected with pFLAG-CMV2-HBx and either pEF-His-NEDD8 or pEF-His-SUMO2. Cell lysates were harvested for His-pulldown assay. (B) 293T cells were transfected with pFLAG-CMV2-HBx for 24 h and then treated with MLN4924 (1 μΜ) for 24 h. The cell lysates were collected for immunoprecipitation assay. (C) 293T cells were cotransfected with pCMV-Myc-HBx and pFLAG-CMV2-ubc9 or pFLAG-CMV2-ubc12. The cell lysates were harvested for immunoprecipitation assay. (D) 293T cells were transfected with pCMV-Myc-RBX1, pCMV-Myc-TRIM40, pCMV-Myc-SCCRO, pCMV-Myc-XIAP, pCMV-Myc-HDM2, pCMV-Myc-c-Cbl, and pCMV-Myc-RNF111 expression plasmids, together with pEF-His-NEDD8. The cell lysates were harvested for His-pulldown assay. (E) 293T cells were transfected with pFLAG-CMV2-HBx and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h. The cell lysates were collected for immunoprecipitation assay with the indicated antibodies. (F) 293T cells were transfected with pFLAG-CMV2-HBx, pEF-His-NEDD8, and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h. The cell lysates were harvested for His-pulldown assay, followed by immunoblotting with anti-FLAG antibody. (G) 293T cells were transfected with pFLAG-CMV2-HBx, pEF-His-NEDD8 and si-control or si-HDM2 targeting endogenous HDM2 with or without pCMV-Myc-HDM2 cotransfection. The cell lysates were harvested for His-pulldown assay. (H) 293T cells were transfected with pCMV-Myc-HBx, pEF-His-NEDD8, and either pFLAG-CMV2-NEDP1 or pFLAG-CMV2-CSN5, and then the cell lysates were collected for His-pulldown assay. (I) 293T cells were transfected with pCMV-Myc-HBx, pEF-His-NEDD8, and either pFLAG-CMV2-NEDP1 or pFLAG-CMV2-NEDP1-C163S mutant. The cell lysates were harvested for His-pulldown assay. TCL, total cell lysate.
    Figure Legend Snippet: HBx is specifically NEDDylated by HDM2. (A) 293T cells were cotransfected with pFLAG-CMV2-HBx and either pEF-His-NEDD8 or pEF-His-SUMO2. Cell lysates were harvested for His-pulldown assay. (B) 293T cells were transfected with pFLAG-CMV2-HBx for 24 h and then treated with MLN4924 (1 μΜ) for 24 h. The cell lysates were collected for immunoprecipitation assay. (C) 293T cells were cotransfected with pCMV-Myc-HBx and pFLAG-CMV2-ubc9 or pFLAG-CMV2-ubc12. The cell lysates were harvested for immunoprecipitation assay. (D) 293T cells were transfected with pCMV-Myc-RBX1, pCMV-Myc-TRIM40, pCMV-Myc-SCCRO, pCMV-Myc-XIAP, pCMV-Myc-HDM2, pCMV-Myc-c-Cbl, and pCMV-Myc-RNF111 expression plasmids, together with pEF-His-NEDD8. The cell lysates were harvested for His-pulldown assay. (E) 293T cells were transfected with pFLAG-CMV2-HBx and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h. The cell lysates were collected for immunoprecipitation assay with the indicated antibodies. (F) 293T cells were transfected with pFLAG-CMV2-HBx, pEF-His-NEDD8, and either pCMV-Myc-HDM2 or pCMV-Myc-HDM2-C464A for 48 h. The cell lysates were harvested for His-pulldown assay, followed by immunoblotting with anti-FLAG antibody. (G) 293T cells were transfected with pFLAG-CMV2-HBx, pEF-His-NEDD8 and si-control or si-HDM2 targeting endogenous HDM2 with or without pCMV-Myc-HDM2 cotransfection. The cell lysates were harvested for His-pulldown assay. (H) 293T cells were transfected with pCMV-Myc-HBx, pEF-His-NEDD8, and either pFLAG-CMV2-NEDP1 or pFLAG-CMV2-CSN5, and then the cell lysates were collected for His-pulldown assay. (I) 293T cells were transfected with pCMV-Myc-HBx, pEF-His-NEDD8, and either pFLAG-CMV2-NEDP1 or pFLAG-CMV2-NEDP1-C163S mutant. The cell lysates were harvested for His-pulldown assay. TCL, total cell lysate.

    Techniques Used: Transfection, Immunoprecipitation, Expressing, Cotransfection, Mutagenesis

    38) Product Images from "Agnoprotein of polyomavirus BK interacts with proliferating cell nuclear antigen and inhibits DNA replication"

    Article Title: Agnoprotein of polyomavirus BK interacts with proliferating cell nuclear antigen and inhibits DNA replication

    Journal: Virology Journal

    doi: 10.1186/s12985-014-0220-1

    BKPyV agnoprotein and PCNA interact in vitro and in vivo. (A) In vitro pull down experiment shows direct interaction between PCNA and agnoprotein. Purified agnoprotein, PCNA or GST-PCNA fusion protein were incubated alone or together in PBS (buffer) or with lysate of HEK293 cells (cell lysate) at 4°C for 1 h. Complexes were immunoprecipitated with PCNA antibodies (IP:anti-PCNA; lanes 1–12) or with antibodies against agnoprotein (IP:anti-agno; lanes 13–24). Samples were run on gel and western blot was performed with antibodies against PCNA (WB:anti-PCNA) or against agnoprotein (WB: anti-agno) as indicated. I = input, P = precipitate. The position of GST-agno, agnoprotein, GST-PCNA, purified PCNA and endogenous PCNA are indicated by arrows. The arrow with dashed line probably represents agnoprotein dimers (see also Figure 2 B). (B) Co-immunoprecipitation of agnoprotein and PCNA. HEK293 cells were transfected with following plasmids: lanes 1 and 2: pRcCMV-agno plus pFLAG-CMV-2-PCNA, lanes 3 and 4: pRcCMV-agno plus pFLAG-CMV-2, lanes 5 and 6: pRcCMV plus pFLAG-CMV-2. Lanes 1, 3, and 5: input; lanes 2, 4, and 6: immunoprecipitates (IP). Protein complexes were precipitated with antibodies against PCNA and the presence of polδ, PCNA and agnoprotein was examined with antibodies against these proteins. (C) FRET measurements of the interaction between ECFP-PCNA (donor) and EYFP-agnoprotein (acceptor) fusion proteins in A375 cells by acceptor photo bleaching. FRET efficiency (FRET signal %) is calculated by fluorescence before (prebleach) and after bleaching (postbleach) and shown by the colour code bar. Control experiments with ECFP plus EYFP-agno and ECFP-PCNA plus EYFP were included.
    Figure Legend Snippet: BKPyV agnoprotein and PCNA interact in vitro and in vivo. (A) In vitro pull down experiment shows direct interaction between PCNA and agnoprotein. Purified agnoprotein, PCNA or GST-PCNA fusion protein were incubated alone or together in PBS (buffer) or with lysate of HEK293 cells (cell lysate) at 4°C for 1 h. Complexes were immunoprecipitated with PCNA antibodies (IP:anti-PCNA; lanes 1–12) or with antibodies against agnoprotein (IP:anti-agno; lanes 13–24). Samples were run on gel and western blot was performed with antibodies against PCNA (WB:anti-PCNA) or against agnoprotein (WB: anti-agno) as indicated. I = input, P = precipitate. The position of GST-agno, agnoprotein, GST-PCNA, purified PCNA and endogenous PCNA are indicated by arrows. The arrow with dashed line probably represents agnoprotein dimers (see also Figure 2 B). (B) Co-immunoprecipitation of agnoprotein and PCNA. HEK293 cells were transfected with following plasmids: lanes 1 and 2: pRcCMV-agno plus pFLAG-CMV-2-PCNA, lanes 3 and 4: pRcCMV-agno plus pFLAG-CMV-2, lanes 5 and 6: pRcCMV plus pFLAG-CMV-2. Lanes 1, 3, and 5: input; lanes 2, 4, and 6: immunoprecipitates (IP). Protein complexes were precipitated with antibodies against PCNA and the presence of polδ, PCNA and agnoprotein was examined with antibodies against these proteins. (C) FRET measurements of the interaction between ECFP-PCNA (donor) and EYFP-agnoprotein (acceptor) fusion proteins in A375 cells by acceptor photo bleaching. FRET efficiency (FRET signal %) is calculated by fluorescence before (prebleach) and after bleaching (postbleach) and shown by the colour code bar. Control experiments with ECFP plus EYFP-agno and ECFP-PCNA plus EYFP were included.

    Techniques Used: In Vitro, In Vivo, Purification, Incubation, Immunoprecipitation, Western Blot, Transfection, Fluorescence

    39) Product Images from "Akt/Protein Kinase B-Dependent Phosphorylation and Inactivation of WEE1Hu Promote Cell Cycle Progression at G2/M Transition"

    Article Title: Akt/Protein Kinase B-Dependent Phosphorylation and Inactivation of WEE1Hu Promote Cell Cycle Progression at G2/M Transition

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.25.13.5725-5737.2005

    WEE1Hu phosphorylation at Ser 642 during late S to G 2 phase. 293T cells were transfected with the pFLAG-CMV-2 vector encoding ΔN214-WEE1Hu. After transfection for 24 h, the cells were treated with 1 μg/ml of aphidicolin for 24 h. Then, the cells were washed with PBS and changed to complete growth medium. Cells were harvested at the indicated time after the release. One-third of the cells were analyzed using a flow cytometer (right panel), and the others were analyzed by immunoprecipitation with an anti-FLAG agarose, following immunoblot analysis with an anti-phospho-Ser/Thr Akt substrate antibody or an anti-FLAG antibody (left, top and second panels, respectively). The expression level of endogenous WEE1Hu (endo-WEE1Hu), phosphorylated Cdc2 (Tyr 15 ), Cdc2, cyclin B1, cyclin A, and β-actin was confirmed by immunoblot analysis with the indicated antibodies (left, from third to bottom panels).
    Figure Legend Snippet: WEE1Hu phosphorylation at Ser 642 during late S to G 2 phase. 293T cells were transfected with the pFLAG-CMV-2 vector encoding ΔN214-WEE1Hu. After transfection for 24 h, the cells were treated with 1 μg/ml of aphidicolin for 24 h. Then, the cells were washed with PBS and changed to complete growth medium. Cells were harvested at the indicated time after the release. One-third of the cells were analyzed using a flow cytometer (right panel), and the others were analyzed by immunoprecipitation with an anti-FLAG agarose, following immunoblot analysis with an anti-phospho-Ser/Thr Akt substrate antibody or an anti-FLAG antibody (left, top and second panels, respectively). The expression level of endogenous WEE1Hu (endo-WEE1Hu), phosphorylated Cdc2 (Tyr 15 ), Cdc2, cyclin B1, cyclin A, and β-actin was confirmed by immunoblot analysis with the indicated antibodies (left, from third to bottom panels).

    Techniques Used: Transfection, Plasmid Preparation, Flow Cytometry, Cytometry, Immunoprecipitation, Expressing

    Overexpression of Akt together with 14-3-3θ overcomes the WEE1Hu-induced G 2 /M arrest. (A) 293T cells were cotransfected with the pFLAG-CMV-2 vector alone (a) or encoding wild-type WEE1Hu (b to e) and the pHM6 vector alone (a to c) or encoding 14-3-3θ (d and e) together with the pUSEamp vector not encoding Myr-Akt (a, b, and d) or encoding Myr-Akt (c and e). To monitor the transfected cells, all cells were simultaneously transfected with the pcDNA3 vector encoding Aggrus as a cell surface marker. The cells were harvested 48 h posttransfection. The Aggrus proteins were detected by staining with a rat monoclonal anti-Aggrus antibody and a fluorescein isothiocyanate-conjugated anti-rat antibody. Nuclei were also detected by staining with propidium iodide, and the cells were analyzed using a flow cytometer. (B) 293T cells were transfected as for panel A. Cell lysates were subjected to immunoblot analysis with the indicated antibodies.
    Figure Legend Snippet: Overexpression of Akt together with 14-3-3θ overcomes the WEE1Hu-induced G 2 /M arrest. (A) 293T cells were cotransfected with the pFLAG-CMV-2 vector alone (a) or encoding wild-type WEE1Hu (b to e) and the pHM6 vector alone (a to c) or encoding 14-3-3θ (d and e) together with the pUSEamp vector not encoding Myr-Akt (a, b, and d) or encoding Myr-Akt (c and e). To monitor the transfected cells, all cells were simultaneously transfected with the pcDNA3 vector encoding Aggrus as a cell surface marker. The cells were harvested 48 h posttransfection. The Aggrus proteins were detected by staining with a rat monoclonal anti-Aggrus antibody and a fluorescein isothiocyanate-conjugated anti-rat antibody. Nuclei were also detected by staining with propidium iodide, and the cells were analyzed using a flow cytometer. (B) 293T cells were transfected as for panel A. Cell lysates were subjected to immunoblot analysis with the indicated antibodies.

    Techniques Used: Over Expression, Plasmid Preparation, Transfection, Marker, Staining, Flow Cytometry, Cytometry

    40) Product Images from "Expression and characterization of novel ovine orthologs of bovine placental prolactin-related proteins"

    Article Title: Expression and characterization of novel ovine orthologs of bovine placental prolactin-related proteins

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-8-95

    Expression of oPRP1 and oPRP2 mRNA in ovine tissues . Heart, liver, lung, spleen, kidney and endometrium were used for RT-PCR. Cotyledonary tissue at Day 45 of gestation was used as a placental sample. GAPDH expression in each tissue is presented as a control.
    Figure Legend Snippet: Expression of oPRP1 and oPRP2 mRNA in ovine tissues . Heart, liver, lung, spleen, kidney and endometrium were used for RT-PCR. Cotyledonary tissue at Day 45 of gestation was used as a placental sample. GAPDH expression in each tissue is presented as a control.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    Western blot analysis of recombinant FLAG-tag fusion oPRP2 protein . Conditioned media from HEK 293 cells transiently transfected with each gene were collected, and the purified proteins (1 ng) were loaded on to separate lanes. The proteins were separated by SDS-PAGE and specific proteins were detected by Western blot analysis using an anti-FLAG antibody. MW Marker: molecular weight marker.
    Figure Legend Snippet: Western blot analysis of recombinant FLAG-tag fusion oPRP2 protein . Conditioned media from HEK 293 cells transiently transfected with each gene were collected, and the purified proteins (1 ng) were loaded on to separate lanes. The proteins were separated by SDS-PAGE and specific proteins were detected by Western blot analysis using an anti-FLAG antibody. MW Marker: molecular weight marker.

    Techniques Used: Western Blot, Recombinant, FLAG-tag, Transfection, Purification, SDS Page, Marker, Molecular Weight

    QPCR analysis of (A) oPRP1 and (B) oPRP2 mRNA in ovine placenta . Total sheep RNA was extracted from PTM and ICOT on Day 45 (early), Day 95 (middle) and Day 135 (late) of gestation. Expression of these mRNAs was normalized to the expression of GAPDH measured in the corresponding RNA preparation. Values are means ± SEM. Values with different letters (a, b, c and d) are significantly different ( P
    Figure Legend Snippet: QPCR analysis of (A) oPRP1 and (B) oPRP2 mRNA in ovine placenta . Total sheep RNA was extracted from PTM and ICOT on Day 45 (early), Day 95 (middle) and Day 135 (late) of gestation. Expression of these mRNAs was normalized to the expression of GAPDH measured in the corresponding RNA preparation. Values are means ± SEM. Values with different letters (a, b, c and d) are significantly different ( P

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Lactogenic activity of oPRP2 and bPRP1 . Nb2 lymphoma cell proliferation and PRP dosage are shown. oPRL and bPL were used as positive controls. Values are means ± SD.
    Figure Legend Snippet: Lactogenic activity of oPRP2 and bPRP1 . Nb2 lymphoma cell proliferation and PRP dosage are shown. oPRL and bPL were used as positive controls. Values are means ± SD.

    Techniques Used: Activity Assay

    Comparison of amino acid sequences of oPRP1 and oPRP2 with phylogenetically neighbouring PRPs . Residues identical to oPRP1 and oPRP2 are shown by black hyphens, residues present only in oPRP2 by pink hyphens, and residues present only in oPRP1 by blue hyphens. The sequence gaps are shown by dots. The amino acid sequences were aligned with the help of Clustal W 1.83 on the DDBJ web site. The arrow indicates the putative primary cleavage site of the signal peptide of oPRP1 or oPRP2. The potential N -glycosylation site is underlined in purple.
    Figure Legend Snippet: Comparison of amino acid sequences of oPRP1 and oPRP2 with phylogenetically neighbouring PRPs . Residues identical to oPRP1 and oPRP2 are shown by black hyphens, residues present only in oPRP2 by pink hyphens, and residues present only in oPRP1 by blue hyphens. The sequence gaps are shown by dots. The amino acid sequences were aligned with the help of Clustal W 1.83 on the DDBJ web site. The arrow indicates the putative primary cleavage site of the signal peptide of oPRP1 or oPRP2. The potential N -glycosylation site is underlined in purple.

    Techniques Used: Sequencing

    The predicted 3D structures of mature (A) oPRP1 and (B) oPRP2 proteins . The 3D structures were predicted by FAMS software. The oPRP1 structure was constructed in the Pro40-His178 region. The oPRP2 structure was constructed in the Pro40-Ile234 region. Disulfide bonds are shown as light green solid lines, predicted disulfide bonds as light green dotted lines. N -GLY indicates the potential N -glycosylation site.
    Figure Legend Snippet: The predicted 3D structures of mature (A) oPRP1 and (B) oPRP2 proteins . The 3D structures were predicted by FAMS software. The oPRP1 structure was constructed in the Pro40-His178 region. The oPRP2 structure was constructed in the Pro40-Ile234 region. Disulfide bonds are shown as light green solid lines, predicted disulfide bonds as light green dotted lines. N -GLY indicates the potential N -glycosylation site.

    Techniques Used: Software, Construct

    Localization of oPRP1 and oPRP2 in ovine placentome on Day 45 of gestation . (A, B) oPRP1 and (C, D) oPRP2 mRNAs were detected by in situ hybridization. (A, C) DIG-labeled anti-sense cRNA probes were used. (B, D) DIG-labeled sense cRNA probes were used. Seven micrometer sections of ovine placentome were hybridized with each probe. Scale bars = 100 μm (main areas in A, B, C and D) and 4 μm (right upper areas in A and C).
    Figure Legend Snippet: Localization of oPRP1 and oPRP2 in ovine placentome on Day 45 of gestation . (A, B) oPRP1 and (C, D) oPRP2 mRNAs were detected by in situ hybridization. (A, C) DIG-labeled anti-sense cRNA probes were used. (B, D) DIG-labeled sense cRNA probes were used. Seven micrometer sections of ovine placentome were hybridized with each probe. Scale bars = 100 μm (main areas in A, B, C and D) and 4 μm (right upper areas in A and C).

    Techniques Used: In Situ Hybridization, Labeling

    The stop codon region of PRPs mRNA . oPRP2 , bPRP1 and cPRP1 have a stop codon 717 bp from the CDS start site. In oPRP1 the stop codon is shifted to 540 bp from the CDS start. The shaded boxes indicate the stop codon. The sequence gaps are shown by dots.
    Figure Legend Snippet: The stop codon region of PRPs mRNA . oPRP2 , bPRP1 and cPRP1 have a stop codon 717 bp from the CDS start site. In oPRP1 the stop codon is shifted to 540 bp from the CDS start. The shaded boxes indicate the stop codon. The sequence gaps are shown by dots.

    Techniques Used: Sequencing

    Related Articles

    In Vitro:

    Article Title: Linking Ras to myosin function: RasGEF Q, a Dictyostelium exchange factor for RasB, affects myosin II functions
    Article Snippet: .. In vitro binding assays with GST fusion protein and analysis of cAMP-induced activation of RasB For interaction with cytoskeletal proteins, 5 × 107 AX2 cells were lysed in lysis buffer (LB; 25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, and 1 mM DTT, supplemented with protease inhibitors [Sigma-Aldrich] with 5 mM ATP added) with or without a preincubation with 10 μM Lat A (Sigma-Aldrich for 1 h) and incubated with equal amounts of GST-GEF bound to beads for 3 h at 4°C. .. Beads were washed with wash buffer (25 mM Tris/HCl, pH 7.5, 150 mM NaCl, and 5 mM EDTA) and the pulldown eluates were analyzed in Western blots.

    Construct:

    Article Title: Analysis of Novel Iron-Regulated, Surface-Anchored Hemin-Binding Proteins in Corynebacterium diphtheriae
    Article Snippet: .. Plasmid constructs that expressed the N-terminally Strep-tagged proteins ChtA, ChtA CR, ChtA C-terminal region, ChtB, and ChtC were constructed using the pET24a vector (Novagen). .. PCR-derived DNA fragments harboring the gene of interest were initially cloned into the pCR-Blunt II-TOPO vector and subsequently ligated into the NdeI and EcoRI sites of pET24a.

    Purification:

    Article Title: Catabolic Repression of secB Expression Is Positively Controlled by Cyclic AMP (cAMP) Receptor Protein-cAMP Complexes at the Transcriptional Level
    Article Snippet: .. 32 P-labeled DNA fragments and purified CRP proteins were incubated in binding buffer (10 mM Tris-HCl [pH 7.8], 50 mM KCl, 1 mM EDTA, 50 μg of bovine serum albumin/ml, 1 mM DTT, 0.05% Nonidet P-40, 50 μM cAMP, 20 μg of salmon sperm DNA [Sigma Chemical Co., St. Louis, Mo. .. Then, 3 μl of loading buffer (binding buffer containing 50% glycerol and 0.1 mg of bromophenol blue/ml) was added, and the samples were immediately loaded on a 5% polyacrylamide gel (Protogel; National Diagnostics), with current applied.

    Article Title: CK2 phosphorylation of the PRH/Hex homeodomain functions as a reversible switch for DNA binding
    Article Snippet: .. Protein phosphorylation and dephosphorylation Purified PRH protein, truncated PRH proteins and PRH mutants (10 ng) were incubated in CK2 phosphorylation buffer (50 mM KCl, 10 mM MgCl2 , 20 mM Tris–HCl pH 7.5, 200 μM ATP) with 100 U CK2 enzyme (500 U/μl Calbiochem) for 30 min at 30°C. .. Dephosphorylation was brought about by incubation of the phosphorylated protein with 10 U of calf alkaline phosphatase (CAP) (6 U/μl Promega) in CAP buffer (50 mM Tris–HCl pH 9.3, 10 mM MgCl2 , 1 mM ZnCl2 , 10 mM spermidine) for 20 min at 25°C.

    Activation Assay:

    Article Title: Linking Ras to myosin function: RasGEF Q, a Dictyostelium exchange factor for RasB, affects myosin II functions
    Article Snippet: .. In vitro binding assays with GST fusion protein and analysis of cAMP-induced activation of RasB For interaction with cytoskeletal proteins, 5 × 107 AX2 cells were lysed in lysis buffer (LB; 25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, and 1 mM DTT, supplemented with protease inhibitors [Sigma-Aldrich] with 5 mM ATP added) with or without a preincubation with 10 μM Lat A (Sigma-Aldrich for 1 h) and incubated with equal amounts of GST-GEF bound to beads for 3 h at 4°C. .. Beads were washed with wash buffer (25 mM Tris/HCl, pH 7.5, 150 mM NaCl, and 5 mM EDTA) and the pulldown eluates were analyzed in Western blots.

    Incubation:

    Article Title: Linking Ras to myosin function: RasGEF Q, a Dictyostelium exchange factor for RasB, affects myosin II functions
    Article Snippet: .. In vitro binding assays with GST fusion protein and analysis of cAMP-induced activation of RasB For interaction with cytoskeletal proteins, 5 × 107 AX2 cells were lysed in lysis buffer (LB; 25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, and 1 mM DTT, supplemented with protease inhibitors [Sigma-Aldrich] with 5 mM ATP added) with or without a preincubation with 10 μM Lat A (Sigma-Aldrich for 1 h) and incubated with equal amounts of GST-GEF bound to beads for 3 h at 4°C. .. Beads were washed with wash buffer (25 mM Tris/HCl, pH 7.5, 150 mM NaCl, and 5 mM EDTA) and the pulldown eluates were analyzed in Western blots.

    Article Title: Development of a Biological Scaffold Engineered Using the Extracellular Matrix Secreted by Skeletal Muscle Cells
    Article Snippet: .. To visualize accumulated ECM proteins within DSM and eECM samples, mounted sections were immune-reacted for the presence of collagen type I (αrat collagen 1, mouse IgG1, 750:1, Sigma, St. Louis MO) and cellular fibronectin (αrat cellular fibronectin, mouse IgM, 400:1, Sigma, St. Louis MO) followed by incubation with the appropriate fluorescently labeled secondary antibodies (500:1, Invitrogen, Carlsbad, CA). .. Sections were counterstained with the nuclear staining reagent DAPI, and then microscopically imaged.

    Article Title: Catabolic Repression of secB Expression Is Positively Controlled by Cyclic AMP (cAMP) Receptor Protein-cAMP Complexes at the Transcriptional Level
    Article Snippet: .. 32 P-labeled DNA fragments and purified CRP proteins were incubated in binding buffer (10 mM Tris-HCl [pH 7.8], 50 mM KCl, 1 mM EDTA, 50 μg of bovine serum albumin/ml, 1 mM DTT, 0.05% Nonidet P-40, 50 μM cAMP, 20 μg of salmon sperm DNA [Sigma Chemical Co., St. Louis, Mo. .. Then, 3 μl of loading buffer (binding buffer containing 50% glycerol and 0.1 mg of bromophenol blue/ml) was added, and the samples were immediately loaded on a 5% polyacrylamide gel (Protogel; National Diagnostics), with current applied.

    Article Title: CK2 phosphorylation of the PRH/Hex homeodomain functions as a reversible switch for DNA binding
    Article Snippet: .. Protein phosphorylation and dephosphorylation Purified PRH protein, truncated PRH proteins and PRH mutants (10 ng) were incubated in CK2 phosphorylation buffer (50 mM KCl, 10 mM MgCl2 , 20 mM Tris–HCl pH 7.5, 200 μM ATP) with 100 U CK2 enzyme (500 U/μl Calbiochem) for 30 min at 30°C. .. Dephosphorylation was brought about by incubation of the phosphorylated protein with 10 U of calf alkaline phosphatase (CAP) (6 U/μl Promega) in CAP buffer (50 mM Tris–HCl pH 9.3, 10 mM MgCl2 , 1 mM ZnCl2 , 10 mM spermidine) for 20 min at 25°C.

    Labeling:

    Article Title: Development of a Biological Scaffold Engineered Using the Extracellular Matrix Secreted by Skeletal Muscle Cells
    Article Snippet: .. To visualize accumulated ECM proteins within DSM and eECM samples, mounted sections were immune-reacted for the presence of collagen type I (αrat collagen 1, mouse IgG1, 750:1, Sigma, St. Louis MO) and cellular fibronectin (αrat cellular fibronectin, mouse IgM, 400:1, Sigma, St. Louis MO) followed by incubation with the appropriate fluorescently labeled secondary antibodies (500:1, Invitrogen, Carlsbad, CA). .. Sections were counterstained with the nuclear staining reagent DAPI, and then microscopically imaged.

    De-Phosphorylation Assay:

    Article Title: CK2 phosphorylation of the PRH/Hex homeodomain functions as a reversible switch for DNA binding
    Article Snippet: .. Protein phosphorylation and dephosphorylation Purified PRH protein, truncated PRH proteins and PRH mutants (10 ng) were incubated in CK2 phosphorylation buffer (50 mM KCl, 10 mM MgCl2 , 20 mM Tris–HCl pH 7.5, 200 μM ATP) with 100 U CK2 enzyme (500 U/μl Calbiochem) for 30 min at 30°C. .. Dephosphorylation was brought about by incubation of the phosphorylated protein with 10 U of calf alkaline phosphatase (CAP) (6 U/μl Promega) in CAP buffer (50 mM Tris–HCl pH 9.3, 10 mM MgCl2 , 1 mM ZnCl2 , 10 mM spermidine) for 20 min at 25°C.

    Staining:

    Article Title: An in silico model of the ubiquitin-proteasome system that incorporates normal homeostasis and age-related decline
    Article Snippet: .. The membranes were autoclaved on a liquid cycle for 45 minutes to enhance the detection of poly-ubiquitinated proteins, stained with Ponceau S (Sigma, St. Louis, Missouri, USA) and analyzed by western blotting with the indicated antibody. .. The proteins were visualized by a horseradish peroxidase method using the ECL kit from Kirkegaard and Perry Laboratories Inc., Gaithersburg, Maryland, USA.

    Western Blot:

    Article Title: An in silico model of the ubiquitin-proteasome system that incorporates normal homeostasis and age-related decline
    Article Snippet: .. The membranes were autoclaved on a liquid cycle for 45 minutes to enhance the detection of poly-ubiquitinated proteins, stained with Ponceau S (Sigma, St. Louis, Missouri, USA) and analyzed by western blotting with the indicated antibody. .. The proteins were visualized by a horseradish peroxidase method using the ECL kit from Kirkegaard and Perry Laboratories Inc., Gaithersburg, Maryland, USA.

    Lysis:

    Article Title: Linking Ras to myosin function: RasGEF Q, a Dictyostelium exchange factor for RasB, affects myosin II functions
    Article Snippet: .. In vitro binding assays with GST fusion protein and analysis of cAMP-induced activation of RasB For interaction with cytoskeletal proteins, 5 × 107 AX2 cells were lysed in lysis buffer (LB; 25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, and 1 mM DTT, supplemented with protease inhibitors [Sigma-Aldrich] with 5 mM ATP added) with or without a preincubation with 10 μM Lat A (Sigma-Aldrich for 1 h) and incubated with equal amounts of GST-GEF bound to beads for 3 h at 4°C. .. Beads were washed with wash buffer (25 mM Tris/HCl, pH 7.5, 150 mM NaCl, and 5 mM EDTA) and the pulldown eluates were analyzed in Western blots.

    Binding Assay:

    Article Title: Linking Ras to myosin function: RasGEF Q, a Dictyostelium exchange factor for RasB, affects myosin II functions
    Article Snippet: .. In vitro binding assays with GST fusion protein and analysis of cAMP-induced activation of RasB For interaction with cytoskeletal proteins, 5 × 107 AX2 cells were lysed in lysis buffer (LB; 25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, and 1 mM DTT, supplemented with protease inhibitors [Sigma-Aldrich] with 5 mM ATP added) with or without a preincubation with 10 μM Lat A (Sigma-Aldrich for 1 h) and incubated with equal amounts of GST-GEF bound to beads for 3 h at 4°C. .. Beads were washed with wash buffer (25 mM Tris/HCl, pH 7.5, 150 mM NaCl, and 5 mM EDTA) and the pulldown eluates were analyzed in Western blots.

    Article Title: Catabolic Repression of secB Expression Is Positively Controlled by Cyclic AMP (cAMP) Receptor Protein-cAMP Complexes at the Transcriptional Level
    Article Snippet: .. 32 P-labeled DNA fragments and purified CRP proteins were incubated in binding buffer (10 mM Tris-HCl [pH 7.8], 50 mM KCl, 1 mM EDTA, 50 μg of bovine serum albumin/ml, 1 mM DTT, 0.05% Nonidet P-40, 50 μM cAMP, 20 μg of salmon sperm DNA [Sigma Chemical Co., St. Louis, Mo. .. Then, 3 μl of loading buffer (binding buffer containing 50% glycerol and 0.1 mg of bromophenol blue/ml) was added, and the samples were immediately loaded on a 5% polyacrylamide gel (Protogel; National Diagnostics), with current applied.

    SDS Page:

    Article Title: The phosphoinositide phosphatase Sac1 regulates cell shape and microtubule stability in the developing Drosophila eye
    Article Snippet: .. Flag-tagged Sac1 proteins were analyzed by SDS page and immunoblotting (1:1000) using mouse monoclonal anti-Flag M2 antiserum (Sigma-Aldrich F3165). .. Anti-GAPDH antibody (1:1000; Abcam, ab9485) was used as the loading control.

    Plasmid Preparation:

    Article Title: Analysis of Novel Iron-Regulated, Surface-Anchored Hemin-Binding Proteins in Corynebacterium diphtheriae
    Article Snippet: .. Plasmid constructs that expressed the N-terminally Strep-tagged proteins ChtA, ChtA CR, ChtA C-terminal region, ChtB, and ChtC were constructed using the pET24a vector (Novagen). .. PCR-derived DNA fragments harboring the gene of interest were initially cloned into the pCR-Blunt II-TOPO vector and subsequently ligated into the NdeI and EcoRI sites of pET24a.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore cytoplasmic expression
    Cytoplasmic Expression, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cytoplasmic expression/product/Millipore
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    cytoplasmic expression - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    84
    Millipore pflag myc cmv 20 expression vector
    Pflag Myc Cmv 20 Expression Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pflag myc cmv 20 expression vector/product/Millipore
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pflag myc cmv 20 expression vector - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    Image Search Results