Structured Review

Millipore pet 28a
Induction of MazFSa and MazESa in E. coli . The sectors of the plates show different concentrations of IPTG (0, 0.1, and 1 mM), which induces the expression of His6 -tagged MazFSa , and the rows of the plates show different concentrations of arabinose (0 and 0.2%), which induces the expression of MazESa . The upper half of each plate contains three different clones, which contain both vectors <t>(pET-28a</t> and pBAD) as a control. The lower half of each plate contains three different clones, which contain both pET-28a-MazFSa and pBAD-MazESa .
Pet 28a, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 703 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet 28a/product/Millipore
Average 99 stars, based on 703 article reviews
Price from $9.99 to $1999.99
pet 28a - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "Staphylococcus aureus MazF Specifically Cleaves a Pentad Sequence, UACAU, Which Is Unusually Abundant in the mRNA for Pathogenic Adhesive Factor SraP"

Article Title: Staphylococcus aureus MazF Specifically Cleaves a Pentad Sequence, UACAU, Which Is Unusually Abundant in the mRNA for Pathogenic Adhesive Factor SraP

Journal:

doi: 10.1128/JB.01815-08

Induction of MazFSa and MazESa in E. coli . The sectors of the plates show different concentrations of IPTG (0, 0.1, and 1 mM), which induces the expression of His6 -tagged MazFSa , and the rows of the plates show different concentrations of arabinose (0 and 0.2%), which induces the expression of MazESa . The upper half of each plate contains three different clones, which contain both vectors (pET-28a and pBAD) as a control. The lower half of each plate contains three different clones, which contain both pET-28a-MazFSa and pBAD-MazESa .
Figure Legend Snippet: Induction of MazFSa and MazESa in E. coli . The sectors of the plates show different concentrations of IPTG (0, 0.1, and 1 mM), which induces the expression of His6 -tagged MazFSa , and the rows of the plates show different concentrations of arabinose (0 and 0.2%), which induces the expression of MazESa . The upper half of each plate contains three different clones, which contain both vectors (pET-28a and pBAD) as a control. The lower half of each plate contains three different clones, which contain both pET-28a-MazFSa and pBAD-MazESa .

Techniques Used: Expressing, Clone Assay, Positron Emission Tomography

2) Product Images from "Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation"

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation

Journal:

doi: 10.1016/j.pep.2011.12.008

Expression/cloning region of (A) original pET-28a and (B) its modified version, in which a sequence encoding MBP was inserted between the Nde I and the Bam HI sites. This modification allows the vector to be used for MBP fusion expression.
Figure Legend Snippet: Expression/cloning region of (A) original pET-28a and (B) its modified version, in which a sequence encoding MBP was inserted between the Nde I and the Bam HI sites. This modification allows the vector to be used for MBP fusion expression.

Techniques Used: Expressing, Clone Assay, Positron Emission Tomography, Modification, Sequencing, Plasmid Preparation

3) Product Images from "Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea"

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea

Journal: Genetics and Molecular Biology

doi: 10.1590/S1415-475738320150003

SDS-PAGE and Western blot analysis of the expression of recombinant Ifu-Chit2 in E. coli . Lane M: pre-stained protein marker; Lane 1: total protein of cells containing empty vector pET-28a with IPTG induction; Lane 2: total protein of cells containing expression vector pET- 28a-Ifu-chit2 without IPTG induction; Lanes 3–8: total protein of cells containing expression vector pET- 28a-Ifu-chit2 induced by IPTG at 28 °C for 1, 2, 3, 4, 5 and 6 h, respectively; Lane 9: purified recombinant Ifu-Chit2 (50 kDa). Lane 10: total protein of cells containing empty vector pET-28a with IPTG induction; Lane 11: total protein of cells containing expression vector pET- 28a-Ifu-chit2 without IPTG induction; Lane 12: total protein of cells containing expression vector pET- 28a-Ifu-chit2 induced by IPTG at 28 °C for 4 h; Lane13: Purified recombinant Ifu-Chit2.
Figure Legend Snippet: SDS-PAGE and Western blot analysis of the expression of recombinant Ifu-Chit2 in E. coli . Lane M: pre-stained protein marker; Lane 1: total protein of cells containing empty vector pET-28a with IPTG induction; Lane 2: total protein of cells containing expression vector pET- 28a-Ifu-chit2 without IPTG induction; Lanes 3–8: total protein of cells containing expression vector pET- 28a-Ifu-chit2 induced by IPTG at 28 °C for 1, 2, 3, 4, 5 and 6 h, respectively; Lane 9: purified recombinant Ifu-Chit2 (50 kDa). Lane 10: total protein of cells containing empty vector pET-28a with IPTG induction; Lane 11: total protein of cells containing expression vector pET- 28a-Ifu-chit2 without IPTG induction; Lane 12: total protein of cells containing expression vector pET- 28a-Ifu-chit2 induced by IPTG at 28 °C for 4 h; Lane13: Purified recombinant Ifu-Chit2.

Techniques Used: SDS Page, Western Blot, Expressing, Recombinant, Staining, Marker, Plasmid Preparation, Positron Emission Tomography, Purification

4) Product Images from "Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K"

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K

Journal: BMC Microbiology

doi: 10.1186/s12866-018-1309-2

Conversion of vanillin to vanillic acid by VDH. HPLC analysis was used to examine vanillin conversion to vanillic acid by VDH activity in cell-free extracts. A cell-free extract of E. coli harboring pET-28a ( a ) or pET28a/VDH ( b ) was incubated with 1.25 mM vanillin in the presence of 2 mM NAD + for 10 min. HPLC analysis was conducted according to the conditions described in Methods. E. coli strains were cultured for 15 h after IPTG induction
Figure Legend Snippet: Conversion of vanillin to vanillic acid by VDH. HPLC analysis was used to examine vanillin conversion to vanillic acid by VDH activity in cell-free extracts. A cell-free extract of E. coli harboring pET-28a ( a ) or pET28a/VDH ( b ) was incubated with 1.25 mM vanillin in the presence of 2 mM NAD + for 10 min. HPLC analysis was conducted according to the conditions described in Methods. E. coli strains were cultured for 15 h after IPTG induction

Techniques Used: High Performance Liquid Chromatography, Activity Assay, Positron Emission Tomography, Incubation, Cell Culture

5) Product Images from "Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters"

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters

Journal:

doi: 10.1128/JB.00579-08

SDS-PAGE analysis of purified dehydrogenase proteins after Ni + ). Proteins were expressed with a hexahistidine tag from pET-28a. All proteins were free of contamination.
Figure Legend Snippet: SDS-PAGE analysis of purified dehydrogenase proteins after Ni + ). Proteins were expressed with a hexahistidine tag from pET-28a. All proteins were free of contamination.

Techniques Used: SDS Page, Purification, Positron Emission Tomography

6) Product Images from "Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab"

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab

Journal: Frontiers in Immunology

doi: 10.3389/fimmu.2018.00801

Truncated soluble Es Dscam exhibit variation in bacteria-binding ability and loss of the capacity to promote phagocytosis. (A) Schematic diagram of truncated r Es Dscam 4.24,6.19 . The red, green, and blue dotted lines represents the rIg1–2, rIg2–3, and rIg3–4 proteins, respectively. The three domains were expressed in vitro using a prokaryotic expression system (results of the construction, expression, and purification of the recombinant isoforms are shown in Figure S4 in Supplementary Material). (B) Recombinant truncated soluble Es Dscam proteins were analyzed by SDS-PAGE. Three proteins were expressed from the pET-28a (+) vector in Escherichia coli Rosetta (DE) cells and purified by affinity chromatography. (C–E) Quantitative binding of truncated r Es Dscam proteins with bacteria. The binding activity between truncated r Es Dscam proteins and bacteria were detected by ELISA using anti-His-tag antibodies. PBS incubated with microorganisms was used as the control. Absorbance data ( upper panel ) represent the mean ± SD of three independent experiments. Western data ( lower panel ) are representative of two independent repeats. (F) Truncated Es Dscam has slight effect on phagocytosis of bacteria in vitro . Each recombinant protein was incubated with FITC-labeled Staphylococcus aureus and then used to stimulate hemocyte, with r Es Dscam 4.24,6.19 as positive control. Three independent repeats were performed, and results are expressed as the mean ± SD. Data were analyzed by one-way ANOVA and the letters (a, b) presented significant differences ( p
Figure Legend Snippet: Truncated soluble Es Dscam exhibit variation in bacteria-binding ability and loss of the capacity to promote phagocytosis. (A) Schematic diagram of truncated r Es Dscam 4.24,6.19 . The red, green, and blue dotted lines represents the rIg1–2, rIg2–3, and rIg3–4 proteins, respectively. The three domains were expressed in vitro using a prokaryotic expression system (results of the construction, expression, and purification of the recombinant isoforms are shown in Figure S4 in Supplementary Material). (B) Recombinant truncated soluble Es Dscam proteins were analyzed by SDS-PAGE. Three proteins were expressed from the pET-28a (+) vector in Escherichia coli Rosetta (DE) cells and purified by affinity chromatography. (C–E) Quantitative binding of truncated r Es Dscam proteins with bacteria. The binding activity between truncated r Es Dscam proteins and bacteria were detected by ELISA using anti-His-tag antibodies. PBS incubated with microorganisms was used as the control. Absorbance data ( upper panel ) represent the mean ± SD of three independent experiments. Western data ( lower panel ) are representative of two independent repeats. (F) Truncated Es Dscam has slight effect on phagocytosis of bacteria in vitro . Each recombinant protein was incubated with FITC-labeled Staphylococcus aureus and then used to stimulate hemocyte, with r Es Dscam 4.24,6.19 as positive control. Three independent repeats were performed, and results are expressed as the mean ± SD. Data were analyzed by one-way ANOVA and the letters (a, b) presented significant differences ( p

Techniques Used: Binding Assay, In Vitro, Expressing, Purification, Recombinant, SDS Page, Positron Emission Tomography, Plasmid Preparation, Affinity Chromatography, Activity Assay, Enzyme-linked Immunosorbent Assay, Incubation, Western Blot, Labeling, Positive Control

7) Product Images from "Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis"

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis

Journal: PLoS Neglected Tropical Diseases

doi: 10.1371/journal.pntd.0003097

Identification of r Ts -Pt by SDS-PAGE and western blotting. (A) SDS-PAGE analysis of the expression and purification of r Ts -Pt. The gel was stained with Coomassie Brilliant blue. Lane 1, prestained protein marker (Genview); lane 2, E. coli lysate (pET28a) without IPTG; lane 3, E. coli lysate (pET28a) with IPTG; lane 4, E. coli lysate (pET-28a/ Ts -Pt) without IPTG; lane 5, E. coli lysate (pET-28a/ Ts -Pt) with IPTG; lane 6, supernatant of E. coli lysate (pET-28a/ Ts -Pt) with IPTG; lane 7, r Ts -Pt purified by Ni-affinity chromatography. (B) Western blot analysis of the antigenicity of r Ts -Pt. Lane 1, rabbit anti-r Ts -Pt serum; lane 2, negative rabbit serum; lane 3, T. spiralis -infected mice serum; lane 4, negative mice serum. (C) Western blot analysis of the crude somatic extracts and ES products of T. spiralis were recognised by rabbit anti-r Ts -Pt serum. Lane 1, Ad crude somatic extracts; lane 2, Ad ES products; lane 3, NBL crude somatic extracts; lane 4, NBL ES products; lane 5, ML crude somatic extracts; lane 6, ML ES products.
Figure Legend Snippet: Identification of r Ts -Pt by SDS-PAGE and western blotting. (A) SDS-PAGE analysis of the expression and purification of r Ts -Pt. The gel was stained with Coomassie Brilliant blue. Lane 1, prestained protein marker (Genview); lane 2, E. coli lysate (pET28a) without IPTG; lane 3, E. coli lysate (pET28a) with IPTG; lane 4, E. coli lysate (pET-28a/ Ts -Pt) without IPTG; lane 5, E. coli lysate (pET-28a/ Ts -Pt) with IPTG; lane 6, supernatant of E. coli lysate (pET-28a/ Ts -Pt) with IPTG; lane 7, r Ts -Pt purified by Ni-affinity chromatography. (B) Western blot analysis of the antigenicity of r Ts -Pt. Lane 1, rabbit anti-r Ts -Pt serum; lane 2, negative rabbit serum; lane 3, T. spiralis -infected mice serum; lane 4, negative mice serum. (C) Western blot analysis of the crude somatic extracts and ES products of T. spiralis were recognised by rabbit anti-r Ts -Pt serum. Lane 1, Ad crude somatic extracts; lane 2, Ad ES products; lane 3, NBL crude somatic extracts; lane 4, NBL ES products; lane 5, ML crude somatic extracts; lane 6, ML ES products.

Techniques Used: SDS Page, Western Blot, Expressing, Purification, Staining, Marker, Positron Emission Tomography, Affinity Chromatography, Infection, Mouse Assay

8) Product Images from "Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma"

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma

Journal: Parasites & Vectors

doi: 10.1186/s13071-017-2179-4

Expression and identification of r Cs GRN. a r Cs GRN was identified by 12% SDS-PAGE. Protein molecular weight markers (Lane M), lysate of E. coli containing pET-28a (+) without induction (Lane 1) and with induction by IPTG (Lane 2), lysate of E. coli containing pET-28a (+)- Cs GRN without induction (Lane 3) and with induction by IPTG (Lane 4), supernatant (Lane 5) and precipitate (Lane 6) of the lysate of E. coli containing the recombinant plasmid after induction, the purified recombinant Cs GRN protein (Lane 7). b r Cs GRN protein was identified as a component of Cs ESPs. r Cs GRN protein was probed by mouse anti-His-tag serum, rat anti- Cs GRN serum, rat anti- Cs ESPs serum and naïve serum (Lanes 1–4, respectively). In addition, Cs ESPs were probed with rat anti- Cs GRN serum and naïve serum (Lanes 5, 6). Protein molecular weight markers (Lane M)
Figure Legend Snippet: Expression and identification of r Cs GRN. a r Cs GRN was identified by 12% SDS-PAGE. Protein molecular weight markers (Lane M), lysate of E. coli containing pET-28a (+) without induction (Lane 1) and with induction by IPTG (Lane 2), lysate of E. coli containing pET-28a (+)- Cs GRN without induction (Lane 3) and with induction by IPTG (Lane 4), supernatant (Lane 5) and precipitate (Lane 6) of the lysate of E. coli containing the recombinant plasmid after induction, the purified recombinant Cs GRN protein (Lane 7). b r Cs GRN protein was identified as a component of Cs ESPs. r Cs GRN protein was probed by mouse anti-His-tag serum, rat anti- Cs GRN serum, rat anti- Cs ESPs serum and naïve serum (Lanes 1–4, respectively). In addition, Cs ESPs were probed with rat anti- Cs GRN serum and naïve serum (Lanes 5, 6). Protein molecular weight markers (Lane M)

Techniques Used: Expressing, SDS Page, Molecular Weight, Positron Emission Tomography, Recombinant, Plasmid Preparation, Purification

9) Product Images from "Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K"

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K

Journal: BMC Microbiology

doi: 10.1186/s12866-018-1309-2

Conversion of vanillin to vanillic acid by VDH. HPLC analysis was used to examine vanillin conversion to vanillic acid by VDH activity in cell-free extracts. A cell-free extract of E. coli harboring pET-28a ( a ) or pET28a/VDH ( b ) was incubated with 1.25 mM vanillin in the presence of 2 mM NAD + for 10 min. HPLC analysis was conducted according to the conditions described in Methods. E. coli strains were cultured for 15 h after IPTG induction
Figure Legend Snippet: Conversion of vanillin to vanillic acid by VDH. HPLC analysis was used to examine vanillin conversion to vanillic acid by VDH activity in cell-free extracts. A cell-free extract of E. coli harboring pET-28a ( a ) or pET28a/VDH ( b ) was incubated with 1.25 mM vanillin in the presence of 2 mM NAD + for 10 min. HPLC analysis was conducted according to the conditions described in Methods. E. coli strains were cultured for 15 h after IPTG induction

Techniques Used: High Performance Liquid Chromatography, Activity Assay, Positron Emission Tomography, Incubation, Cell Culture

10) Product Images from "Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations"

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations

Journal: BMC Biotechnology

doi: 10.1186/s12896-015-0180-6

Expression of loop-inserted and terminal fusion CCMV constructs in E. coli . ( a ) SDS-PAGE analysis of cell extract (CE) and reassembled VLP pellet (RP) from the M2e(23) loop-inserted CCMV-CP (A 1 ) βB-βC-M2e(23), (A 2 ) βD-βE-M2e(23), (A 3 ) βF-βG-M2e(23) and (A 4 ) βH-βI-M2e(23). ( b ) SDS-PAGE analysis of M2e(7) and M2e(15) within βF-βG (B 1 ,B 3 ) and βH-βI(B 2 , B 4 ) CCMV-CP loops. ( c ) SDS-PAGE (upper panel) and western blot (lower panel) of βF-βG M2e(7)/M2e(15) and βH-βI M2e(7)/M2e(15) detected by monoclonal anti-His-tag and M2e sera, respectively. ( d ) Immunoblot detection of VP1 and 2C fusions to CCMV-CP and NΔ24-CP using polyclonal anti-CCMV serum (D 1 ) and serum from FMDV-infected guinea pig (D 2 ). Induced empty pET-28a and CCMV-CP were used as negative and positive control, respectively. ( e ) Detection of M2e fused to NΔ24CP using polyclonal anti-CCMV (E 1 ) and monoclonal anti-M2e (E 2 ) sera. Molecular size marker is indicated on the left
Figure Legend Snippet: Expression of loop-inserted and terminal fusion CCMV constructs in E. coli . ( a ) SDS-PAGE analysis of cell extract (CE) and reassembled VLP pellet (RP) from the M2e(23) loop-inserted CCMV-CP (A 1 ) βB-βC-M2e(23), (A 2 ) βD-βE-M2e(23), (A 3 ) βF-βG-M2e(23) and (A 4 ) βH-βI-M2e(23). ( b ) SDS-PAGE analysis of M2e(7) and M2e(15) within βF-βG (B 1 ,B 3 ) and βH-βI(B 2 , B 4 ) CCMV-CP loops. ( c ) SDS-PAGE (upper panel) and western blot (lower panel) of βF-βG M2e(7)/M2e(15) and βH-βI M2e(7)/M2e(15) detected by monoclonal anti-His-tag and M2e sera, respectively. ( d ) Immunoblot detection of VP1 and 2C fusions to CCMV-CP and NΔ24-CP using polyclonal anti-CCMV serum (D 1 ) and serum from FMDV-infected guinea pig (D 2 ). Induced empty pET-28a and CCMV-CP were used as negative and positive control, respectively. ( e ) Detection of M2e fused to NΔ24CP using polyclonal anti-CCMV (E 1 ) and monoclonal anti-M2e (E 2 ) sera. Molecular size marker is indicated on the left

Techniques Used: Expressing, Construct, SDS Page, Western Blot, Infection, Positron Emission Tomography, Positive Control, Marker

11) Product Images from "Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis"

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0073989

GPX activity analysis in pET-28a, pET-W69 and pET-W106. (A) SDS-PAGE analysis of the expression of recombinant proteins in E. coli. The complete protein of the bacteria and purified recombinant protein from soluble crude extract were separated by 12% SDS-PAGE and stained with Coomassie Brilliant Blue. M, protein size marker (16–94 kDa). T, total proteins of the bacteria (10 μg); P, purified recombinant proteins (1 μg) from soluble crude extract. (B) Enzyme activities of the GPX isoenzymes were calculated with H 2 O 2 and t-BHP as the substrates. Data are means ±SD of three independent experiments.
Figure Legend Snippet: GPX activity analysis in pET-28a, pET-W69 and pET-W106. (A) SDS-PAGE analysis of the expression of recombinant proteins in E. coli. The complete protein of the bacteria and purified recombinant protein from soluble crude extract were separated by 12% SDS-PAGE and stained with Coomassie Brilliant Blue. M, protein size marker (16–94 kDa). T, total proteins of the bacteria (10 μg); P, purified recombinant proteins (1 μg) from soluble crude extract. (B) Enzyme activities of the GPX isoenzymes were calculated with H 2 O 2 and t-BHP as the substrates. Data are means ±SD of three independent experiments.

Techniques Used: Activity Assay, Positron Emission Tomography, SDS Page, Expressing, Recombinant, Purification, Staining, Marker

12) Product Images from "Functional analysis of apple stem pitting virus coat protein variants"

Article Title: Functional analysis of apple stem pitting virus coat protein variants

Journal: Virology Journal

doi: 10.1186/s12985-019-1126-8

Analysis of recombinant CPs from different ASPV isolates by SDS-PAGE and western blot. a SDS-PAGE analyze of rCPs expressed in E. coli . Lane M: Protein Ladder; Lanes 1–6 and Lane EV (from left to right): protein extracts from E. coli transformed with vectors pET-HB-HN9–3, pET-HB-HN6–8, pET-LN-AP1–1, pET-HB-HN7–18, pET-HB-HN1–3, pET-YN-MRS-17 and the empty vector pET-28a (+), respectively. b-d Western blot analysis of rCPs by antibody PAb-HB-HN6–8, PAb-YN-MRS-17 and PAb-HB-HN9–3, respectively. Hybridization signals on western blots were quantified by Image J software (right column of B-D)
Figure Legend Snippet: Analysis of recombinant CPs from different ASPV isolates by SDS-PAGE and western blot. a SDS-PAGE analyze of rCPs expressed in E. coli . Lane M: Protein Ladder; Lanes 1–6 and Lane EV (from left to right): protein extracts from E. coli transformed with vectors pET-HB-HN9–3, pET-HB-HN6–8, pET-LN-AP1–1, pET-HB-HN7–18, pET-HB-HN1–3, pET-YN-MRS-17 and the empty vector pET-28a (+), respectively. b-d Western blot analysis of rCPs by antibody PAb-HB-HN6–8, PAb-YN-MRS-17 and PAb-HB-HN9–3, respectively. Hybridization signals on western blots were quantified by Image J software (right column of B-D)

Techniques Used: Recombinant, SDS Page, Western Blot, Transformation Assay, Positron Emission Tomography, Plasmid Preparation, Hybridization, Software

13) Product Images from "Development of a keratinase activity assay using recombinant chicken feather keratin substrates"

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates

Journal: PLoS ONE

doi: 10.1371/journal.pone.0172712

Expression and purification of soluble G . gallus β-keratins. (A) Construction of expression vectors for recombinant Chr2_FK4, Chr25_FK25, and Chr27_FK12 β-keratins. (B) SDS-PAGE analysis of recombinant keratins expressed in E . coli , and purification of soluble Chr2_FK4 and Chr27_FK12 β-keratins. Lane M, molecular weight markers; lane 1, E . coli BL21 (DE3); lane 2, E . coli BL21 (DE3) (pET-28a_Chr2); lane 3, E . coli BL21 (DE3) (pET-28a_Chr25); lane 4, E . coli BL21 (DE3) (pET-28a_Chr27); S, supernatant; P, pellet. (C) Transmission electron microscope images of recombinant β-keratins. (D) Quantification of soluble Chr2_FK4 and Chr27_FK12 β-keratins using Kunitz and ninhydrin assays. Linear correlation between the absorbance at 280 nm and the concentration of purified β-keratins.
Figure Legend Snippet: Expression and purification of soluble G . gallus β-keratins. (A) Construction of expression vectors for recombinant Chr2_FK4, Chr25_FK25, and Chr27_FK12 β-keratins. (B) SDS-PAGE analysis of recombinant keratins expressed in E . coli , and purification of soluble Chr2_FK4 and Chr27_FK12 β-keratins. Lane M, molecular weight markers; lane 1, E . coli BL21 (DE3); lane 2, E . coli BL21 (DE3) (pET-28a_Chr2); lane 3, E . coli BL21 (DE3) (pET-28a_Chr25); lane 4, E . coli BL21 (DE3) (pET-28a_Chr27); S, supernatant; P, pellet. (C) Transmission electron microscope images of recombinant β-keratins. (D) Quantification of soluble Chr2_FK4 and Chr27_FK12 β-keratins using Kunitz and ninhydrin assays. Linear correlation between the absorbance at 280 nm and the concentration of purified β-keratins.

Techniques Used: Expressing, Purification, Recombinant, SDS Page, Molecular Weight, Positron Emission Tomography, Transmission Assay, Microscopy, Concentration Assay

14) Product Images from "Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase"

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase

Journal: The Scientific World Journal

doi: 10.1155/2014/973751

Expression and purification of B. abortus MDH and the six mutant forms were identified with SDS-PAGE followed by Coomassie blue staining. (a) SDS-PAGE profiles of the expressed recombinant proteins. Lane M: prestained protein marker (SM0671, Fermentas); lane NC: total cellular proteins of E. coli BL21 transformed with pET-28a. No band of 38 kDa His-MDH was shown. Lane 1: total cellular proteins of E. coli BL21 transformed with expression plasmids pET-28a-MDH. Lanes 2–7: total cellular proteins of E. coli BL21 transformed with pET-28a-derived plasmids containing the mutant forms of the mdh gene, including Arg 89 to Leu mutant, Asp 149 to Val mutant, Arg 152 to Leu mutant, His 176 to Pro mutant, Asp178 to Val mutant, and Thr 231 to Val mutant, respectively. (b) Coomassie blue staining of the expressed recombinant proteins. Lane M: prestained protein marker (SM0671, Fermentas). Lane 1: purified proteins of MDH. Lanes 2–7: purified proteins of mutant forms MDH, including Arg 89 to Leu mutant, Asp 149 to Val mutant, Arg 152 to Leu mutant, His 176 to Pro mutant, Asp178 to Val mutant, and Thr 231 to Val mutant, respectively.
Figure Legend Snippet: Expression and purification of B. abortus MDH and the six mutant forms were identified with SDS-PAGE followed by Coomassie blue staining. (a) SDS-PAGE profiles of the expressed recombinant proteins. Lane M: prestained protein marker (SM0671, Fermentas); lane NC: total cellular proteins of E. coli BL21 transformed with pET-28a. No band of 38 kDa His-MDH was shown. Lane 1: total cellular proteins of E. coli BL21 transformed with expression plasmids pET-28a-MDH. Lanes 2–7: total cellular proteins of E. coli BL21 transformed with pET-28a-derived plasmids containing the mutant forms of the mdh gene, including Arg 89 to Leu mutant, Asp 149 to Val mutant, Arg 152 to Leu mutant, His 176 to Pro mutant, Asp178 to Val mutant, and Thr 231 to Val mutant, respectively. (b) Coomassie blue staining of the expressed recombinant proteins. Lane M: prestained protein marker (SM0671, Fermentas). Lane 1: purified proteins of MDH. Lanes 2–7: purified proteins of mutant forms MDH, including Arg 89 to Leu mutant, Asp 149 to Val mutant, Arg 152 to Leu mutant, His 176 to Pro mutant, Asp178 to Val mutant, and Thr 231 to Val mutant, respectively.

Techniques Used: Expressing, Purification, Mutagenesis, SDS Page, Staining, Recombinant, Marker, Transformation Assay, Positron Emission Tomography, Derivative Assay

15) Product Images from "Purification and Functional Characterization of the C-Terminal Domain of the β-Actin-Binding Protein AIM1 In Vitro"

Article Title: Purification and Functional Characterization of the C-Terminal Domain of the β-Actin-Binding Protein AIM1 In Vitro

Journal: Molecules

doi: 10.3390/molecules23123281

Construction of the pET-28a-psp plasmid and preparation of Prescission Protease. ( A ) The difference between the commercial pET-28a (+) and modified pET-28a_psp vectors. The orange and blue regions are the extra parts of the modified vector. RBS, Ribosomal Binding Site. MCS, Multiple Cloning Site. PSP, Prescission Proteas. ( B ) Map of the pET-28a_psp plasmid. The red region is the site recognized by the Prescission Protease and the position of the 8x His-tag. ( C ) The purity and activity of Prescission Protease were analyzed by SDS-PAGE (15%) and stained by Coomassie Blue.
Figure Legend Snippet: Construction of the pET-28a-psp plasmid and preparation of Prescission Protease. ( A ) The difference between the commercial pET-28a (+) and modified pET-28a_psp vectors. The orange and blue regions are the extra parts of the modified vector. RBS, Ribosomal Binding Site. MCS, Multiple Cloning Site. PSP, Prescission Proteas. ( B ) Map of the pET-28a_psp plasmid. The red region is the site recognized by the Prescission Protease and the position of the 8x His-tag. ( C ) The purity and activity of Prescission Protease were analyzed by SDS-PAGE (15%) and stained by Coomassie Blue.

Techniques Used: Positron Emission Tomography, Plasmid Preparation, Modification, Binding Assay, Clone Assay, Activity Assay, SDS Page, Staining

Related Articles

Clone Assay:

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: To construct FK expression vectors, codon-optimized Chr2_FK4, Chr25_FK12, and Chr27_FK12 genes with overhanging Nde Ι and Xho Ι sites were synthesized by Bioneer Co. (Daejeon, Korea) and cloned into the pBHA vector to yield plasmids pBHA-Chr2_FK4, pBHA-Chr25_FK12, and pBHA-Chr27_FK12. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27.

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: All primer sequences used in this study are listed in Additional file : Table S1 PCR fragments were cloned into the pMD18-T simple vector (TaKaRa, Dalian, China) for sequencing. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I. .. The recombinant expression vectors were named as pET-HB-HN1–3, pET-HB-HN7–18, pET-HB-HN6–8, pET-HB-HN9–3, pET-YN-MRS-17 and pET-LN1-AP-1, respectively.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: The primers were designed according to B. abortus S2308 mdh gene sequence (AM040264.1) with Bam HI and Sal I site (underlined) inserted. .. PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. The resulting plasmids, pET-28a-MDH, was used to transform E. coli BL21.

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations
Article Snippet: In addition a CP construct was generated lacking the first 24 aa (denoted NΔ24-CP), to be tested on the ability to still fold into VLPs and potential future exploitation. .. Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels. .. Polyacrylamide gels were stained with Coomassie brilliant blue and showed the presence of protein bands that were absent from BL21 control cells, and corresponded with the expected sizes of the CCMV CP chimera and NΔ24-CP.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: Paragraph title: Gene cloning, expression and purification of recombinant Cs GRN ... The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega).

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Chromosomal DNA was extracted as described previously [ ]. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression. .. E. coli strains were cultured in Luria-Bertani (LB) broth or on LB agar supplemented with ampicillin (50 μL/mL) or kanamycin (30 μL/mL) when necessary.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: ZIKV was titered by a plaque formation (PFU) assay . .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The cloning primers are presented in .

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Primers used for genotyping PCR are shown as follows: KO screen forward, 5′-GAAACTGAAACTGGGTGTGCTAGGG-3′; KO screen reverse, 5′ CGCCTTCTTGACGAGTTCTTCTGAG-3′; WT screen reverse, 5′-GCCTTCCTTGTCTCTCTCCATAGCG-3′. .. Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: cDNA sequences encoding N -terminally truncated Mina53 (aa 26-465) and NO66 (aa 183-641) were PCR amplified from Mammalian Gene Collection (MGC) (accession no.: BC014928 and BC011350, respectively) and cloned into pNIC28-Bsa4 vector. .. Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Stratagene’s QuickChange site-directed mutagenesis kit was used to make all ROX mutations using the above constructs as templates.

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: Expression vector pET21a (Novagen) containing Bo GH5A (pBoGH5) was used for subsequent cloning of the BACON domain (residues 28-116), the GH5 catalytic domain (residues 117-489), and two active-site mutants, generating pBACON , pCAT , pBoGH5-E430A and pCAT-E430A , respectively. cDNA encoding the BACON and GH5 domains were amplified by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site.

Article Title: A 40 kDa protein of the inner membrane is the mitochondrial calcium uniporter
Article Snippet: - For the cloning of MCU-Flag in pcDNA3.1: fw: 5′-GGTACCGCCACCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-GGAATTCTCACTTATCGTCGTCATCCTTGTAATCTTCCTTTTCTCCGATCTGTC-3′ The PCR fragment was cloned into KpnI and EcoRI sites in pcDNA3.1 (Invitrogen). .. - For the cloning of MCU in pET-28A(+): fw: 5′-AGGATCCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-ACTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into BamHI and XhoI sites in pET-28A(+) (Novagen). .. - For the cloning of MCU deleted of the mitochondrial targeting sequence (aa 1-54) (MCUΔMTS ) in pET-28A(+): fw: 5′-CATATGGCTTCCTGGCAGAGCGTGGG-3′ rv: 5′-CTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into NdeI and XhoI sites in pET-28A(+) (Novagen).

Centrifugation:

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus. .. E. coli cells carrying pET-W69, pET-W106, and PET-28a were grown in 40 ml LB medium containing 50 mg/ml kanamycin at 37°C to D600 = 0.5 and induced with 0.8 mM isopropyl-1-thio-bD-galactopyranoside (IPTG) at 22°C.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. Ifu-Chit2 expression was induced by addition of isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM and cultivation was continued for an additional 6 h at 28°C.

Amplification:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: A PCR fragment representing the extracellular domains of Es Dscam from FNIII3 to FNIII6 was amplified using specific primers (Es Dscam-anti-F and Es Dscam-anti-R; Table ). .. Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA).

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: For generation of different versions of CP constructs, pMD18-T-CP constructs were used as templates for PCR amplification using rTaq DNA polymerase (TaKaRa, Dalian, China). .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: The encoding gene, malate dehydrogenase (mdh ), was amplified by polymerase chain reaction (PCR) using primers MDH-F (5′ CGC GGATCC ATGGCACGCAACAAGATTG 3′) and MDH-R (5′ CGC GTCGAC TTATTTCAGCGACGGAGCA 3′) and subjected to the sequence analysis. .. PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen).

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The two GPX cDNAs were amplified by reverse transcription PCR (RT-PCR) using the primer sets W69-PET ( 5'-TACGGATCCATGGGGGCGTCCGAATCT-3' and 5'-TAGCTCGAGCTTCTGCGAGTCGGAAGATTCC-3' ) and W106-PET ( 5'-TACGGATCCAACATGGGTGCGGCAGAGT-3' and 5'-TAGCTCGAGAACCTCCAACAGCTTCTTGATG-3' ). .. The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus.

Article Title: Purification and Functional Characterization of the C-Terminal Domain of the β-Actin-Binding Protein AIM1 In Vitro
Article Snippet: This domain is only a very small part of the protein, and we are planning to perform further experiments. .. Escherichia coli strains DH5α and BL21 (DE3) were the host strains for amplification and protein expression, respectively. pET-28a (+) was purchased from Novagen company. .. Subcloning of artificial genes encoding g1, g1g2, g1g2g3 and g1g1 were inserted into pET-28a_psp vectors and oligonucleotide primers were synthesized.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 .

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The sense and antisense primers were designed to introduce the ATG initiation codon and TGA stop codon (boldfaced) for VDH production, respectively. .. The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH. .. After verifying the nucleotide sequence of vdh by sequencing, pET28a/VDH was used to transformed E. coli BL21(DE3), and the resulting recombinant strain was used for VDH production.

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: Briefly, knockout constructs of wbpB and wbpE were generated by insertional mutagenesis with a Gm resistance cassette. .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada). .. The wbpB gene was disrupted by insertion of the Gmr cassette from PstI-digested pPS856 into the two internal PstI sites.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: ZIKV was titered by a plaque formation (PFU) assay . .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The cloning primers are presented in .

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: cDNA sequences encoding N -terminally truncated Mina53 (aa 26-465) and NO66 (aa 183-641) were PCR amplified from Mammalian Gene Collection (MGC) (accession no.: BC014928 and BC011350, respectively) and cloned into pNIC28-Bsa4 vector. .. Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Stratagene’s QuickChange site-directed mutagenesis kit was used to make all ROX mutations using the above constructs as templates.

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: The gene fragments corresponding to amino acids 28-519 of SusD-like Bacova_02651 and 34-456 of Bacova_02650 gene products were amplified from B. ovatus genomic DNA by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site.

Article Title: A 40 kDa protein of the inner membrane is the mitochondrial calcium uniporter
Article Snippet: Mouse MCU (NM_001033259) was amplified from mouse skeletal muscle cDNA by PCR using the following primers: - For the cloning in pEGFP-N1: fw: 5′-GAATTCGCCACCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-GGATCCACTTCCTTTTCTCCGATCTGTCG-3′ The PCR fragment was cloned into EcoRI and BamHI sites in pEGFP-N1 (Clontech). .. - For the cloning of MCU in pET-28A(+): fw: 5′-AGGATCCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-ACTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into BamHI and XhoI sites in pET-28A(+) (Novagen).

Synthesized:

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: To construct FK expression vectors, codon-optimized Chr2_FK4, Chr25_FK12, and Chr27_FK12 genes with overhanging Nde Ι and Xho Ι sites were synthesized by Bioneer Co. (Daejeon, Korea) and cloned into the pBHA vector to yield plasmids pBHA-Chr2_FK4, pBHA-Chr25_FK12, and pBHA-Chr27_FK12. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27.

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Plasmids pET-32a and pET-28a were purchased from Novagen. .. TEV protease expression vector pRK793 was obtained from Addgene.

Construct:

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: To construct FK expression vectors, codon-optimized Chr2_FK4, Chr25_FK12, and Chr27_FK12 genes with overhanging Nde Ι and Xho Ι sites were synthesized by Bioneer Co. (Daejeon, Korea) and cloned into the pBHA vector to yield plasmids pBHA-Chr2_FK4, pBHA-Chr25_FK12, and pBHA-Chr27_FK12. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27.

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: For generation of different versions of CP constructs, pMD18-T-CP constructs were used as templates for PCR amplification using rTaq DNA polymerase (TaKaRa, Dalian, China). .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations
Article Snippet: In addition a CP construct was generated lacking the first 24 aa (denoted NΔ24-CP), to be tested on the ability to still fold into VLPs and potential future exploitation. .. Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels. .. Polyacrylamide gels were stained with Coomassie brilliant blue and showed the presence of protein bands that were absent from BL21 control cells, and corresponded with the expected sizes of the CCMV CP chimera and NΔ24-CP.

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis
Article Snippet: Forward ( 5′-TTTTGGATCC ATGGACGCACGTCGGCCGGTAT -3′ , Bam HI site underlined) and reverse primers ( 5′-CCCAAGCTT TCAATATGGTGGAATAGGACAAAGT -3′ , Hind III site underlined) were used to amplify the Ts -Pt gene from cDNA and genomic DNA from larvae. .. The recombinant plasmid was constructed from a linearised pET-28a (+) expression vector (Novagen, Germany) and the target gene. .. DNA sequencing was performed on an automated DNA sequencer. rTs -Pt was expressed from an E. coli Rosetta (DE3) strain after induction with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and the protein was purified by affinity chromatography using a His-Trap purification kit (GE, USA), per the manufacturer's instructions.

Article Title: Staphylococcus aureus MazF Specifically Cleaves a Pentad Sequence, UACAU, Which Is Unusually Abundant in the mRNA for Pathogenic Adhesive Factor SraP
Article Snippet: The E. coli BL21(DE3) strain was used for recombinant protein expression. .. Plasmids pET-28a-MazFSa and pBAD-MazESa were constructed from pET-28a (Novagen) and pBAD to express His6 -tagged MazFSa and MazESa , respectively. .. MazFSa tagged with His6 at the N-terminal end were purified from strain BL21(DE3) carrying pET-28a-MazFSa by using Ni-nitrilotriacetic acid resin (Qiagen) as described previously ( ).

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: Briefly, knockout constructs of wbpB and wbpE were generated by insertional mutagenesis with a Gm resistance cassette. .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada).

Article Title: A 40 kDa protein of the inner membrane is the mitochondrial calcium uniporter
Article Snippet: Paragraph title: Constructs and siRNA ... - For the cloning of MCU in pET-28A(+): fw: 5′-AGGATCCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-ACTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into BamHI and XhoI sites in pET-28A(+) (Novagen).

Enzyme-linked Immunosorbent Assay:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA). .. The fusion protein was purified with Ni-NTA resin (Transgen, China) according to the manufacturer’s instructions.

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Incubation:

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH. .. E. coli BL21(DE3) harboring pET28a/VDH was cultured in LB broth supplemented with 1% glucose and kanamycin (30 μL/mL) at 37 °C.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: After 48 h in liquid culture, 10% of the grown mycelia were transferred to 100 mL of mineral salts medium with yeast extract (MSMYE; 0.01% (NH4 )2 SO4 , 0.01% NaCl, 0.02% MgSO4 ·7H2 O, 0.001% CaCl2 , 0.05% KH2 PO4 , 0.1% K2 HPO4 , and 0.05% yeast extract, pH 7.2) [ ] supplemented with 3.6 mM ferulic acid as the sole carbon source, and incubated for an appropriate time at 30 °C. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression.

Infection:

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: ZIKV was titered by a plaque formation (PFU) assay . .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The cloning primers are presented in .

Activity Assay:

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: Based on phylogenetic analysis of the ASPV CP gene in our previous study [ ], unique CP sequences (clones) from five pear and one apple ASPV isolates (HB-HN1–3, HB-HN7–18, HB-HN6–8, HB-HN9–3, YN-MRS-17 and LN-AP-1) were selected to produce recombinant proteins to be used for analysis of electrophoretic mobility, serological reactivity and VSR activity. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Cell Culture:

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH. .. After verifying the nucleotide sequence of vdh by sequencing, pET28a/VDH was used to transformed E. coli BL21(DE3), and the resulting recombinant strain was used for VDH production.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: To isolate chromosomal DNA, bacteria were cultured in YEME medium supplemented with 17% sucrose and 0.5% glycine. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression.

Expressing:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: Paragraph title: Recombinant Expression, Purification, and Antiserum Production ... Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA).

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: To construct FK expression vectors, codon-optimized Chr2_FK4, Chr25_FK12, and Chr27_FK12 genes with overhanging Nde Ι and Xho Ι sites were synthesized by Bioneer Co. (Daejeon, Korea) and cloned into the pBHA vector to yield plasmids pBHA-Chr2_FK4, pBHA-Chr25_FK12, and pBHA-Chr27_FK12. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27.

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: All primer sequences used in this study are listed in Additional file : Table S1 PCR fragments were cloned into the pMD18-T simple vector (TaKaRa, Dalian, China) for sequencing. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I. .. The recombinant expression vectors were named as pET-HB-HN1–3, pET-HB-HN7–18, pET-HB-HN6–8, pET-HB-HN9–3, pET-YN-MRS-17 and pET-LN1-AP-1, respectively.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: Paragraph title: 2.2. Cloning and Expression of B. abortus MDH ... PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen).

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations
Article Snippet: In addition a CP construct was generated lacking the first 24 aa (denoted NΔ24-CP), to be tested on the ability to still fold into VLPs and potential future exploitation. .. Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels. .. Polyacrylamide gels were stained with Coomassie brilliant blue and showed the presence of protein bands that were absent from BL21 control cells, and corresponded with the expected sizes of the CCMV CP chimera and NΔ24-CP.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The purified PCR products were ligated into the pGEM-T-Easy vector (Promega, Madison, USA), followed by transformation into E. coli DH5α (Promega). .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. Selected clones were grown and induced with 1 mM isopropyl-β-d-thiogalactoside (IPTG, Sigma, Guangzhou, China) at 20 °C for 12–18 h. The bacterial cells were collected by centrifugation and were sonicated on ice.

Article Title: Purification and Functional Characterization of the C-Terminal Domain of the β-Actin-Binding Protein AIM1 In Vitro
Article Snippet: This domain is only a very small part of the protein, and we are planning to perform further experiments. .. Escherichia coli strains DH5α and BL21 (DE3) were the host strains for amplification and protein expression, respectively. pET-28a (+) was purchased from Novagen company. .. Subcloning of artificial genes encoding g1, g1g2, g1g2g3 and g1g1 were inserted into pET-28a_psp vectors and oligonucleotide primers were synthesized.

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis
Article Snippet: Forward ( 5′-TTTTGGATCC ATGGACGCACGTCGGCCGGTAT -3′ , Bam HI site underlined) and reverse primers ( 5′-CCCAAGCTT TCAATATGGTGGAATAGGACAAAGT -3′ , Hind III site underlined) were used to amplify the Ts -Pt gene from cDNA and genomic DNA from larvae. .. The recombinant plasmid was constructed from a linearised pET-28a (+) expression vector (Novagen, Germany) and the target gene. .. DNA sequencing was performed on an automated DNA sequencer. rTs -Pt was expressed from an E. coli Rosetta (DE3) strain after induction with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and the protein was purified by affinity chromatography using a His-Trap purification kit (GE, USA), per the manufacturer's instructions.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Paragraph title: Heterologous expression of the vdh gene ... The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH.

Article Title: Staphylococcus aureus MazF Specifically Cleaves a Pentad Sequence, UACAU, Which Is Unusually Abundant in the mRNA for Pathogenic Adhesive Factor SraP
Article Snippet: The E. coli BL21(DE3) strain was used for recombinant protein expression. .. Plasmids pET-28a-MazFSa and pBAD-MazESa were constructed from pET-28a (Novagen) and pBAD to express His6 -tagged MazFSa and MazESa , respectively.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Chromosomal DNA was extracted as described previously [ ]. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression. .. E. coli strains were cultured in Luria-Bertani (LB) broth or on LB agar supplemented with ampicillin (50 μL/mL) or kanamycin (30 μL/mL) when necessary.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: ZIKV was titered by a plaque formation (PFU) assay . .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The cloning primers are presented in .

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Primers used for genotyping PCR are shown as follows: KO screen forward, 5′-GAAACTGAAACTGGGTGTGCTAGGG-3′; KO screen reverse, 5′ CGCCTTCTTGACGAGTTCTTCTGAG-3′; WT screen reverse, 5′-GCCTTCCTTGTCTCTCTCCATAGCG-3′. .. Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: Expression vector pET21a (Novagen) containing Bo GH5A (pBoGH5) was used for subsequent cloning of the BACON domain (residues 28-116), the GH5 catalytic domain (residues 117-489), and two active-site mutants, generating pBACON , pCAT , pBoGH5-E430A and pCAT-E430A , respectively. cDNA encoding the BACON and GH5 domains were amplified by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site.

BIA-KA:

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. Expression of His-tagged MDH (His-MDH) was induced by 1 mM IPTG, analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. The lysates of purified protein were subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Modification:

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I. .. The PVX expression construct pGR106 (Peart et al. 2002), 35S:P25, 35S:mGFP5 and 35:P19 [ ] have been previously described.

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: The gene fragments corresponding to amino acids 28-519 of SusD-like Bacova_02651 and 34-456 of Bacova_02650 gene products were amplified from B. ovatus genomic DNA by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site. .. Heterologous protein production in E. coli BL21 and purification was subsequently performed essentially as described for the glycoside hydrolases of the XyGUL; SDS-PAGE was used to confirm the purity of the proteins.

Western Blot:

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Transformation Assay:

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: These plasmids were transformed into E . coli DH5α competent cells, and transformants containing the pBHA vectors harboring the FK genes encoding Gallus gallus keratins were selected on LB medium-ampicillin plates. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The purified PCR products were ligated into the pGEM-T-Easy vector (Promega, Madison, USA), followed by transformation into E. coli DH5α (Promega). .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. Selected clones were grown and induced with 1 mM isopropyl-β-d-thiogalactoside (IPTG, Sigma, Guangzhou, China) at 20 °C for 12–18 h. The bacterial cells were collected by centrifugation and were sonicated on ice.

Crystallization Assay:

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Wild-type ROX enzymes/variants were produced as native His6 -tagged proteins in Escherichia coli BL21(DE3) as described .

Ligation:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: A PCR fragment representing the extracellular domains of Es Dscam from FNIII3 to FNIII6 was amplified using specific primers (Es Dscam-anti-F and Es Dscam-anti-R; Table ). .. Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA). .. The recombinant plasmid pET-28a (+)-Es Dscam was transformed into E. coli Rosetta (DE3) cells (Transgen, China) for expression of the recombinant Es Dscam protein.

Introduce:

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The sense and antisense primers were designed to introduce the ATG initiation codon and TGA stop codon (boldfaced) for VDH production, respectively. .. The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH.

Generated:

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations
Article Snippet: In addition a CP construct was generated lacking the first 24 aa (denoted NΔ24-CP), to be tested on the ability to still fold into VLPs and potential future exploitation. .. Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels.

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: Briefly, knockout constructs of wbpB and wbpE were generated by insertional mutagenesis with a Gm resistance cassette. .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada).

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: The catalytic nucleophile mutants of full-length Bo GH5A and the GH5 domain were generated using Q5® high affinity DNA polymerase (New England BioLabs) from pBoGH5 and pCAT . .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site.

Polymerase Chain Reaction:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: A PCR fragment representing the extracellular domains of Es Dscam from FNIII3 to FNIII6 was amplified using specific primers (Es Dscam-anti-F and Es Dscam-anti-R; Table ). .. Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA). .. The recombinant plasmid pET-28a (+)-Es Dscam was transformed into E. coli Rosetta (DE3) cells (Transgen, China) for expression of the recombinant Es Dscam protein.

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: All primer sequences used in this study are listed in Additional file : Table S1 PCR fragments were cloned into the pMD18-T simple vector (TaKaRa, Dalian, China) for sequencing. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: The primers were designed according to B. abortus S2308 mdh gene sequence (AM040264.1) with Bam HI and Sal I site (underlined) inserted. .. PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. The resulting plasmids, pET-28a-MDH, was used to transform E. coli BL21.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The purified PCR products were ligated into the pGEM-T-Easy vector (Promega, Madison, USA), followed by transformation into E. coli DH5α (Promega). .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega).

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The two GPX cDNAs were amplified by reverse transcription PCR (RT-PCR) using the primer sets W69-PET ( 5'-TACGGATCCATGGGGGCGTCCGAATCT-3' and 5'-TAGCTCGAGCTTCTGCGAGTCGGAAGATTCC-3' ) and W106-PET ( 5'-TACGGATCCAACATGGGTGCGGCAGAGT-3' and 5'-TAGCTCGAGAACCTCCAACAGCTTCTTGATG-3' ). .. The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus. .. The fusion plasmids and empty vector (PET-28a) were transformed into E. coli BL21 (DE3) strain.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The sense and antisense primers were designed to introduce the ATG initiation codon and TGA stop codon (boldfaced) for VDH production, respectively. .. The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH. .. After verifying the nucleotide sequence of vdh by sequencing, pET28a/VDH was used to transformed E. coli BL21(DE3), and the resulting recombinant strain was used for VDH production.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Chromosomal DNA was extracted as described previously [ ]. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression. .. E. coli strains were cultured in Luria-Bertani (LB) broth or on LB agar supplemented with ampicillin (50 μL/mL) or kanamycin (30 μL/mL) when necessary.

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada). .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada).

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Plasmids pET-32a and pET-28a were purchased from Novagen. .. Vent DNA polymerase, restriction enzymes, calf intestinal alkaline phosphatase (CIP), T4 DNA ligase and DNA marker were obtained from New England Biolabs.

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: cDNA sequences encoding N -terminally truncated Mina53 (aa 26-465) and NO66 (aa 183-641) were PCR amplified from Mammalian Gene Collection (MGC) (accession no.: BC014928 and BC011350, respectively) and cloned into pNIC28-Bsa4 vector. .. Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Stratagene’s QuickChange site-directed mutagenesis kit was used to make all ROX mutations using the above constructs as templates.

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: The gene fragments corresponding to amino acids 28-519 of SusD-like Bacova_02651 and 34-456 of Bacova_02650 gene products were amplified from B. ovatus genomic DNA by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site.

Article Title: A 40 kDa protein of the inner membrane is the mitochondrial calcium uniporter
Article Snippet: - For the cloning of MCU-Flag in pcDNA3.1: fw: 5′-GGTACCGCCACCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-GGAATTCTCACTTATCGTCGTCATCCTTGTAATCTTCCTTTTCTCCGATCTGTC-3′ The PCR fragment was cloned into KpnI and EcoRI sites in pcDNA3.1 (Invitrogen). .. - For the cloning of MCU in pET-28A(+): fw: 5′-AGGATCCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-ACTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into BamHI and XhoI sites in pET-28A(+) (Novagen). .. - For the cloning of MCU deleted of the mitochondrial targeting sequence (aa 1-54) (MCUΔMTS ) in pET-28A(+): fw: 5′-CATATGGCTTCCTGGCAGAGCGTGGG-3′ rv: 5′-CTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into NdeI and XhoI sites in pET-28A(+) (Novagen).

Sequencing:

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: All primer sequences used in this study are listed in Additional file : Table S1 PCR fragments were cloned into the pMD18-T simple vector (TaKaRa, Dalian, China) for sequencing. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: The primers were designed according to B. abortus S2308 mdh gene sequence (AM040264.1) with Bam HI and Sal I site (underlined) inserted. .. PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen).

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 .

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The vdh coding sequence was PCR-amplified using a sense primer, 5′-AAC CC ATG G CAGCCACTGAGACCG-3′ (Nco I site underlined), and an antisense primer, 5′-AAC CTCGAG CC TCA GATGGGGTAGTGGCGG-3′ (Xho I site underlined). .. The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Chromosomal DNA was extracted as described previously [ ]. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression. .. E. coli strains were cultured in Luria-Bertani (LB) broth or on LB agar supplemented with ampicillin (50 μL/mL) or kanamycin (30 μL/mL) when necessary.

Sonication:

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus. .. E. coli cells carrying pET-W69, pET-W106, and PET-28a were grown in 40 ml LB medium containing 50 mg/ml kanamycin at 37°C to D600 = 0.5 and induced with 0.8 mM isopropyl-1-thio-bD-galactopyranoside (IPTG) at 22°C.

Recombinant:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: Paragraph title: Recombinant Expression, Purification, and Antiserum Production ... Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA).

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: Based on phylogenetic analysis of the ASPV CP gene in our previous study [ ], unique CP sequences (clones) from five pear and one apple ASPV isolates (HB-HN1–3, HB-HN7–18, HB-HN6–8, HB-HN9–3, YN-MRS-17 and LN-AP-1) were selected to produce recombinant proteins to be used for analysis of electrophoretic mobility, serological reactivity and VSR activity. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. Expression of His-tagged MDH (His-MDH) was induced by 1 mM IPTG, analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: Paragraph title: Gene cloning, expression and purification of recombinant Cs GRN ... The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega).

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis
Article Snippet: Forward ( 5′-TTTTGGATCC ATGGACGCACGTCGGCCGGTAT -3′ , Bam HI site underlined) and reverse primers ( 5′-CCCAAGCTT TCAATATGGTGGAATAGGACAAAGT -3′ , Hind III site underlined) were used to amplify the Ts -Pt gene from cDNA and genomic DNA from larvae. .. The recombinant plasmid was constructed from a linearised pET-28a (+) expression vector (Novagen, Germany) and the target gene. .. DNA sequencing was performed on an automated DNA sequencer. rTs -Pt was expressed from an E. coli Rosetta (DE3) strain after induction with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and the protein was purified by affinity chromatography using a His-Trap purification kit (GE, USA), per the manufacturer's instructions.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Article Title: Staphylococcus aureus MazF Specifically Cleaves a Pentad Sequence, UACAU, Which Is Unusually Abundant in the mRNA for Pathogenic Adhesive Factor SraP
Article Snippet: The E. coli BL21(DE3) strain was used for recombinant protein expression. .. Plasmids pET-28a-MazFSa and pBAD-MazESa were constructed from pET-28a (Novagen) and pBAD to express His6 -tagged MazFSa and MazESa , respectively.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore).

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Primers used for genotyping PCR are shown as follows: KO screen forward, 5′-GAAACTGAAACTGGGTGTGCTAGGG-3′; KO screen reverse, 5′ CGCCTTCTTGACGAGTTCTTCTGAG-3′; WT screen reverse, 5′-GCCTTCCTTGTCTCTCTCCATAGCG-3′. .. Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: Paragraph title: Recombinant protein production and enzyme assays ... Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+).

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: The gene fragments corresponding to amino acids 28-519 of SusD-like Bacova_02651 and 34-456 of Bacova_02650 gene products were amplified from B. ovatus genomic DNA by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site. .. Heterologous protein production in E. coli BL21 and purification was subsequently performed essentially as described for the glycoside hydrolases of the XyGUL; SDS-PAGE was used to confirm the purity of the proteins.

Nucleic Acid Electrophoresis:

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. The supernatant was collected, and recombinant protein was purified using the His-Bind Purification Kit (Novagen).

Mutagenesis:

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: Briefly, knockout constructs of wbpB and wbpE were generated by insertional mutagenesis with a Gm resistance cassette. .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada).

Article Title: A 40 kDa protein of the inner membrane is the mitochondrial calcium uniporter
Article Snippet: - For the cloning of MCU in pET-28A(+): fw: 5′-AGGATCCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-ACTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into BamHI and XhoI sites in pET-28A(+) (Novagen). .. - For the cloning of MCU in pIVEX 1.3 WG: fw: 5′-ACATATGGCGGCCGCCGCAGGTAGATC-3′ rv: 5′-TCTCGAGTTCCTTTTCTCCGATCTGTC-3′ The PCR fragment was cloned into NdeI and XhoI sites in pIVEX 1.3 WG (Roche).

Isolation:

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: Plasmids were isolated from the transformants and digested with Nde I and Xho I. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: Chromosomal DNA of B. abortus A19 was isolated as previously described [ ]. .. PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen).

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The underlined bases indicated restrictions sites. cDNA was synthesised from total RNA, which was isolated from frozen C. sinensis adult tissues. .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega).

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Streptomyces sp. NL15-2K was used for the purification of VDH and isolation of chromosomal DNA. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression.

Purification:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: A PCR fragment representing the extracellular domains of Es Dscam from FNIII3 to FNIII6 was amplified using specific primers (Es Dscam-anti-F and Es Dscam-anti-R; Table ). .. Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA). .. The recombinant plasmid pET-28a (+)-Es Dscam was transformed into E. coli Rosetta (DE3) cells (Transgen, China) for expression of the recombinant Es Dscam protein.

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: Plasmids were isolated from the transformants and digested with Nde I and Xho I. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27. .. Expression vectors also encoded an N-terminal polyhistidine (×6His) tag in frame with the inserted gene.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. Expression of His-tagged MDH (His-MDH) was induced by 1 mM IPTG, analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining.

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations
Article Snippet: Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels. .. For this reason, a protocol was developed to solubilize chimeric CP proteins from protein aggregates and in vitro reassemble them into VLPs.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: Paragraph title: Gene cloning, expression and purification of recombinant Cs GRN ... The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega).

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus. .. Cells were extracted at 4 h and were collected by centrifugation at 3000 g for 10 min, resuspended in pre-chilled sodium phosphate buffer (14 mM NaCl, 0.27 mM KCl, mM Na2 HPO4 , 0.18 mM KH2 PO4 , 1 mM EDTA-2Na and 1% polyvinylpyrrolidone, pH 7.0), and disrupted by sonication.

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis
Article Snippet: Paragraph title: Expression and purification of recombinant protein ... The recombinant plasmid was constructed from a linearised pET-28a (+) expression vector (Novagen, Germany) and the target gene.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Paragraph title: Expression and purification of recombinant Ifu-chit2 protein ... The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 .

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The sense and antisense primers were designed to introduce the ATG initiation codon and TGA stop codon (boldfaced) for VDH production, respectively. .. The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH. .. After verifying the nucleotide sequence of vdh by sequencing, pET28a/VDH was used to transformed E. coli BL21(DE3), and the resulting recombinant strain was used for VDH production.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Streptomyces sp. NL15-2K was used for the purification of VDH and isolation of chromosomal DNA. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression.

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada). .. The wbpB ::Gm region was PCR amplified using KOD polymerase according to the manufacturer's directions (Novagen), using primers that introduced HindIII sites at each end.

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Plasmids pET-32a and pET-28a were purchased from Novagen. .. Vent DNA polymerase, restriction enzymes, calf intestinal alkaline phosphatase (CIP), T4 DNA ligase and DNA marker were obtained from New England Biolabs.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. Recombinant NS1 proteins were expressed in the Escherichia coli BL21 DE3 strain in an insoluble form in inclusion bodies.

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Protein Purification:

Article Title: Purification and Functional Characterization of the C-Terminal Domain of the β-Actin-Binding Protein AIM1 In Vitro
Article Snippet: Escherichia coli strains DH5α and BL21 (DE3) were the host strains for amplification and protein expression, respectively. pET-28a (+) was purchased from Novagen company. .. Escherichia coli strains DH5α and BL21 (DE3) were the host strains for amplification and protein expression, respectively. pET-28a (+) was purchased from Novagen company.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The two GPX cDNAs were amplified by reverse transcription PCR (RT-PCR) using the primer sets W69-PET ( 5'-TACGGATCCATGGGGGCGTCCGAATCT-3' and 5'-TAGCTCGAGCTTCTGCGAGTCGGAAGATTCC-3' ) and W106-PET ( 5'-TACGGATCCAACATGGGTGCGGCAGAGT-3' and 5'-TAGCTCGAGAACCTCCAACAGCTTCTTGATG-3' ). .. The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus.

Polyacrylamide Gel Electrophoresis:

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. The resulting plasmids, pET-28a-MDH, was used to transform E. coli BL21.

Staining:

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. The resulting plasmids, pET-28a-MDH, was used to transform E. coli BL21.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. Ifu-Chit2 expression was induced by addition of isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM and cultivation was continued for an additional 6 h at 28°C.

Activated Clotting Time Assay:

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The ORF of Cs GRN (GenBank KY855531) was 714 bp and the specific primers were as follows: forward 5′-CGC GGA TCC TGT AAA TAT AAC CAG ACT TG-3′ (BamH I) (Thermo Scientific, Waltham, USA), Reverse: 5′-TTA CTC GAG CGG AGC ACA GGT GTA GTG AT-3′ (Xhol I) (Thermo Scientific). .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega).

SDS Page:

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. The resulting plasmids, pET-28a-MDH, was used to transform E. coli BL21.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. The supernatant was collected, and recombinant protein was purified using the His-Bind Purification Kit (Novagen).

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. Ifu-Chit2 expression was induced by addition of isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM and cultivation was continued for an additional 6 h at 28°C.

Plasmid Preparation:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: A PCR fragment representing the extracellular domains of Es Dscam from FNIII3 to FNIII6 was amplified using specific primers (Es Dscam-anti-F and Es Dscam-anti-R; Table ). .. Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA). .. The recombinant plasmid pET-28a (+)-Es Dscam was transformed into E. coli Rosetta (DE3) cells (Transgen, China) for expression of the recombinant Es Dscam protein.

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: Plasmids were isolated from the transformants and digested with Nde I and Xho I. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27. .. Expression vectors also encoded an N-terminal polyhistidine (×6His) tag in frame with the inserted gene.

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: Paragraph title: Vector construction ... For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The purified PCR products were ligated into the pGEM-T-Easy vector (Promega, Madison, USA), followed by transformation into E. coli DH5α (Promega). .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. Selected clones were grown and induced with 1 mM isopropyl-β-d-thiogalactoside (IPTG, Sigma, Guangzhou, China) at 20 °C for 12–18 h. The bacterial cells were collected by centrifugation and were sonicated on ice.

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis
Article Snippet: Forward ( 5′-TTTTGGATCC ATGGACGCACGTCGGCCGGTAT -3′ , Bam HI site underlined) and reverse primers ( 5′-CCCAAGCTT TCAATATGGTGGAATAGGACAAAGT -3′ , Hind III site underlined) were used to amplify the Ts -Pt gene from cDNA and genomic DNA from larvae. .. The recombinant plasmid was constructed from a linearised pET-28a (+) expression vector (Novagen, Germany) and the target gene. .. DNA sequencing was performed on an automated DNA sequencer. rTs -Pt was expressed from an E. coli Rosetta (DE3) strain after induction with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and the protein was purified by affinity chromatography using a His-Trap purification kit (GE, USA), per the manufacturer's instructions.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Escherichia coli B strain AVB101 harboring a pACYC-184 plasmid, which contains the birA gene, was purchased from Avidity. .. Plasmids pET-32a and pET-28a were purchased from Novagen.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: ZIKV was titered by a plaque formation (PFU) assay . .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The cloning primers are presented in .

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Primers used for genotyping PCR are shown as follows: KO screen forward, 5′-GAAACTGAAACTGGGTGTGCTAGGG-3′; KO screen reverse, 5′ CGCCTTCTTGACGAGTTCTTCTGAG-3′; WT screen reverse, 5′-GCCTTCCTTGTCTCTCTCCATAGCG-3′. .. Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: cDNA sequences encoding N -terminally truncated Mina53 (aa 26-465) and NO66 (aa 183-641) were PCR amplified from Mammalian Gene Collection (MGC) (accession no.: BC014928 and BC011350, respectively) and cloned into pNIC28-Bsa4 vector. .. Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Stratagene’s QuickChange site-directed mutagenesis kit was used to make all ROX mutations using the above constructs as templates.

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: Expression vector pET21a (Novagen) containing Bo GH5A (pBoGH5) was used for subsequent cloning of the BACON domain (residues 28-116), the GH5 catalytic domain (residues 117-489), and two active-site mutants, generating pBACON , pCAT , pBoGH5-E430A and pCAT-E430A , respectively. cDNA encoding the BACON and GH5 domains were amplified by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site.

Positron Emission Tomography:

Article Title: Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam) Regulates Phagocytosis via Membrane-Bound Dscam in Crab
Article Snippet: A PCR fragment representing the extracellular domains of Es Dscam from FNIII3 to FNIII6 was amplified using specific primers (Es Dscam-anti-F and Es Dscam-anti-R; Table ). .. Subsequently, the PCR products were purified and digested with restriction enzymes (EcoR I and Xho I) for ligation of the final DNA fragment into the pET-28a (+) vector (Novagen, USA). .. The recombinant plasmid pET-28a (+)-Es Dscam was transformed into E. coli Rosetta (DE3) cells (Transgen, China) for expression of the recombinant Es Dscam protein.

Article Title: Development of a keratinase activity assay using recombinant chicken feather keratin substrates
Article Snippet: Plasmids were isolated from the transformants and digested with Nde I and Xho I. .. Inserts were purified and ligated into the Nde I and Xho I sites of the pET-28a (+) plasmid (Novagen) to yield pET-28a_Chr2, pET-28a_Chr25, and pET-28a_Chr27. .. Expression vectors also encoded an N-terminal polyhistidine (×6His) tag in frame with the inserted gene.

Article Title: Functional analysis of apple stem pitting virus coat protein variants
Article Snippet: All primer sequences used in this study are listed in Additional file : Table S1 PCR fragments were cloned into the pMD18-T simple vector (TaKaRa, Dalian, China) for sequencing. .. For expression of ASPV-CPs fused with a His tag in Escherichia coli (E. coli ) BL21 (DE3), HB-HN9–3 was cloned into pET-28a (+) (Novagen, Madison, WI, USA) by double digestion with Bam HI and Hin dIII, HB-HN1–3, HB-HN7–18, HB-HN6–8, LN-AP-1 and YN-MRS-17 were cloned into pET-28a (+) by double digestion with Sac I and Sal I. .. The recombinant expression vectors were named as pET-HB-HN1–3, pET-HB-HN7–18, pET-HB-HN6–8, pET-HB-HN9–3, pET-YN-MRS-17 and pET-LN1-AP-1, respectively.

Article Title: Enzymatic Activity Analysis and Catalytic Essential Residues Identification of Brucella abortus Malate Dehydrogenase
Article Snippet: The primers were designed according to B. abortus S2308 mdh gene sequence (AM040264.1) with Bam HI and Sal I site (underlined) inserted. .. PCR product was Bam HI/Sal I-digested and cloned into Bam HI/Sal I sites of pET-28a (+) (Novagen). .. The resulting plasmids, pET-28a-MDH, was used to transform E. coli BL21.

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The purified PCR products were ligated into the pGEM-T-Easy vector (Promega, Madison, USA), followed by transformation into E. coli DH5α (Promega). .. The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. Selected clones were grown and induced with 1 mM isopropyl-β-d-thiogalactoside (IPTG, Sigma, Guangzhou, China) at 20 °C for 12–18 h. The bacterial cells were collected by centrifugation and were sonicated on ice.

Article Title: Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis
Article Snippet: The two GPX cDNAs were amplified by reverse transcription PCR (RT-PCR) using the primer sets W69-PET ( 5'-TACGGATCCATGGGGGCGTCCGAATCT-3' and 5'-TAGCTCGAGCTTCTGCGAGTCGGAAGATTCC-3' ) and W106-PET ( 5'-TACGGATCCAACATGGGTGCGGCAGAGT-3' and 5'-TAGCTCGAGAACCTCCAACAGCTTCTTGATG-3' ). .. The PCR product was cut by Bam HI and Xho I and then subcloned into corresponding sites of pET-28a (Novagen) with a Histidine-tag at the N-terminus. .. The fusion plasmids and empty vector (PET-28a) were transformed into E. coli BL21 (DE3) strain.

Article Title: Purification and Functional Characterization of the C-Terminal Domain of the β-Actin-Binding Protein AIM1 In Vitro
Article Snippet: This domain is only a very small part of the protein, and we are planning to perform further experiments. .. Escherichia coli strains DH5α and BL21 (DE3) were the host strains for amplification and protein expression, respectively. pET-28a (+) was purchased from Novagen company. .. Subcloning of artificial genes encoding g1, g1g2, g1g2g3 and g1g1 were inserted into pET-28a_psp vectors and oligonucleotide primers were synthesized.

Article Title: Characterisation of a Plancitoxin-1-Like DNase II Gene in Trichinella spiralis
Article Snippet: Forward ( 5′-TTTTGGATCC ATGGACGCACGTCGGCCGGTAT -3′ , Bam HI site underlined) and reverse primers ( 5′-CCCAAGCTT TCAATATGGTGGAATAGGACAAAGT -3′ , Hind III site underlined) were used to amplify the Ts -Pt gene from cDNA and genomic DNA from larvae. .. The recombinant plasmid was constructed from a linearised pET-28a (+) expression vector (Novagen, Germany) and the target gene. .. DNA sequencing was performed on an automated DNA sequencer. rTs -Pt was expressed from an E. coli Rosetta (DE3) strain after induction with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and the protein was purified by affinity chromatography using a His-Trap purification kit (GE, USA), per the manufacturer's instructions.

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: Primers 5-CCG GAATTC ATGCTGGGTTTCCTCA GGAAAT-3 and 5-ATAAGAAT GCGGCCGC CTA GTGGTGATGGTGATGGTG AGCCATGCTATTCCT GATATTG-3 (restriction enzyme sites are underlined; the 6His-tag sequence is in bold) were designed for PCR amplification based on the encoding region of the Ifu-chit2 gene. .. The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: The sense and antisense primers were designed to introduce the ATG initiation codon and TGA stop codon (boldfaced) for VDH production, respectively. .. The amplified gene was digested with Nco I and Xho I, purified using a MinElute PCR Purification Kit (Qiagen, Hilden, Germany), and inserted into the respective restriction sites in pET-28a(+) (Novagen) to generate pET28a/VDH. .. After verifying the nucleotide sequence of vdh by sequencing, pET28a/VDH was used to transformed E. coli BL21(DE3), and the resulting recombinant strain was used for VDH production.

Article Title: Staphylococcus aureus MazF Specifically Cleaves a Pentad Sequence, UACAU, Which Is Unusually Abundant in the mRNA for Pathogenic Adhesive Factor SraP
Article Snippet: The E. coli BL21(DE3) strain was used for recombinant protein expression. .. Plasmids pET-28a-MazFSa and pBAD-MazESa were constructed from pET-28a (Novagen) and pBAD to express His6 -tagged MazFSa and MazESa , respectively. .. MazFSa tagged with His6 at the N-terminal end were purified from strain BL21(DE3) carrying pET-28a-MazFSa by using Ni-nitrilotriacetic acid resin (Qiagen) as described previously ( ).

Article Title: Molecular cloning and characterization of vanillin dehydrogenase from Streptomyces sp. NL15-2K
Article Snippet: Chromosomal DNA was extracted as described previously [ ]. .. E. coli DH5α (Takara Bio, Kyoto, Japan) and pMD20-T (Takara Bio) were used for cloning of PCR products and sequencing, and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) and pET-28a(+) (Novagen) were used for protein expression. .. E. coli strains were cultured in Luria-Bertani (LB) broth or on LB agar supplemented with ampicillin (50 μL/mL) or kanamycin (30 μL/mL) when necessary.

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: Briefly, knockout constructs of wbpB and wbpE were generated by insertional mutagenesis with a Gm resistance cassette. .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada). .. The wbpB gene was disrupted by insertion of the Gmr cassette from PstI-digested pPS856 into the two internal PstI sites.

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Escherichia coli B strain AVB101 harboring a pACYC-184 plasmid, which contains the birA gene, was purchased from Avidity. .. Plasmids pET-32a and pET-28a were purchased from Novagen. .. TEV protease expression vector pRK793 was obtained from Addgene.

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: ZIKV was titered by a plaque formation (PFU) assay . .. The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The cloning primers are presented in .

Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
Article Snippet: Primers used for genotyping PCR are shown as follows: KO screen forward, 5′-GAAACTGAAACTGGGTGTGCTAGGG-3′; KO screen reverse, 5′ CGCCTTCTTGACGAGTTCTTCTGAG-3′; WT screen reverse, 5′-GCCTTCCTTGTCTCTCTCCATAGCG-3′. .. Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen) to generate recombinant Batf2 protein with His tagged. .. Recombinant Batf2 was then expressed using Escherichia coli BL21 (Invitrogen).

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: cDNA sequences encoding N -terminally truncated Mina53 (aa 26-465) and NO66 (aa 183-641) were PCR amplified from Mammalian Gene Collection (MGC) (accession no.: BC014928 and BC011350, respectively) and cloned into pNIC28-Bsa4 vector. .. Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Stratagene’s QuickChange site-directed mutagenesis kit was used to make all ROX mutations using the above constructs as templates.

Article Title: A discrete genetic locus confers xyloglucan metabolism in select human gut Bacteroidetes
Article Snippet: The gene fragments corresponding to amino acids 28-519 of SusD-like Bacova_02651 and 34-456 of Bacova_02650 gene products were amplified from B. ovatus genomic DNA by PCR using forward primers including NdeI restriction sites and reverse primers including XhoI ( ). .. The gene products were ligated into a modified version of pET-28a (EMD Biosciences) containing a recombinant tobacco etch virus (rTEV) protease recognition site. .. Heterologous protein production in E. coli BL21 and purification was subsequently performed essentially as described for the glycoside hydrolases of the XyGUL; SDS-PAGE was used to confirm the purity of the proteins.

Article Title: A 40 kDa protein of the inner membrane is the mitochondrial calcium uniporter
Article Snippet: - For the cloning of MCU-Flag in pcDNA3.1: fw: 5′-GGTACCGCCACCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-GGAATTCTCACTTATCGTCGTCATCCTTGTAATCTTCCTTTTCTCCGATCTGTC-3′ The PCR fragment was cloned into KpnI and EcoRI sites in pcDNA3.1 (Invitrogen). .. - For the cloning of MCU in pET-28A(+): fw: 5′-AGGATCCATGGCGGCCGCCGCAGGTAG-3′ rv: 5′-ACTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into BamHI and XhoI sites in pET-28A(+) (Novagen). .. - For the cloning of MCU deleted of the mitochondrial targeting sequence (aa 1-54) (MCUΔMTS ) in pET-28A(+): fw: 5′-CATATGGCTTCCTGGCAGAGCGTGGG-3′ rv: 5′-CTCGAGTCATTCCTTTTCTCCGATCT-3′ The PCR fragment was cloned into NdeI and XhoI sites in pET-28A(+) (Novagen).

In Vitro:

Article Title: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations
Article Snippet: Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels. .. Constructs were cloned into pET 28a (Novagen) expression vector, expressed in BL21 cells and subsequently analyzed on sodium dodecylsulfate-polyacrylamide gels.

Knock-Out:

Article Title: Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters
Article Snippet: Briefly, knockout constructs of wbpB and wbpE were generated by insertional mutagenesis with a Gm resistance cassette. .. For the wbpB knockout, the gene was amplified from P. aeruginosa PAO1 genomic DNA, using primers that incorporate a BamHI site and an EcoRI site, and the resultant product was ligated into pET-28a (Novagen, Mississauga, Ontario, Canada). .. The wbpB gene was disrupted by insertion of the Gmr cassette from PstI-digested pPS856 into the two internal PstI sites.

Produced:

Article Title: Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes
Article Snippet: The ZIKV NS1 genes were amplified from the cDNA of infected cells and cloned into a pET-28a (+) expression vector (69864, Millipore). .. The proteins were then solubilized by 8 M urea and purified with a TALON Purification Kit (635515, Clontech).

Article Title: Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans
Article Snippet: Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+). .. Full length ycfD was cloned into pET-28a(+) vector (Novagen, Madison, WI, U.S.A.) as described . ycfDRM gene (NCBI GENE ID: 8566662) was amplified by PCR from genomic DNA of R. marinus , and was cloned into pGEM®-T Easy Vector and then into pET-28a(+).

Concentration Assay:

Article Title: Clonorchis sinensis granulin: identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma
Article Snippet: The resulting plasmid DNA was digested with the appropriate restriction enzymes, ligated into the pET-28a (+) expression vector (Novagen, Darmstadt, Germany), and then transformed into E. coli BL21 (DE3) (Promega). .. The lysates of purified protein were subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Article Title: Cloning and expression analysis of the chitinase gene Ifu-chit2 from Isaria fumosorosea
Article Snippet: The PCR product was cloned into the pET-28a (+) vector (Novagen), resulting in recombinant expression vector pET-28a-Ifu-chit2 . .. This was transformed into E. coli strain BL21 (DE3) chemically competent cells (TransGen, China) and grown at 37 °C in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin.

Marker:

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Plasmids pET-32a and pET-28a were purchased from Novagen. .. Plasmids pET-32a and pET-28a were purchased from Novagen.

Gel Extraction:

Article Title: Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation
Article Snippet: Plasmids pET-32a and pET-28a were purchased from Novagen. .. Vent DNA polymerase, restriction enzymes, calf intestinal alkaline phosphatase (CIP), T4 DNA ligase and DNA marker were obtained from New England Biolabs.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore plasmid pet 28a
    Validation of nucleic acid digestion by pepsin. a , Digestion of various DNA and RNA by commercial porcine pepsin. Lane 1, 2: salmon sperm DNA; Lane 3, 4: λ DNA; Lane 5, 6: <t>pET-28a;</t> Lane 7, 8: M13mp18; Lane 9, 10: RNA ladder. Other conditions: 4.0 mg ml −1 of pepsin, NaH 2 PO 4 buffer (25 mM, pH 3.8, including 200 mM NaCl), 37 °C, 5 h. For RNA, the digestion time was 1 h. b , Effect of alkaline conditions on pepsin NA digestion. Lane 1, original λ DNA; Lane 2, digested by active pepsin; Lane 3, digested by NaOH-pretreated pepsin. c, Digestion of λ DNA by commercial porcine pepsin (Lane P), recombinant pepsin (Lane rP) and mutant pepsin (Lane mP). Conditions: 0.15 mg ml −1 enzymes, pH 3.8, 37 °C, 12 h. A 0.8% agarose gel was used for electrophoresis.
    Plasmid Pet 28a, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 744 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid pet 28a/product/Millipore
    Average 99 stars, based on 744 article reviews
    Price from $9.99 to $1999.99
    plasmid pet 28a - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Validation of nucleic acid digestion by pepsin. a , Digestion of various DNA and RNA by commercial porcine pepsin. Lane 1, 2: salmon sperm DNA; Lane 3, 4: λ DNA; Lane 5, 6: pET-28a; Lane 7, 8: M13mp18; Lane 9, 10: RNA ladder. Other conditions: 4.0 mg ml −1 of pepsin, NaH 2 PO 4 buffer (25 mM, pH 3.8, including 200 mM NaCl), 37 °C, 5 h. For RNA, the digestion time was 1 h. b , Effect of alkaline conditions on pepsin NA digestion. Lane 1, original λ DNA; Lane 2, digested by active pepsin; Lane 3, digested by NaOH-pretreated pepsin. c, Digestion of λ DNA by commercial porcine pepsin (Lane P), recombinant pepsin (Lane rP) and mutant pepsin (Lane mP). Conditions: 0.15 mg ml −1 enzymes, pH 3.8, 37 °C, 12 h. A 0.8% agarose gel was used for electrophoresis.

    Journal: Scientific Reports

    Article Title: Digestion of Nucleic Acids Starts in the Stomach

    doi: 10.1038/srep11936

    Figure Lengend Snippet: Validation of nucleic acid digestion by pepsin. a , Digestion of various DNA and RNA by commercial porcine pepsin. Lane 1, 2: salmon sperm DNA; Lane 3, 4: λ DNA; Lane 5, 6: pET-28a; Lane 7, 8: M13mp18; Lane 9, 10: RNA ladder. Other conditions: 4.0 mg ml −1 of pepsin, NaH 2 PO 4 buffer (25 mM, pH 3.8, including 200 mM NaCl), 37 °C, 5 h. For RNA, the digestion time was 1 h. b , Effect of alkaline conditions on pepsin NA digestion. Lane 1, original λ DNA; Lane 2, digested by active pepsin; Lane 3, digested by NaOH-pretreated pepsin. c, Digestion of λ DNA by commercial porcine pepsin (Lane P), recombinant pepsin (Lane rP) and mutant pepsin (Lane mP). Conditions: 0.15 mg ml −1 enzymes, pH 3.8, 37 °C, 12 h. A 0.8% agarose gel was used for electrophoresis.

    Article Snippet: Plasmid pET-28a (5.4 kb) was purchased from EMD Chemicals Inc. (Novagen, D00131614) with concentration of 500 μg ml−1 , and was diluted into 210 μg ml−1 before use.

    Techniques: Positron Emission Tomography, Recombinant, Mutagenesis, Agarose Gel Electrophoresis, Electrophoresis