Review





Similar Products

97
Thermo Fisher gene exp pdk4 mm00443325 m1
Gene Exp Pdk4 Mm00443325 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/Gene+Exp%2E+Pdk4%2C+Mm00443325_m1/pmc13096911-240-63-19
Average 97 stars, based on 1 article reviews
gene exp pdk4 mm00443325 m1 - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier

86
Sangon Biotech caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse
Caagtctcagcaaaaggaacgt Sangon Biotech N A Primer Pdk4 Promoter Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-58-59
Average 86 stars, based on 1 article reviews
caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Sangon Biotech gacccagtcaccaatcaaaatct sangon biotech n a primer pdk4 reverse
Gacccagtcaccaatcaaaatct Sangon Biotech N A Primer Pdk4 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-171-172
Average 86 stars, based on 1 article reviews
gacccagtcaccaatcaaaatct sangon biotech n a primer pdk4 reverse - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Sangon Biotech caactgtcgctctcattgagt sangon biotech n a primer pdk4 forward
Caactgtcgctctcattgagt Sangon Biotech N A Primer Pdk4 Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-164-165
Average 86 stars, based on 1 article reviews
caactgtcgctctcattgagt sangon biotech n a primer pdk4 forward - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Sangon Biotech caggtcttggataactttcta sangon biotech n a shrna pdk4
Caggtcttggataactttcta Sangon Biotech N A Shrna Pdk4, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-663-65-66
Average 86 stars, based on 1 article reviews
caggtcttggataactttcta sangon biotech n a shrna pdk4 - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

94
ABclonal Biotechnology pdk4
Construction and validation of machine-learning diagnostic models based on monocyte/macrophage-specific scDEGs. (A–D) Cross-validation performance surfaces illustrating model accuracy across tested hyperparameter combinations for Gradient Boosting Machine (A) , Support Vector Machine (B) , Random Forest (C) and Extreme Gradient Boosting (D) . (E–H) Feature-importance plots showing the top-ranked predictive genes identified by each algorithm—GBM (E) , SVM (F) , RF (G) , and XGBoost (H) . Importance values represent model-specific metrics: relative influence for GBM, permutation-based sensitivity for SVM, mean decrease in Gini impurity for RF, and gain across tree splits for XGBoost. (I–L) Precision–recall curves of the 4 machine-learning models evaluated on the validation set—GBM (I) , SVM (J) , RF (K) , and XGBoost (L, M) Upset plot showing the overlap of importance genes across the 4 algorithms (RHOB, TSPAN4, FRMD4B, CEBPB, CD4 and <t>PDK4).</t>
Pdk4, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/PDK4+Rabbit+pAb/pmc13132789-56-34-35
Average 94 stars, based on 1 article reviews
pdk4 - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

95
Proteintech pdk4
Construction and validation of machine-learning diagnostic models based on monocyte/macrophage-specific scDEGs. (A–D) Cross-validation performance surfaces illustrating model accuracy across tested hyperparameter combinations for Gradient Boosting Machine (A) , Support Vector Machine (B) , Random Forest (C) and Extreme Gradient Boosting (D) . (E–H) Feature-importance plots showing the top-ranked predictive genes identified by each algorithm—GBM (E) , SVM (F) , RF (G) , and XGBoost (H) . Importance values represent model-specific metrics: relative influence for GBM, permutation-based sensitivity for SVM, mean decrease in Gini impurity for RF, and gain across tree splits for XGBoost. (I–L) Precision–recall curves of the 4 machine-learning models evaluated on the validation set—GBM (I) , SVM (J) , RF (K) , and XGBoost (L, M) Upset plot showing the overlap of importance genes across the 4 algorithms (RHOB, TSPAN4, FRMD4B, CEBPB, CD4 and <t>PDK4).</t>
Pdk4, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/PDK4+Antibody/pm41922343-323-63-65
Average 95 stars, based on 1 article reviews
pdk4 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp pdk4 rn00585577 m1
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( <t>Pdk4,</t> Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Gene Exp Pdk4 Rn00585577 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/Gene+Exp%2E+Pdk4%2C+Rn00585577_m1/bio_rxiv__64898__2026__03__16__710895-79-59-15
Average 86 stars, based on 1 article reviews
gene exp pdk4 rn00585577 m1 - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

98
Thermo Fisher gene exp pdk4 hs01037712 m1
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( <t>Pdk4,</t> Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Gene Exp Pdk4 Hs01037712 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/Gene+Exp%2E+PDK4%2C+Hs01037712_m1/bio_rxiv__64898__2026__03__16__710895-79-57-15
Average 98 stars, based on 1 article reviews
gene exp pdk4 hs01037712 m1 - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

Image Search Results


Construction and validation of machine-learning diagnostic models based on monocyte/macrophage-specific scDEGs. (A–D) Cross-validation performance surfaces illustrating model accuracy across tested hyperparameter combinations for Gradient Boosting Machine (A) , Support Vector Machine (B) , Random Forest (C) and Extreme Gradient Boosting (D) . (E–H) Feature-importance plots showing the top-ranked predictive genes identified by each algorithm—GBM (E) , SVM (F) , RF (G) , and XGBoost (H) . Importance values represent model-specific metrics: relative influence for GBM, permutation-based sensitivity for SVM, mean decrease in Gini impurity for RF, and gain across tree splits for XGBoost. (I–L) Precision–recall curves of the 4 machine-learning models evaluated on the validation set—GBM (I) , SVM (J) , RF (K) , and XGBoost (L, M) Upset plot showing the overlap of importance genes across the 4 algorithms (RHOB, TSPAN4, FRMD4B, CEBPB, CD4 and PDK4).

Journal: Frontiers in Immunology

Article Title: Immune cells with senescence-related transcriptional signatures orchestrate the inflammatory continuum in osteoarthritis synovium: a single-cell and machine learning study

doi: 10.3389/fimmu.2026.1774722

Figure Lengend Snippet: Construction and validation of machine-learning diagnostic models based on monocyte/macrophage-specific scDEGs. (A–D) Cross-validation performance surfaces illustrating model accuracy across tested hyperparameter combinations for Gradient Boosting Machine (A) , Support Vector Machine (B) , Random Forest (C) and Extreme Gradient Boosting (D) . (E–H) Feature-importance plots showing the top-ranked predictive genes identified by each algorithm—GBM (E) , SVM (F) , RF (G) , and XGBoost (H) . Importance values represent model-specific metrics: relative influence for GBM, permutation-based sensitivity for SVM, mean decrease in Gini impurity for RF, and gain across tree splits for XGBoost. (I–L) Precision–recall curves of the 4 machine-learning models evaluated on the validation set—GBM (I) , SVM (J) , RF (K) , and XGBoost (L, M) Upset plot showing the overlap of importance genes across the 4 algorithms (RHOB, TSPAN4, FRMD4B, CEBPB, CD4 and PDK4).

Article Snippet: Membranes were blocked with Tris-buffered saline containing 0.1% Tween 20 (TBST) supplemented with 5% skim milk at room temperature for 1 h, followed by incubation with primary antibodies against RHOB (ABclonal, Cat. No. A22258), PDK4 (ABclonal, Cat. No. A13337), β-Tubulin (Santa Cruz Biotechnology, Cat. No. sc-5274), or GAPDH (Proteintech, Cat. No. 60004-1-Ig) at 4 °C overnight.

Techniques: Biomarker Discovery, Diagnostic Assay, Plasmid Preparation

Immunofluorescence and Western blot validation of RHOB and PDK4 expression in synovial macrophages. (A) Immunofluorescence images showing RHOB (red) colocalized with CD68 (green) in synovial tissue; nuclei are stained with DAPI (blue). (B) Quantification of RHOB/CD68 fluorescence intensity ratio. (C) Pixel-wise colocalization scatter plot of CD68 versus RHOB fluorescence signals (Pearson’s R = 0.80). (D) Representative immunofluorescence images showing PDK4 (red) colocalized with CD68 (green). (E) Quantification of PDK4/CD68 fluorescence intensity ratio. (F) Pixel-wise colocalization scatter plot of CD68 versus PDK4 fluorescence signals (Pearson’s R = 0.68). (G) Western blot analysis of RHOB and PDK4 protein expression in synovial tissues from OA patients and controls. CG, control group; OA, OA group. **p < 0.01, ***p < 0.001, ****p < 0.0001.

Journal: Frontiers in Immunology

Article Title: Immune cells with senescence-related transcriptional signatures orchestrate the inflammatory continuum in osteoarthritis synovium: a single-cell and machine learning study

doi: 10.3389/fimmu.2026.1774722

Figure Lengend Snippet: Immunofluorescence and Western blot validation of RHOB and PDK4 expression in synovial macrophages. (A) Immunofluorescence images showing RHOB (red) colocalized with CD68 (green) in synovial tissue; nuclei are stained with DAPI (blue). (B) Quantification of RHOB/CD68 fluorescence intensity ratio. (C) Pixel-wise colocalization scatter plot of CD68 versus RHOB fluorescence signals (Pearson’s R = 0.80). (D) Representative immunofluorescence images showing PDK4 (red) colocalized with CD68 (green). (E) Quantification of PDK4/CD68 fluorescence intensity ratio. (F) Pixel-wise colocalization scatter plot of CD68 versus PDK4 fluorescence signals (Pearson’s R = 0.68). (G) Western blot analysis of RHOB and PDK4 protein expression in synovial tissues from OA patients and controls. CG, control group; OA, OA group. **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: Membranes were blocked with Tris-buffered saline containing 0.1% Tween 20 (TBST) supplemented with 5% skim milk at room temperature for 1 h, followed by incubation with primary antibodies against RHOB (ABclonal, Cat. No. A22258), PDK4 (ABclonal, Cat. No. A13337), β-Tubulin (Santa Cruz Biotechnology, Cat. No. sc-5274), or GAPDH (Proteintech, Cat. No. 60004-1-Ig) at 4 °C overnight.

Techniques: Immunofluorescence, Western Blot, Biomarker Discovery, Expressing, Staining, Fluorescence, Control

Drug–gene interaction mapping and molecular docking for RHOB and PDK4. (A) DGIdb-derived interaction network displaying the selected gene–compound pairs—PDK4 with SODIUM DICHLOROACETATE (DCA) and RHOB with CHEMBL1797159. The network also shows known disease associations of DCA. (B) Molecular docking pose of PDK4 with SODIUM DICHLOROACETATE (Vina score = −4.0 kcal/mol). (C) Molecular docking pose of RHOB with CHEMBL1797159 (Vina score = −5.2 kcal/mol).

Journal: Frontiers in Immunology

Article Title: Immune cells with senescence-related transcriptional signatures orchestrate the inflammatory continuum in osteoarthritis synovium: a single-cell and machine learning study

doi: 10.3389/fimmu.2026.1774722

Figure Lengend Snippet: Drug–gene interaction mapping and molecular docking for RHOB and PDK4. (A) DGIdb-derived interaction network displaying the selected gene–compound pairs—PDK4 with SODIUM DICHLOROACETATE (DCA) and RHOB with CHEMBL1797159. The network also shows known disease associations of DCA. (B) Molecular docking pose of PDK4 with SODIUM DICHLOROACETATE (Vina score = −4.0 kcal/mol). (C) Molecular docking pose of RHOB with CHEMBL1797159 (Vina score = −5.2 kcal/mol).

Article Snippet: Membranes were blocked with Tris-buffered saline containing 0.1% Tween 20 (TBST) supplemented with 5% skim milk at room temperature for 1 h, followed by incubation with primary antibodies against RHOB (ABclonal, Cat. No. A22258), PDK4 (ABclonal, Cat. No. A13337), β-Tubulin (Santa Cruz Biotechnology, Cat. No. sc-5274), or GAPDH (Proteintech, Cat. No. 60004-1-Ig) at 4 °C overnight.

Techniques: Derivative Assay

A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Western Blot, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, RNA Extraction, Isolation, Activity Assay, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, Marker

Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Staining, Western Blot, Marker

Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Expressing

A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Western Blot, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, RNA Extraction, Isolation, Activity Assay, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, Marker

Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Staining, Western Blot, Marker

Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Expressing