Structured Review

Addgene inc pcscmv tdtomato
Pcscmv Tdtomato, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcscmv tdtomato/product/Addgene inc
Average 94 stars, based on 1 article reviews
Price from $9.99 to $1999.99
pcscmv tdtomato - by Bioz Stars, 2020-04
94/100 stars

Images

Related Articles

Transduction:

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. Viral supernatants were harvested 48 h after transfection and either used directly for cell transduction, or concentrated to 1/50 th of the initial volume using the Lenti-X concentrator reagent and protocol (Takara).

Clone Assay:

Article Title: Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector
Article Snippet: Next, genes of interest were PCR-amplified and inserted into the cloning intermediates one by one. .. The templates used for PCR are: pMXs-MGT for M, G, T, pLenti-GFP (Cell Biolabs, LTV-400) for GFP, pCSCMV-tdTomato (Addgene) for Td, and piRFP670-N1 (Addgene, #45457) for iRFP670.

Article Title: In vitro and in silico multidimensional modeling of oncolytic tumor virotherapy dynamics
Article Snippet: Lentiviral vectors expressing fluorescent proteins PCR products containing the yellow fluorescent protein (YFP), enhanced blue fluorescent protein (eBFP), and the tdTomato genes were generated using Roche Fast-Start High Fidelity PCR kit using pCAG-YFP, CFP, pCSCMV:tdTomato (Addgene) as template DNA. .. The primers (Forward: G GGATCC ACGCCACCATGGTGAGCAAGGGCG and reverse: GAG GCGGCCGC AGTTTACTTGTACAGCTCGTCCATGCC) had restriction sites for BamHI and NotI to facilitate cloning in the lentiviral vector backbone [ ].

Article Title: Cdc14A and Cdc14B Redundantly Regulate DNA Double-Strand Break Repair
Article Snippet: pLKO.1 puro, pMD2.G, psPAX2, pEGFP-N1, pCAGGS, and pCSCMV:tdTomato were obtained from Addgene. .. Cdh1 or Cdc14A was cloned from mouse or human cDNA to pENTR with the following primers and then subcloned to pInducer20 as previously described ( ) with Gateway LR Clonase II (Invitrogen): Cdh1-F (AAGGAAAAAAGCGGCCGCATGGACTACAAGGACGATGATGACAAGGACCAGGACTATGAGCGAAGG) with Cdh1-R (ACGCGTCGACCTATCGGATCCGGGTGAAGAGGTT) and Cdc14A-F (AAGGAAAAAAGCGGCCGCATGGCAGCGGAGTCAGGGGAAC) with Cdc14A-R (ACGCGTCGACTTACTTGTCATCATCGTCCTTGTAGTCGTAATGAACATATTCAGACTG).

Article Title: TDP-43 misexpression causes defects in dendritic growth
Article Snippet: Plasmids expressing full-length human FUS (Addgene plasmid # 29609) and TDP-43 5FL (Addgene plasmid # 84914) was a gift from Aaron Gitler (Stanford University School of Medicine, Stanford CA). pCSCMV:tdTomato was a gift from Gerhart Ryffel (Addgene plasmid # 30530). .. Full-length TDP-43, FUS, and TDP-43 5FL were cloned into pCMV-myc vector backbone using Gibson Assembly (NEB).

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. Then the EF1-GFP cassette was then replaced with a Col2-GFP expression cassette flanked by Not1 (5’end; underlined in the primer sequence) and Sal1 (3’end; underlined in the primer sequence) restriction sites introduced by PCR amplification of pGF-4eCOL2A1 using the primers listed in , to generate a pcDH-CMV-tom/Col2-GFP lentiviral expression plasmid.

Transfection:

Article Title: Cdc14A and Cdc14B Redundantly Regulate DNA Double-Strand Break Repair
Article Snippet: Paragraph title: Plasmids, siRNAs, and transfection. ... pLKO.1 puro, pMD2.G, psPAX2, pEGFP-N1, pCAGGS, and pCSCMV:tdTomato were obtained from Addgene.

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. For production of replication-deficient lentiviral vectors, each pcDH lentiviral expression plasmid was transfected into 293T cells with the second generation packaging plasmids pSPAX-2 (Addgene ID# 12260) and pMD2.G.

Amplification:

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: .. Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. Expression plasmids for FPs-CRY2PHR and CRY2PHR-FPs were constructed by insertion of sequences encoding codon-optimized CRY2PHR (amino acids 1–498) into Nhe I and Age I sites or Eco RI, and Bam HI sites of each FP vector.

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. Then the EF1-GFP cassette was then replaced with a Col2-GFP expression cassette flanked by Not1 (5’end; underlined in the primer sequence) and Sal1 (3’end; underlined in the primer sequence) restriction sites introduced by PCR amplification of pGF-4eCOL2A1 using the primers listed in , to generate a pcDH-CMV-tom/Col2-GFP lentiviral expression plasmid.

Fluorescence:

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. Then the EF1-GFP cassette was then replaced with a Col2-GFP expression cassette flanked by Not1 (5’end; underlined in the primer sequence) and Sal1 (3’end; underlined in the primer sequence) restriction sites introduced by PCR amplification of pGF-4eCOL2A1 using the primers listed in , to generate a pcDH-CMV-tom/Col2-GFP lentiviral expression plasmid.

Synthesized:

Article Title: Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector
Article Snippet: Then sequences between AatII and BstXI on pGEMT-T were replaced with the synthesized DNA fragment PTE2A or 3P2A to obtain the cloning intermediates pGEM-T-PTE2A and pGEMT-T-3P2A. .. The templates used for PCR are: pMXs-MGT for M, G, T, pLenti-GFP (Cell Biolabs, LTV-400) for GFP, pCSCMV-tdTomato (Addgene) for Td, and piRFP670-N1 (Addgene, #45457) for iRFP670.

Mutagenesis:

Article Title: Cdc14A and Cdc14B Redundantly Regulate DNA Double-Strand Break Repair
Article Snippet: pLKO.1 puro, pMD2.G, psPAX2, pEGFP-N1, pCAGGS, and pCSCMV:tdTomato were obtained from Addgene. .. Phosphodeficient (Cdh1-4A) and phosphomimetic (Cdh1-4D) Cdh1 mutants were generated by site-directed mutagenesis in the four putative Cdk consensus sites (S40, T121, S151, and S163, mutated to alanine in Cdh1-4A or aspartic acid in Cdh1-4D) as previously described ( ).

Article Title: TDP-43 misexpression causes defects in dendritic growth
Article Snippet: Plasmids expressing full-length human FUS (Addgene plasmid # 29609) and TDP-43 5FL (Addgene plasmid # 84914) was a gift from Aaron Gitler (Stanford University School of Medicine, Stanford CA). pCSCMV:tdTomato was a gift from Gerhart Ryffel (Addgene plasmid # 30530). .. Constructs containing various mutations of TDP-43 were generated from pCMV-myc hTDP-43 plasmid by site-directed mutagenesis using QuickChange Site Directed Mutagenesis Kit (Stratagene, San Diego CA).

Polymerase Chain Reaction:

Article Title: Visualization and tracking of tumour extracellular vesicle delivery and RNA translation using multiplexed reporters
Article Snippet: Reporter constructs Palmitoylation sequences (MLCCMRRTKQ) of growth cone-associated protein (GAP43) were genetically fused to the NH2 terminus of GFP (PalmGFP) and tdTomato (PalmtdTomato) by PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. Plasmids pCAG-mGFP (Addgene plasmid 14757) (ref. ) and pCSCMV:tdTomato (Addgene plasmid 30530) (ref. ) were used as cDNA templates for GAP-43, EGFP and tdTomato ( for primers).

Article Title: Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector
Article Snippet: .. The templates used for PCR are: pMXs-MGT for M, G, T, pLenti-GFP (Cell Biolabs, LTV-400) for GFP, pCSCMV-tdTomato (Addgene) for Td, and piRFP670-N1 (Addgene, #45457) for iRFP670. .. For quad-cistronic constructs, the restriction sites used for each gene position were: first, BamHI and NheI, second, SpeI and HindIII, third, XhoI and BspEI, last, XbaI and SalI.

Article Title: In vitro and in silico multidimensional modeling of oncolytic tumor virotherapy dynamics
Article Snippet: .. Lentiviral vectors expressing fluorescent proteins PCR products containing the yellow fluorescent protein (YFP), enhanced blue fluorescent protein (eBFP), and the tdTomato genes were generated using Roche Fast-Start High Fidelity PCR kit using pCAG-YFP, CFP, pCSCMV:tdTomato (Addgene) as template DNA. .. The primers (Forward: G GGATCC ACGCCACCATGGTGAGCAAGGGCG and reverse: GAG GCGGCCGC AGTTTACTTGTACAGCTCGTCCATGCC) had restriction sites for BamHI and NotI to facilitate cloning in the lentiviral vector backbone [ ].

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: .. Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. Expression plasmids for FPs-CRY2PHR and CRY2PHR-FPs were constructed by insertion of sequences encoding codon-optimized CRY2PHR (amino acids 1–498) into Nhe I and Age I sites or Eco RI, and Bam HI sites of each FP vector.

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. Then the EF1-GFP cassette was then replaced with a Col2-GFP expression cassette flanked by Not1 (5’end; underlined in the primer sequence) and Sal1 (3’end; underlined in the primer sequence) restriction sites introduced by PCR amplification of pGF-4eCOL2A1 using the primers listed in , to generate a pcDH-CMV-tom/Col2-GFP lentiviral expression plasmid.

Construct:

Article Title: Visualization and tracking of tumour extracellular vesicle delivery and RNA translation using multiplexed reporters
Article Snippet: Paragraph title: Reporter constructs ... Plasmids pCAG-mGFP (Addgene plasmid 14757) (ref. ) and pCSCMV:tdTomato (Addgene plasmid 30530) (ref. ) were used as cDNA templates for GAP-43, EGFP and tdTomato ( for primers).

Article Title: Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector
Article Snippet: Plasmids Cloning of all constructs was performed using the pGEM-T easy vector (Promega) as an intermediate. .. The templates used for PCR are: pMXs-MGT for M, G, T, pLenti-GFP (Cell Biolabs, LTV-400) for GFP, pCSCMV-tdTomato (Addgene) for Td, and piRFP670-N1 (Addgene, #45457) for iRFP670.

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. Expression plasmids for FPs-CRY2PHR and CRY2PHR-FPs were constructed by insertion of sequences encoding codon-optimized CRY2PHR (amino acids 1–498) into Nhe I and Age I sites or Eco RI, and Bam HI sites of each FP vector.

Article Title: TDP-43 misexpression causes defects in dendritic growth
Article Snippet: Plasmids expressing full-length human FUS (Addgene plasmid # 29609) and TDP-43 5FL (Addgene plasmid # 84914) was a gift from Aaron Gitler (Stanford University School of Medicine, Stanford CA). pCSCMV:tdTomato was a gift from Gerhart Ryffel (Addgene plasmid # 30530). .. Constructs containing various mutations of TDP-43 were generated from pCMV-myc hTDP-43 plasmid by site-directed mutagenesis using QuickChange Site Directed Mutagenesis Kit (Stratagene, San Diego CA).

Sequencing:

Article Title: Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector
Article Snippet: A 6 bp stuffer sequence was placed in between each pair of endonuclease sites for gene insertion. .. The templates used for PCR are: pMXs-MGT for M, G, T, pLenti-GFP (Cell Biolabs, LTV-400) for GFP, pCSCMV-tdTomato (Addgene) for Td, and piRFP670-N1 (Addgene, #45457) for iRFP670.

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. The sequence encoding CRY2clust from pmCherry-CRY2clust was PCR-amplified using the primer pair 5′-GTA GCT AGC CAC CAT GAA GAT GGA CAA AAA GAC CAT CGT CTG-3′ (forward) and 5′-GAC TCT CGA GTG AAC CTG AAC CTG AAC CTG AAC CGT TGT CGA GGT CGG GGG GGT CC-3′ (reverse) and inserted into pmCherry-N1 (Clontech) at Nhe I and Xho I sites to generate the CRY2clust-mCherry plasmid.mCherry-CRY2clust variants, CRY2clust mutants, and CRY2 [1–507] mutants were constructed by first changing the nucleotides encoding Arg at position 489 of CRY2PHR from CGG to CGA, generating a Xho I site, and then inserting oligonucleotides encoding the C-terminus of CRY2PHR (amino acids 489–498) and CRY2clust variants or mutants, or the C-terminus of CRY2 (amino acids 489–506) and F507X mutants into the vector at Xho I and Bam HI sites.

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: To generate a lentiviral expression plasmid with mLuc under control of a Col2 promoter, pcDH-Col2-mLuc/EF1-GFP, the CMV promoter sequence was removed from pcDH-CMV-mLuc/EF1-GFP and replaced with the Col2 promoter sequence from pGF-4eCOL2A1 via compatible Spe1/BamH1 sites. .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP.

Generated:

Article Title: In vitro and in silico multidimensional modeling of oncolytic tumor virotherapy dynamics
Article Snippet: .. Lentiviral vectors expressing fluorescent proteins PCR products containing the yellow fluorescent protein (YFP), enhanced blue fluorescent protein (eBFP), and the tdTomato genes were generated using Roche Fast-Start High Fidelity PCR kit using pCAG-YFP, CFP, pCSCMV:tdTomato (Addgene) as template DNA. .. The primers (Forward: G GGATCC ACGCCACCATGGTGAGCAAGGGCG and reverse: GAG GCGGCCGC AGTTTACTTGTACAGCTCGTCCATGCC) had restriction sites for BamHI and NotI to facilitate cloning in the lentiviral vector backbone [ ].

Article Title: Cdc14A and Cdc14B Redundantly Regulate DNA Double-Strand Break Repair
Article Snippet: pLKO.1 puro, pMD2.G, psPAX2, pEGFP-N1, pCAGGS, and pCSCMV:tdTomato were obtained from Addgene. .. Phosphodeficient (Cdh1-4A) and phosphomimetic (Cdh1-4D) Cdh1 mutants were generated by site-directed mutagenesis in the four putative Cdk consensus sites (S40, T121, S151, and S163, mutated to alanine in Cdh1-4A or aspartic acid in Cdh1-4D) as previously described ( ).

Article Title: TDP-43 misexpression causes defects in dendritic growth
Article Snippet: Plasmids expressing full-length human FUS (Addgene plasmid # 29609) and TDP-43 5FL (Addgene plasmid # 84914) was a gift from Aaron Gitler (Stanford University School of Medicine, Stanford CA). pCSCMV:tdTomato was a gift from Gerhart Ryffel (Addgene plasmid # 30530). .. Constructs containing various mutations of TDP-43 were generated from pCMV-myc hTDP-43 plasmid by site-directed mutagenesis using QuickChange Site Directed Mutagenesis Kit (Stratagene, San Diego CA).

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: A modified pcDH lentiviral expression plasmid, pcDH-CMV-mLuc/EF1-GFP, containing independent CMV-mLuc and EF1-GFP expression cassettes was generated by cloning the full-length cDNA of Metridia luciferase (mLuc) from the pMetLuc reporter vector (Takara Bio, Mountain View, CA) into the multiple cloning site of pcDH-CMV-MCS-EF1-copGFP via compatible BamH1/Not1 restriction sites. .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP.

Luciferase:

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: A modified pcDH lentiviral expression plasmid, pcDH-CMV-mLuc/EF1-GFP, containing independent CMV-mLuc and EF1-GFP expression cassettes was generated by cloning the full-length cDNA of Metridia luciferase (mLuc) from the pMetLuc reporter vector (Takara Bio, Mountain View, CA) into the multiple cloning site of pcDH-CMV-MCS-EF1-copGFP via compatible BamH1/Not1 restriction sites. .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP.

Expressing:

Article Title: In vitro and in silico multidimensional modeling of oncolytic tumor virotherapy dynamics
Article Snippet: .. Lentiviral vectors expressing fluorescent proteins PCR products containing the yellow fluorescent protein (YFP), enhanced blue fluorescent protein (eBFP), and the tdTomato genes were generated using Roche Fast-Start High Fidelity PCR kit using pCAG-YFP, CFP, pCSCMV:tdTomato (Addgene) as template DNA. .. The primers (Forward: G GGATCC ACGCCACCATGGTGAGCAAGGGCG and reverse: GAG GCGGCCGC AGTTTACTTGTACAGCTCGTCCATGCC) had restriction sites for BamHI and NotI to facilitate cloning in the lentiviral vector backbone [ ].

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: .. Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. Expression plasmids for FPs-CRY2PHR and CRY2PHR-FPs were constructed by insertion of sequences encoding codon-optimized CRY2PHR (amino acids 1–498) into Nhe I and Age I sites or Eco RI, and Bam HI sites of each FP vector.

Article Title: TDP-43 misexpression causes defects in dendritic growth
Article Snippet: .. Plasmids expressing full-length human FUS (Addgene plasmid # 29609) and TDP-43 5FL (Addgene plasmid # 84914) was a gift from Aaron Gitler (Stanford University School of Medicine, Stanford CA). pCSCMV:tdTomato was a gift from Gerhart Ryffel (Addgene plasmid # 30530). .. Full-length TDP-43, FUS, and TDP-43 5FL were cloned into pCMV-myc vector backbone using Gibson Assembly (NEB).

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP. .. Then the EF1-GFP cassette was then replaced with a Col2-GFP expression cassette flanked by Not1 (5’end; underlined in the primer sequence) and Sal1 (3’end; underlined in the primer sequence) restriction sites introduced by PCR amplification of pGF-4eCOL2A1 using the primers listed in , to generate a pcDH-CMV-tom/Col2-GFP lentiviral expression plasmid.

Modification:

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: A modified pcDH lentiviral expression plasmid, pcDH-CMV-mLuc/EF1-GFP, containing independent CMV-mLuc and EF1-GFP expression cassettes was generated by cloning the full-length cDNA of Metridia luciferase (mLuc) from the pMetLuc reporter vector (Takara Bio, Mountain View, CA) into the multiple cloning site of pcDH-CMV-MCS-EF1-copGFP via compatible BamH1/Not1 restriction sites. .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP.

CTG Assay:

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. The sequence encoding CRY2clust from pmCherry-CRY2clust was PCR-amplified using the primer pair 5′-GTA GCT AGC CAC CAT GAA GAT GGA CAA AAA GAC CAT CGT CTG-3′ (forward) and 5′-GAC TCT CGA GTG AAC CTG AAC CTG AAC CTG AAC CGT TGT CGA GGT CGG GGG GGT CC-3′ (reverse) and inserted into pmCherry-N1 (Clontech) at Nhe I and Xho I sites to generate the CRY2clust-mCherry plasmid.mCherry-CRY2clust variants, CRY2clust mutants, and CRY2 [1–507] mutants were constructed by first changing the nucleotides encoding Arg at position 489 of CRY2PHR from CGG to CGA, generating a Xho I site, and then inserting oligonucleotides encoding the C-terminus of CRY2PHR (amino acids 489–498) and CRY2clust variants or mutants, or the C-terminus of CRY2 (amino acids 489–506) and F507X mutants into the vector at Xho I and Bam HI sites.

Chloramphenicol Acetyltransferase Assay:

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. The sequence encoding CRY2clust from pmCherry-CRY2clust was PCR-amplified using the primer pair 5′-GTA GCT AGC CAC CAT GAA GAT GGA CAA AAA GAC CAT CGT CTG-3′ (forward) and 5′-GAC TCT CGA GTG AAC CTG AAC CTG AAC CTG AAC CGT TGT CGA GGT CGG GGG GGT CC-3′ (reverse) and inserted into pmCherry-N1 (Clontech) at Nhe I and Xho I sites to generate the CRY2clust-mCherry plasmid.mCherry-CRY2clust variants, CRY2clust mutants, and CRY2 [1–507] mutants were constructed by first changing the nucleotides encoding Arg at position 489 of CRY2PHR from CGG to CGA, generating a Xho I site, and then inserting oligonucleotides encoding the C-terminus of CRY2PHR (amino acids 489–498) and CRY2clust variants or mutants, or the C-terminus of CRY2 (amino acids 489–506) and F507X mutants into the vector at Xho I and Bam HI sites.

Cellular Antioxidant Activity Assay:

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. The sequence encoding CRY2clust from pmCherry-CRY2clust was PCR-amplified using the primer pair 5′-GTA GCT AGC CAC CAT GAA GAT GGA CAA AAA GAC CAT CGT CTG-3′ (forward) and 5′-GAC TCT CGA GTG AAC CTG AAC CTG AAC CTG AAC CGT TGT CGA GGT CGG GGG GGT CC-3′ (reverse) and inserted into pmCherry-N1 (Clontech) at Nhe I and Xho I sites to generate the CRY2clust-mCherry plasmid.mCherry-CRY2clust variants, CRY2clust mutants, and CRY2 [1–507] mutants were constructed by first changing the nucleotides encoding Arg at position 489 of CRY2PHR from CGG to CGA, generating a Xho I site, and then inserting oligonucleotides encoding the C-terminus of CRY2PHR (amino acids 489–498) and CRY2clust variants or mutants, or the C-terminus of CRY2 (amino acids 489–506) and F507X mutants into the vector at Xho I and Bam HI sites.

Plasmid Preparation:

Article Title: Visualization and tracking of tumour extracellular vesicle delivery and RNA translation using multiplexed reporters
Article Snippet: .. Plasmids pCAG-mGFP (Addgene plasmid 14757) (ref. ) and pCSCMV:tdTomato (Addgene plasmid 30530) (ref. ) were used as cDNA templates for GAP-43, EGFP and tdTomato ( for primers). .. PalmGFP and PalmtdTomato sequences were inserted at NheI and XhoI sites of CSCGW2 lentivector plasmid kindly provided by Dr Miguel Sena-Esteves (University of Massachusetts Medical School, Worcester, MA, USA) , tagged with MS24X repeats between PspOMI and HpaI sites followed by β-actin 3′ UTR (a kind gift from Dr Robert Singer, Albert Einstein College of Medicine, Bronx, NY, USA) between HpaI and XhoI sites.

Article Title: Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector
Article Snippet: Plasmids Cloning of all constructs was performed using the pGEM-T easy vector (Promega) as an intermediate. .. The templates used for PCR are: pMXs-MGT for M, G, T, pLenti-GFP (Cell Biolabs, LTV-400) for GFP, pCSCMV-tdTomato (Addgene) for Td, and piRFP670-N1 (Addgene, #45457) for iRFP670.

Article Title: In vitro and in silico multidimensional modeling of oncolytic tumor virotherapy dynamics
Article Snippet: Lentiviral vectors expressing fluorescent proteins PCR products containing the yellow fluorescent protein (YFP), enhanced blue fluorescent protein (eBFP), and the tdTomato genes were generated using Roche Fast-Start High Fidelity PCR kit using pCAG-YFP, CFP, pCSCMV:tdTomato (Addgene) as template DNA. .. The primers (Forward: G GGATCC ACGCCACCATGGTGAGCAAGGGCG and reverse: GAG GCGGCCGC AGTTTACTTGTACAGCTCGTCCATGCC) had restriction sites for BamHI and NotI to facilitate cloning in the lentiviral vector backbone [ ].

Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2
Article Snippet: .. Expression plasmids for pCypet-C1 (Addgene plasmid #54649, a gift from Patrick Daugherty and Michael Davidson), pYpet-C1 (Addgene plasmid #54648, a gift from Patrick Daugherty and Michael Davidson), FusionRed-C1 (Addgene plasmid #54777, a gift from Michael Davidson) , mRFP-C1 (Addgene plasmid #54764, a gift from Robert Campbell, Michael Davidson, and Roger Tsien) and R-GECO1 (Addgene plasmid #32444, a gift from Robert Campbell) were obtained from Addgene. dTomato , tdTomato , or Ruby 2 cDNA from paavCAG-post-mGRASP-2A-dTomato (Addgene plasmid #34912, a gift from Jinhyun Kim) , pCSCMV:tdTomato (Addgene plasmid #30530, a gift from GerhartRyffel) and pcDNA3-mRuby2 (Addgene plasmid #40260, a gift from Michael Lin) , respectively, flanked by Age I and Bsr GI restriction sites, were amplified by polymerase chain reaction (PCR) and inserted into pECFP-C1 after excision of ECFP by digestion with AgeI and BsrGI, to generate dTomato-C1, tdTomato-C1 and Ruby2-C1 vectors. .. Expression plasmids for FPs-CRY2PHR and CRY2PHR-FPs were constructed by insertion of sequences encoding codon-optimized CRY2PHR (amino acids 1–498) into Nhe I and Age I sites or Eco RI, and Bam HI sites of each FP vector.

Article Title: Cdc14A and Cdc14B Redundantly Regulate DNA Double-Strand Break Repair
Article Snippet: pLKO.1 puro, pMD2.G, psPAX2, pEGFP-N1, pCAGGS, and pCSCMV:tdTomato were obtained from Addgene. .. Short hairpin RNAs (shRNAs) against Cdc14A, Cdc14B, and Cdh1 (shCdc14A, shCdc14B, and shCdh1, respectively) were designed with the vector pLKO.1 puro as previously described ( , ) using oligonucleotides targeting the following sequences: mouse Cdc14A (AAGATAGTGCACTACACCTCT), human Cdc14A (AAGCACAGTAAATACCCACTA), human Cdc14B (AATATGAGAACTTCTACGCAG), and mouse Cdh1 (AACACGCTCTACAAAGGAATC).

Article Title: TDP-43 misexpression causes defects in dendritic growth
Article Snippet: .. Plasmids expressing full-length human FUS (Addgene plasmid # 29609) and TDP-43 5FL (Addgene plasmid # 84914) was a gift from Aaron Gitler (Stanford University School of Medicine, Stanford CA). pCSCMV:tdTomato was a gift from Gerhart Ryffel (Addgene plasmid # 30530). .. Full-length TDP-43, FUS, and TDP-43 5FL were cloned into pCMV-myc vector backbone using Gibson Assembly (NEB).

Article Title: Lentiviral-based reporter constructs for profiling chondrogenic activity in primary equine cell populations
Article Snippet: To generate a lentiviral expression plasmid with mLuc under control of a Col2 promoter, pcDH-Col2-mLuc/EF1-GFP, the CMV promoter sequence was removed from pcDH-CMV-mLuc/EF1-GFP and replaced with the Col2 promoter sequence from pGF-4eCOL2A1 via compatible Spe1/BamH1 sites. .. For generation of a dual fluorescence reporter containing independent CMV-tom and Col2-GFP expression cassettes, the full length cDNA of tdtomato was obtained by BamH1/Not1 digestion of pCSCMV:tdtomato (Addgene ID# 30530) and cloned into the multiple cloning site of pcDH to generate pcDH-CMV-tom/EF1-GFP.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Addgene inc pcscmv tdtomato
    Pcscmv Tdtomato, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcscmv tdtomato/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcscmv tdtomato - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    91
    Addgene inc tomato red
    Tomato Red, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tomato red/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tomato red - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    Image Search Results