Structured Review

Meridian Life Science pcr mix
Pcr Mix, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr mix/product/Meridian Life Science
Average 94 stars, based on 19 article reviews
Price from $9.99 to $1999.99
pcr mix - by Bioz Stars, 2020-04
94/100 stars

Images

Related Articles

Amplification:

Article Title: Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes
Article Snippet: The resulting cDNA was next amplified by multiplex PCR according to Chikh-Ali et al. [ ] with some modifications. .. The PCR mixture (10 µl) contained: 1-3 µl of cDNA; 0.2 U of uracil DNA glycosylase (UNG) (Bioline); 0.4 mM dNTPs (including dU instead of dT); 2 mM MgCl2 ; 0.2 mM primers n156, o514, n787, o2172, o2700; 0.1 mM primers n2258, n2650c; 0.6 mM primers n7577, SeroN, Y03-8648; 1 µl of 10-fold-concentrated polymerase buffer, and 0.6 U of GoTaq HotStart Polymerase (Promega).

Article Title: Rifampicin Resistance in Tuberculosis Outbreak, London, England
Article Snippet: Ten microliters of DNA was added to the PCR mix containing 81.4 μL PCR-quality water, 10 μL potassium chloride buffer (Bioline Ltd., London, UK), 0.4 μL of each primer (100 mmol) (Sigma-Genosys Ltd., Haverhill, UK), 3 μL deoxynucleoside triphosphates (5 mmol), and 1 μL Taq (Bioline). .. The amplification was performed on a Techgene thermal cycler (Techne, Princeton, NJ, USA).

Article Title: Molecular epidemiology of malaria parasite amongst patients in a displaced people’s camp in Sudan
Article Snippet: In the first PCR round, amplification was performed using rPLU1 and rPLU5 primers for Plasmodium genus determination. .. The PCR mixture was prepared in a total volume of 20 μl, containing 10 μl of MyTaq™ mix (Bioline, UK), 0.4 μM of each primer and 2.5 μl of extracted DNA.

Article Title: The N-linking glycosylation system from Actinobacillus pleuropneumoniae is required for adhesion and has potential use in glycoengineering
Article Snippet: .. For each sample, 2 µl of reverse transcribed cDNA was used as a template in a 25 µl total volume PCR mixture and amplified using MyTaq master mix (Bioline, UK) using the following cycling conditions: 94°C/30 s, followed by 35 cycles of 94°C/10 s, 53°C/10 s, 72°C/10 s and a final single 72°C/30 s cycle using the primers listed in electronic supplementary material, table S2. .. Quantitative real-time PCR validation Total RNA was extracted from bacteria grown in BHI–NAD broth by using Tri Reagent (Sigma, UK) as previously described.

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl. .. DNA amplification was performed for 35 cycles consisting of denaturation for 1 min at 94°C, annealing for 30 s at 50°C, and elongation for 1 min at 72°C with an automated Phoenix DNA Thermocycler (Helena BioSciences, Sunderland, United Kingdom).

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: Paragraph title: PCR amplification of 16S rRNA. ... The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 1.5 μl 50 mM MgCl2 , 1 μl of each primer (20 pmol), 1 μl 100 mM deoxynucleoside triphosphate (dNTP), 38.1 μl H2 O, 2 U (0.4 μl) BioTaq (Bioline), and 2 μl of template DNA.

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: The ITS region was amplified with the primers ITS1 and ITS4 , the LSU region with the primers LR0R and LR5 , the CAL gene (for Juglanconidaceae ) with primers CAL-228F and CAL-737R , the RPB2 region with primers fRPB2-5F and fRPB2-7cR , the TEF1-α gene with the primers EF1-728F and EF1-LLErev for Melanconiellaceae ( , ) and the primers EF1-983F and EF1-1567R for Melanconidaceae ( , ). .. The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline).

Electrophoresis:

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 2 μl 50 mM MgCl2 , 1 μl of each of the 6 primers (20 pmol), 1 μl 100 mM dNTP, 33.6 μl H2 O, 2.5 U (0.5 μl) BioTaq (Bioline), and 2 μl of template DNA. .. PCR products were separated on a 2% Tris-acetate-EDTA buffer (TAE) agarose electrophoresis gel stained with Sybr Safe (5 μl/100 ml).

Article Title: Vascular Endothelial Growth Factor (VEGF) Bioavailability Regulates Angiogenesis and Intestinal Stem and Progenitor Cell Proliferation during Postnatal Small Intestinal Development
Article Snippet: The genotyping PCR mix consisted of 10 μL MyTaq Red Mix (Bioline; Cat# BIO-25043), 0.1 μL 100 μM forward (F) primer, 0.1 μL 100 μM reverse (R) primer (Eurofins MWG Operon, ), 8.8 μL RNase-free water, and 1 μL mouse DNA for a total of 20 μL PCR reaction. .. A 1% agarose (Denville Scientific; Cat# CA3510-8) with 1:1000 ethidium bromide (Promega Corporation; Cat# H5041) electrophoresis gel was prepared and 10 μL of mix was run at 100V for 30 minutes and visualized under a UV light.

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline). .. The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline).

Incubation:

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: DNA was isolated from 1 ml of a late-exponential-phase culture (OD at 600 nm of about 1.0) in MRS medium using a PUREGENE DNA isolation kit (Philip Harris/Flowgen, Shenstone, United Kingdom) modified by the addition of 140 U of mutanolysin (Sigma) per ml to the lytic enzyme solution and incubation of the cell suspension at 37°C for 45 min. .. The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl.

Infection:

Article Title: Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes
Article Snippet: Samsun) infected with PVY isolates Bonin 1-3, PVYO (PV-0345), PVYN-Wi (EF558545), PVYN (PV-0348), and PVYNTN (PV-0403). .. The PCR mixture (10 µl) contained: 1-3 µl of cDNA; 0.2 U of uracil DNA glycosylase (UNG) (Bioline); 0.4 mM dNTPs (including dU instead of dT); 2 mM MgCl2 ; 0.2 mM primers n156, o514, n787, o2172, o2700; 0.1 mM primers n2258, n2650c; 0.6 mM primers n7577, SeroN, Y03-8648; 1 µl of 10-fold-concentrated polymerase buffer, and 0.6 U of GoTaq HotStart Polymerase (Promega).

Modification:

Article Title: The N-linking glycosylation system from Actinobacillus pleuropneumoniae is required for adhesion and has potential use in glycoengineering
Article Snippet: At the time points of 1.5, 3.0, 5 and 24 h, RNA was extracted as previously described [ ], with the minor modification that 2 µg of total RNA from each sample was treated with Ambion TURBO DNase (Invitrogen) according to the manufacturer's instructions. cDNA was generated from DNase-treated RNA using the SuperScript II kit (Invitrogen) according to the manufacturer's instructions. .. For each sample, 2 µl of reverse transcribed cDNA was used as a template in a 25 µl total volume PCR mixture and amplified using MyTaq master mix (Bioline, UK) using the following cycling conditions: 94°C/30 s, followed by 35 cycles of 94°C/10 s, 53°C/10 s, 72°C/10 s and a final single 72°C/30 s cycle using the primers listed in electronic supplementary material, table S2.

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: DNA was isolated from 1 ml of a late-exponential-phase culture (OD at 600 nm of about 1.0) in MRS medium using a PUREGENE DNA isolation kit (Philip Harris/Flowgen, Shenstone, United Kingdom) modified by the addition of 140 U of mutanolysin (Sigma) per ml to the lytic enzyme solution and incubation of the cell suspension at 37°C for 45 min. .. The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl.

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: Genomic DNA was extracted using a modified CTAB method, with fungal mycelium harvested from PDA plates with cellophane ( ). .. The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline).

Over Expression:

Article Title: Vascular Endothelial Growth Factor (VEGF) Bioavailability Regulates Angiogenesis and Intestinal Stem and Progenitor Cell Proliferation during Postnatal Small Intestinal Development
Article Snippet: The doxycycline chow induced overexpression of VEGF or sFlt-1 in the pups via the mother’s breast milk. .. The genotyping PCR mix consisted of 10 μL MyTaq Red Mix (Bioline; Cat# BIO-25043), 0.1 μL 100 μM forward (F) primer, 0.1 μL 100 μM reverse (R) primer (Eurofins MWG Operon, ), 8.8 μL RNase-free water, and 1 μL mouse DNA for a total of 20 μL PCR reaction.

Derivative Assay:

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: The pdc gene was detected by PCR using primers PCD 489F (5′-AACGGCTGGGAATACGA-3′) and PCD 813R (5′-GCAAATTCGGGTACAAC-3′), derived from an alignment of three decarboxylase genes: L. plantarum pdc (accession no. ), Bacillus pumilus ferulate decarboxylase (accession no. ), and Bacillus subtilis phenolic acid decarboxylase (accession no. ). .. The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl.

Sequencing:

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: Paragraph title: DNA extraction and sequencing ... The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline).

Cell Culture:

Article Title: Simultaneous Identification of Mycobacterial Isolates to the Species Level and Determination of Tuberculosis Drug Resistance by PCR Followed by Electrospray Ionization Mass Spectrometry ▿Simultaneous Identification of Mycobacterial Isolates to the Species Level and Determination of Tuberculosis Drug Resistance by PCR Followed by Electrospray Ionization Mass Spectrometry ▿ †
Article Snippet: Genomic material from cultured samples was prepared using the DNeasy tissue kit (Qiagen, Valencia, CA) according to the manufacturer's protocols. .. The PCR mix consisted of 1 unit of Immolase (Bioline, Taunton, MA), 1× buffer II, 1.5 mM MgCl2 , 0.4 M betaine, 800 μM deoxynucleoside triphosphate mix, and 250 nM each primer.

Generated:

Article Title: The N-linking glycosylation system from Actinobacillus pleuropneumoniae is required for adhesion and has potential use in glycoengineering
Article Snippet: At the time points of 1.5, 3.0, 5 and 24 h, RNA was extracted as previously described [ ], with the minor modification that 2 µg of total RNA from each sample was treated with Ambion TURBO DNase (Invitrogen) according to the manufacturer's instructions. cDNA was generated from DNase-treated RNA using the SuperScript II kit (Invitrogen) according to the manufacturer's instructions. .. For each sample, 2 µl of reverse transcribed cDNA was used as a template in a 25 µl total volume PCR mixture and amplified using MyTaq master mix (Bioline, UK) using the following cycling conditions: 94°C/30 s, followed by 35 cycles of 94°C/10 s, 53°C/10 s, 72°C/10 s and a final single 72°C/30 s cycle using the primers listed in electronic supplementary material, table S2.

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 2 μl 50 mM MgCl2 , 1 μl of each of the 6 primers (20 pmol), 1 μl 100 mM dNTP, 33.6 μl H2 O, 2.5 U (0.5 μl) BioTaq (Bioline), and 2 μl of template DNA. .. The isolates were assigned to genetic clusters on the basis of the presence or absence of 279-, 211-, and 152-bp fragments generated by the primer sets.

DNA Sequencing:

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline). .. The DNA sequencing was performed using an ABI PRISM 3730XL DNA Analyzer with BigDye Terminater Kit v. 3.1 (Invitrogen) at the Shanghai Invitrogen Biological Technology Company Limited (Beijing, China).

Polymerase Chain Reaction:

Article Title: Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes
Article Snippet: .. The PCR mixture (10 µl) contained: 1-3 µl of cDNA; 0.2 U of uracil DNA glycosylase (UNG) (Bioline); 0.4 mM dNTPs (including dU instead of dT); 2 mM MgCl2 ; 0.2 mM primers n156, o514, n787, o2172, o2700; 0.1 mM primers n2258, n2650c; 0.6 mM primers n7577, SeroN, Y03-8648; 1 µl of 10-fold-concentrated polymerase buffer, and 0.6 U of GoTaq HotStart Polymerase (Promega). ..

Article Title: Rifampicin Resistance in Tuberculosis Outbreak, London, England
Article Snippet: .. Ten microliters of DNA was added to the PCR mix containing 81.4 μL PCR-quality water, 10 μL potassium chloride buffer (Bioline Ltd., London, UK), 0.4 μL of each primer (100 mmol) (Sigma-Genosys Ltd., Haverhill, UK), 3 μL deoxynucleoside triphosphates (5 mmol), and 1 μL Taq (Bioline). .. The amplification was performed on a Techgene thermal cycler (Techne, Princeton, NJ, USA).

Article Title: Recommendations for application of Haemophilus influenzae PCR diagnostics to respiratory specimens for children living in northern Australia: a retrospective re-analysis
Article Snippet: .. Briefly, the PCR mix comprised 5 µl of Bioline 2 × SensiMix SYBR Green (QT650-02), 100 nM each of forward and reverse primer, and 1 µl of sample supernatant to a total of 10 µl per reaction. .. Analysis of the HRM was performed on the Rotorgene software (version 1.7).

Article Title: Molecular epidemiology of malaria parasite amongst patients in a displaced people’s camp in Sudan
Article Snippet: .. The PCR mixture was prepared in a total volume of 20 μl, containing 10 μl of MyTaq™ mix (Bioline, UK), 0.4 μM of each primer and 2.5 μl of extracted DNA. .. PCR was performed under the following conditions: 94 °C for 5 min as the initial denaturation step; 25 cycles at 94 °C for 45 s, 58 °C for 45 s and 72 °C for 1 min; and a final extension step at 72 °C for 5 min.

Article Title: The N-linking glycosylation system from Actinobacillus pleuropneumoniae is required for adhesion and has potential use in glycoengineering
Article Snippet: .. For each sample, 2 µl of reverse transcribed cDNA was used as a template in a 25 µl total volume PCR mixture and amplified using MyTaq master mix (Bioline, UK) using the following cycling conditions: 94°C/30 s, followed by 35 cycles of 94°C/10 s, 53°C/10 s, 72°C/10 s and a final single 72°C/30 s cycle using the primers listed in electronic supplementary material, table S2. .. Quantitative real-time PCR validation Total RNA was extracted from bacteria grown in BHI–NAD broth by using Tri Reagent (Sigma, UK) as previously described.

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: .. The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 2 μl 50 mM MgCl2 , 1 μl of each of the 6 primers (20 pmol), 1 μl 100 mM dNTP, 33.6 μl H2 O, 2.5 U (0.5 μl) BioTaq (Bioline), and 2 μl of template DNA. .. The PCR steps were as follows: denaturation for 4 min at 94°C, 30 cycles of 5 s at 94°C and 10 s at 59°C, and a final extension step of 5 min at 72°C.

Article Title: Pathways of Ca2+ entry and cytoskeletal damage following eccentric contractions in mouse skeletal muscle
Article Snippet: .. To distinguish the TRPC1 −/− (KO) from the TRPC1 +/+ (WT) mice, 3 μg of mouse tail genomic DNA was added to a PCR mix containing: 2 μl of 10 × PCR reaction buffer, 4 μl of 5 × GC-Rich Buffer, 1.5 mM MgCl2 , 200 μM dNTPs (Bioline), 300 μM of both forward and reverse primers (Sigma-Aldrich), 0.4–0.8 Units of FastStart Taq DNA Polymerase. .. The following primers were used to identify WT mice (forward) tccctttacttggcaaccttt and (reverse) ttggcaaaatgaggataatga and KO mice (forward) tctatggcttctgaggcgga and (reverse) gcattattaatatctgagtcattttcttattggcaaaatgagc.

Article Title: Simultaneous Identification of Mycobacterial Isolates to the Species Level and Determination of Tuberculosis Drug Resistance by PCR Followed by Electrospray Ionization Mass Spectrometry ▿Simultaneous Identification of Mycobacterial Isolates to the Species Level and Determination of Tuberculosis Drug Resistance by PCR Followed by Electrospray Ionization Mass Spectrometry ▿ †
Article Snippet: .. The PCR mix consisted of 1 unit of Immolase (Bioline, Taunton, MA), 1× buffer II, 1.5 mM MgCl2 , 0.4 M betaine, 800 μM deoxynucleoside triphosphate mix, and 250 nM each primer. .. The following PCR conditions were used to amplify the sequences used for PCR/ESI-MS analysis: 95°C for 10 min, followed by eight cycles of 95°C for 30 s, 48°C for 30 s, and 72°C for 30 s, with the 48°C annealing temperature increasing 0.9°C each cycle.

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: .. The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl. .. DNA amplification was performed for 35 cycles consisting of denaturation for 1 min at 94°C, annealing for 30 s at 50°C, and elongation for 1 min at 72°C with an automated Phoenix DNA Thermocycler (Helena BioSciences, Sunderland, United Kingdom).

Article Title: Vascular Endothelial Growth Factor (VEGF) Bioavailability Regulates Angiogenesis and Intestinal Stem and Progenitor Cell Proliferation during Postnatal Small Intestinal Development
Article Snippet: .. The genotyping PCR mix consisted of 10 μL MyTaq Red Mix (Bioline; Cat# BIO-25043), 0.1 μL 100 μM forward (F) primer, 0.1 μL 100 μM reverse (R) primer (Eurofins MWG Operon, ), 8.8 μL RNase-free water, and 1 μL mouse DNA for a total of 20 μL PCR reaction. .. This was placed in a 0.2 μL PCR tube.

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: .. The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 1.5 μl 50 mM MgCl2 , 1 μl of each primer (20 pmol), 1 μl 100 mM deoxynucleoside triphosphate (dNTP), 38.1 μl H2 O, 2 U (0.4 μl) BioTaq (Bioline), and 2 μl of template DNA. .. The PCR was performed with an Eppendorf Mastercycler gradient (model 5331) with the following steps: denaturation for 3 min at 94°C; 30 cycles of 45 s at 94°C, 45 s at 55°C, and 1 min at 72°C; and a final extension step of 5 min at 72°C.

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: .. The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline). .. Conditions for PCR of ITS and LSU regions constituted an initial denaturation step of 2 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, 45 s at 51 °C and 1 min at 72 °C and a final extension step of 8 min at 72 °C, while the TEF1-α gene was performed using an initial denaturation step of 2 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, 45 s at 56 °C and 1 min at 72 °C and a final extension step of 8 min at 72 °C.

DNA Extraction:

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: DNA was isolated from 1 ml of a late-exponential-phase culture (OD at 600 nm of about 1.0) in MRS medium using a PUREGENE DNA isolation kit (Philip Harris/Flowgen, Shenstone, United Kingdom) modified by the addition of 140 U of mutanolysin (Sigma) per ml to the lytic enzyme solution and incubation of the cell suspension at 37°C for 45 min. .. The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl.

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: Paragraph title: DNA extraction and sequencing ... The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline).

Nucleic Acid Electrophoresis:

Article Title: Rifampicin Resistance in Tuberculosis Outbreak, London, England
Article Snippet: Ten microliters of DNA was added to the PCR mix containing 81.4 μL PCR-quality water, 10 μL potassium chloride buffer (Bioline Ltd., London, UK), 0.4 μL of each primer (100 mmol) (Sigma-Genosys Ltd., Haverhill, UK), 3 μL deoxynucleoside triphosphates (5 mmol), and 1 μL Taq (Bioline). .. PCR products were separated by gel electrophoresis on a 1.5% agarose gel, and DNA bands were stained with ethidium bromide.

Mutagenesis:

Article Title: Vascular Endothelial Growth Factor (VEGF) Bioavailability Regulates Angiogenesis and Intestinal Stem and Progenitor Cell Proliferation during Postnatal Small Intestinal Development
Article Snippet: Paragraph title: Generation of VillinCre /rtTAflox/flox /tet(o)VEGF and VillinCre /rtTAflox/flox /tet(o)s-Flt1 (sFlt-1 mutants) mutant mice, Transgene PCR, and Tissue Collection ... The genotyping PCR mix consisted of 10 μL MyTaq Red Mix (Bioline; Cat# BIO-25043), 0.1 μL 100 μM forward (F) primer, 0.1 μL 100 μM reverse (R) primer (Eurofins MWG Operon, ), 8.8 μL RNase-free water, and 1 μL mouse DNA for a total of 20 μL PCR reaction.

Isolation:

Article Title: Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes
Article Snippet: Strain identification by multiplex RT-PCR Total RNA was isolated according to Zacharzewska et al. [ ] from tobacco leaves (cv. .. The PCR mixture (10 µl) contained: 1-3 µl of cDNA; 0.2 U of uracil DNA glycosylase (UNG) (Bioline); 0.4 mM dNTPs (including dU instead of dT); 2 mM MgCl2 ; 0.2 mM primers n156, o514, n787, o2172, o2700; 0.1 mM primers n2258, n2650c; 0.6 mM primers n7577, SeroN, Y03-8648; 1 µl of 10-fold-concentrated polymerase buffer, and 0.6 U of GoTaq HotStart Polymerase (Promega).

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: DNA was isolated from 1 ml of a late-exponential-phase culture (OD at 600 nm of about 1.0) in MRS medium using a PUREGENE DNA isolation kit (Philip Harris/Flowgen, Shenstone, United Kingdom) modified by the addition of 140 U of mutanolysin (Sigma) per ml to the lytic enzyme solution and incubation of the cell suspension at 37°C for 45 min. .. The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl.

Labeling:

Article Title: Decarboxylation of Substituted Cinnamic Acids by Lactic Acid Bacteria Isolated during Malt Whisky Fermentation
Article Snippet: The PCR mixture contained 5 μl of 10× Taq DNA polymerase buffer, 1 μl of deoxynucleoside triphosphate mix (12.5 mM), 2 mM MgCl2 , 100 nM each primer, 20 ng of genomic template DNA, and 1 U of Taq DNA polymerase (Bioline, London, United Kingdom) in a final volume of 50 μl. .. The following cycling profile was used: denaturation at 96°C for 15 s, primer annealing at 45°C for 15 s, and elongation at 60°C for 60 s. The energy transfer dye terminator chemistry supplied with the MegaBACE dye terminator ready mix (Amersham Pharmacia Biotech AB, Uppsala, Sweden) was used as described by the manufacturer for labeling the fragments.

Mouse Assay:

Article Title: Pathways of Ca2+ entry and cytoskeletal damage following eccentric contractions in mouse skeletal muscle
Article Snippet: .. To distinguish the TRPC1 −/− (KO) from the TRPC1 +/+ (WT) mice, 3 μg of mouse tail genomic DNA was added to a PCR mix containing: 2 μl of 10 × PCR reaction buffer, 4 μl of 5 × GC-Rich Buffer, 1.5 mM MgCl2 , 200 μM dNTPs (Bioline), 300 μM of both forward and reverse primers (Sigma-Aldrich), 0.4–0.8 Units of FastStart Taq DNA Polymerase. .. The following primers were used to identify WT mice (forward) tccctttacttggcaaccttt and (reverse) ttggcaaaatgaggataatga and KO mice (forward) tctatggcttctgaggcgga and (reverse) gcattattaatatctgagtcattttcttattggcaaaatgagc.

Article Title: Vascular Endothelial Growth Factor (VEGF) Bioavailability Regulates Angiogenesis and Intestinal Stem and Progenitor Cell Proliferation during Postnatal Small Intestinal Development
Article Snippet: Paragraph title: Generation of VillinCre /rtTAflox/flox /tet(o)VEGF and VillinCre /rtTAflox/flox /tet(o)s-Flt1 (sFlt-1 mutants) mutant mice, Transgene PCR, and Tissue Collection ... The genotyping PCR mix consisted of 10 μL MyTaq Red Mix (Bioline; Cat# BIO-25043), 0.1 μL 100 μM forward (F) primer, 0.1 μL 100 μM reverse (R) primer (Eurofins MWG Operon, ), 8.8 μL RNase-free water, and 1 μL mouse DNA for a total of 20 μL PCR reaction.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes
Article Snippet: Paragraph title: Strain identification by multiplex RT-PCR ... The PCR mixture (10 µl) contained: 1-3 µl of cDNA; 0.2 U of uracil DNA glycosylase (UNG) (Bioline); 0.4 mM dNTPs (including dU instead of dT); 2 mM MgCl2 ; 0.2 mM primers n156, o514, n787, o2172, o2700; 0.1 mM primers n2258, n2650c; 0.6 mM primers n7577, SeroN, Y03-8648; 1 µl of 10-fold-concentrated polymerase buffer, and 0.6 U of GoTaq HotStart Polymerase (Promega).

Lysis:

Article Title: Recommendations for application of Haemophilus influenzae PCR diagnostics to respiratory specimens for children living in northern Australia: a retrospective re-analysis
Article Snippet: PCR methods and assays Samples were prepared for PCR using a colony lysis method; 1–2 colonies from a subculture of each original NTHi isolate were suspended in 200 μl of sterile water, heated at 100 °C for 10 min, cooled on ice, and centrifuged at 12,000 RPM for 2 min to pellet any cellular debris. .. Briefly, the PCR mix comprised 5 µl of Bioline 2 × SensiMix SYBR Green (QT650-02), 100 nM each of forward and reverse primer, and 1 µl of sample supernatant to a total of 10 µl per reaction.

Nested PCR:

Article Title: Molecular epidemiology of malaria parasite amongst patients in a displaced people’s camp in Sudan
Article Snippet: PCR for Plasmodium detection Nested PCR (nPCR) was performed as described previously [ ] in a two-step procedure. .. The PCR mixture was prepared in a total volume of 20 μl, containing 10 μl of MyTaq™ mix (Bioline, UK), 0.4 μM of each primer and 2.5 μl of extracted DNA.

Software:

Article Title: Recommendations for application of Haemophilus influenzae PCR diagnostics to respiratory specimens for children living in northern Australia: a retrospective re-analysis
Article Snippet: Briefly, the PCR mix comprised 5 µl of Bioline 2 × SensiMix SYBR Green (QT650-02), 100 nM each of forward and reverse primer, and 1 µl of sample supernatant to a total of 10 µl per reaction. .. Analysis of the HRM was performed on the Rotorgene software (version 1.7).

SYBR Green Assay:

Article Title: Recommendations for application of Haemophilus influenzae PCR diagnostics to respiratory specimens for children living in northern Australia: a retrospective re-analysis
Article Snippet: .. Briefly, the PCR mix comprised 5 µl of Bioline 2 × SensiMix SYBR Green (QT650-02), 100 nM each of forward and reverse primer, and 1 µl of sample supernatant to a total of 10 µl per reaction. .. Analysis of the HRM was performed on the Rotorgene software (version 1.7).

Multiplex Assay:

Article Title: Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes
Article Snippet: Paragraph title: Strain identification by multiplex RT-PCR ... The PCR mixture (10 µl) contained: 1-3 µl of cDNA; 0.2 U of uracil DNA glycosylase (UNG) (Bioline); 0.4 mM dNTPs (including dU instead of dT); 2 mM MgCl2 ; 0.2 mM primers n156, o514, n787, o2172, o2700; 0.1 mM primers n2258, n2650c; 0.6 mM primers n7577, SeroN, Y03-8648; 1 µl of 10-fold-concentrated polymerase buffer, and 0.6 U of GoTaq HotStart Polymerase (Promega).

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: Paragraph title: Multiplex PCR. ... The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 2 μl 50 mM MgCl2 , 1 μl of each of the 6 primers (20 pmol), 1 μl 100 mM dNTP, 33.6 μl H2 O, 2.5 U (0.5 μl) BioTaq (Bioline), and 2 μl of template DNA.

Agarose Gel Electrophoresis:

Article Title: Rifampicin Resistance in Tuberculosis Outbreak, London, England
Article Snippet: Ten microliters of DNA was added to the PCR mix containing 81.4 μL PCR-quality water, 10 μL potassium chloride buffer (Bioline Ltd., London, UK), 0.4 μL of each primer (100 mmol) (Sigma-Genosys Ltd., Haverhill, UK), 3 μL deoxynucleoside triphosphates (5 mmol), and 1 μL Taq (Bioline). .. PCR products were separated by gel electrophoresis on a 1.5% agarose gel, and DNA bands were stained with ethidium bromide.

Article Title: Taxonomic circumscription of melanconis-like fungi causing canker disease in China
Article Snippet: The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline). .. The PCR mixture for all the regions consisted of 1 μl genomic DNA, 3 mM MgCl2 , 20 μM of each dNTP, 0.2 μM of each primer and 0.25 U BIOTAQ DNA polymerase (Bioline).

Staining:

Article Title: Rifampicin Resistance in Tuberculosis Outbreak, London, England
Article Snippet: Ten microliters of DNA was added to the PCR mix containing 81.4 μL PCR-quality water, 10 μL potassium chloride buffer (Bioline Ltd., London, UK), 0.4 μL of each primer (100 mmol) (Sigma-Genosys Ltd., Haverhill, UK), 3 μL deoxynucleoside triphosphates (5 mmol), and 1 μL Taq (Bioline). .. PCR products were separated by gel electrophoresis on a 1.5% agarose gel, and DNA bands were stained with ethidium bromide.

Article Title: Characterization of Environmentally Persistent Escherichia coli Isolates Leached from an Irish Soil ▿
Article Snippet: The PCR mixture (50 μl) consisted of 5 μl 10× NH4 buffer, 2 μl 50 mM MgCl2 , 1 μl of each of the 6 primers (20 pmol), 1 μl 100 mM dNTP, 33.6 μl H2 O, 2.5 U (0.5 μl) BioTaq (Bioline), and 2 μl of template DNA. .. PCR products were separated on a 2% Tris-acetate-EDTA buffer (TAE) agarose electrophoresis gel stained with Sybr Safe (5 μl/100 ml).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Meridian Life Science pcr master mix
    Pcr Master Mix, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 96/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/Meridian Life Science
    Average 96 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    Image Search Results