pcr based strategy  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher pcr based strategy
    Mutation of ESE-1 NES2 inhibits <t>GFP-ESE-1-induced</t> MCF-12A cell transformation . (A) Diagram of the GFP-ESE-1 protein showing the two isoleucine to alanine point mutations engineered in the ESE-1 NES2 sequence to generate the GFP-ESE-1 NES2Mut construct. Black lines above the diagram - NES1 or NLS. Red line below the diagram - NES2 (wild type NES2 sequence expanded below). Red letters - critical leucine and isoleucine residues in NES2. Blue letters - the isoleucine to alanine point mutations engineered to generate NES2Mut. (B) Direct fluorescence imaging of MCF-12A cells transiently expressing GFP-ESE-1 NES2Mut. DAPI panel - nuclear DAPI florescence (blue). GFP panel - GFP fluorescence (green). Merge panel - an overlay of the DAPI and GFP fluorescence. (C) Anchorage-independent growth of pooled MCF-12A cell populations expressing GFP-only, GFP-PEA3, GFP-ETS-2, GFP-ESE-1 or GFP-ESE-1 NES2Mut. Stable transfectants were plated in soft agarose and typical colonies were photographed eight days later (40X). (D) Quantitation of anchorage-independent colony formation. Two independent, stably transfected MCF-12A populations for each construct (GFP-only, GFP-PEA3, GFP-ETS-2, GFP-ESE-1 and GFP-ESE-1 NES2Mut) were seeded in triplicate soft agarose cultures and colonies visible by 6X bright field microscopy were counted 21 days later. Bars show average numbers of colonies per plate +/- s.e.m. (E) <t>RT-PCR</t> analysis of mRNA expression of GFP fusion constructs in stably transfected MCF-12A cells. For each construct two independently generated stable populations (A and B) were analyzed: GFP-only populations (GFP-only A and B), GFP-PEA3 populations (PEA3 A and B), GFP-ETS-2 (ETS-2 A and B), GFP-ESE-1 (ESE-1 A and B), GFP-ESE-1 NES2Mut (ESE-1NES2MutA and B). PEA3 A (R) and PEA3 B (R) - RNAse treated samples.
    Pcr Based Strategy, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr based strategy/product/Thermo Fisher
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pcr based strategy - by Bioz Stars, 2020-07
    90/100 stars

    Images

    1) Product Images from "Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism"

    Article Title: Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-10-103

    Mutation of ESE-1 NES2 inhibits GFP-ESE-1-induced MCF-12A cell transformation . (A) Diagram of the GFP-ESE-1 protein showing the two isoleucine to alanine point mutations engineered in the ESE-1 NES2 sequence to generate the GFP-ESE-1 NES2Mut construct. Black lines above the diagram - NES1 or NLS. Red line below the diagram - NES2 (wild type NES2 sequence expanded below). Red letters - critical leucine and isoleucine residues in NES2. Blue letters - the isoleucine to alanine point mutations engineered to generate NES2Mut. (B) Direct fluorescence imaging of MCF-12A cells transiently expressing GFP-ESE-1 NES2Mut. DAPI panel - nuclear DAPI florescence (blue). GFP panel - GFP fluorescence (green). Merge panel - an overlay of the DAPI and GFP fluorescence. (C) Anchorage-independent growth of pooled MCF-12A cell populations expressing GFP-only, GFP-PEA3, GFP-ETS-2, GFP-ESE-1 or GFP-ESE-1 NES2Mut. Stable transfectants were plated in soft agarose and typical colonies were photographed eight days later (40X). (D) Quantitation of anchorage-independent colony formation. Two independent, stably transfected MCF-12A populations for each construct (GFP-only, GFP-PEA3, GFP-ETS-2, GFP-ESE-1 and GFP-ESE-1 NES2Mut) were seeded in triplicate soft agarose cultures and colonies visible by 6X bright field microscopy were counted 21 days later. Bars show average numbers of colonies per plate +/- s.e.m. (E) RT-PCR analysis of mRNA expression of GFP fusion constructs in stably transfected MCF-12A cells. For each construct two independently generated stable populations (A and B) were analyzed: GFP-only populations (GFP-only A and B), GFP-PEA3 populations (PEA3 A and B), GFP-ETS-2 (ETS-2 A and B), GFP-ESE-1 (ESE-1 A and B), GFP-ESE-1 NES2Mut (ESE-1NES2MutA and B). PEA3 A (R) and PEA3 B (R) - RNAse treated samples.
    Figure Legend Snippet: Mutation of ESE-1 NES2 inhibits GFP-ESE-1-induced MCF-12A cell transformation . (A) Diagram of the GFP-ESE-1 protein showing the two isoleucine to alanine point mutations engineered in the ESE-1 NES2 sequence to generate the GFP-ESE-1 NES2Mut construct. Black lines above the diagram - NES1 or NLS. Red line below the diagram - NES2 (wild type NES2 sequence expanded below). Red letters - critical leucine and isoleucine residues in NES2. Blue letters - the isoleucine to alanine point mutations engineered to generate NES2Mut. (B) Direct fluorescence imaging of MCF-12A cells transiently expressing GFP-ESE-1 NES2Mut. DAPI panel - nuclear DAPI florescence (blue). GFP panel - GFP fluorescence (green). Merge panel - an overlay of the DAPI and GFP fluorescence. (C) Anchorage-independent growth of pooled MCF-12A cell populations expressing GFP-only, GFP-PEA3, GFP-ETS-2, GFP-ESE-1 or GFP-ESE-1 NES2Mut. Stable transfectants were plated in soft agarose and typical colonies were photographed eight days later (40X). (D) Quantitation of anchorage-independent colony formation. Two independent, stably transfected MCF-12A populations for each construct (GFP-only, GFP-PEA3, GFP-ETS-2, GFP-ESE-1 and GFP-ESE-1 NES2Mut) were seeded in triplicate soft agarose cultures and colonies visible by 6X bright field microscopy were counted 21 days later. Bars show average numbers of colonies per plate +/- s.e.m. (E) RT-PCR analysis of mRNA expression of GFP fusion constructs in stably transfected MCF-12A cells. For each construct two independently generated stable populations (A and B) were analyzed: GFP-only populations (GFP-only A and B), GFP-PEA3 populations (PEA3 A and B), GFP-ETS-2 (ETS-2 A and B), GFP-ESE-1 (ESE-1 A and B), GFP-ESE-1 NES2Mut (ESE-1NES2MutA and B). PEA3 A (R) and PEA3 B (R) - RNAse treated samples.

    Techniques Used: Mutagenesis, Transformation Assay, Sequencing, Construct, Fluorescence, Imaging, Expressing, Quantitation Assay, Stable Transfection, Transfection, Microscopy, Reverse Transcription Polymerase Chain Reaction, Generated

    2) Product Images from "ARID1a-DNA Interactions Are Required for Promoter Occupancy by SWI/SNF"

    Article Title: ARID1a-DNA Interactions Are Required for Promoter Occupancy by SWI/SNF

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.01008-12

    The ARID domain of ARID1a is required for BAF-A occupancy at THBS1. (A) Mouse/human VISTA alignment of the THBS1 promoter and 5′ transcribed region. Salmon-colored peaks denote evolutionarily conserved regions, whereas lavender peaks denote exons. The locations of ChIP amplicons within this interval are plotted. (B to H) Formaldehyde-cross-linked chromatin from wild-type and Arid1a V1068G/V1068G MEFs was immunoprecipitated with ARID1a, ARID1b, ARID2, BRG1, BRM, INI1/SNF5, or Pol II antibodies. DNA was amplified by quantitative PCR to determine if loss of ARID-DNA binding leads to changes in BAF-A occupancy across THBS1 . An intergenic, nonconserved downstream region (located at approximately kb +20) and two unlinked promoter control elements ( GAPDH and INS-1 ) were used as negative genomic controls. Data were plotted as the percentage of total input or chromatin bound. (I) Whole-embryo protein lysates from triplicate pooled samples were used to examine THBS1 protein (reduced, monomeric form) expression differences by Western blotting. An overexposed image of the Western blot was also included to further emphasize these expression differences. The constitutive nuclear matrix protein, nucleolin, was used as a loading control. (J) cDNA synthesized from RNA isolated from wild-type or Arid1a V1068G/V1068G MEFs was used in a quantitative PCR to examine THBS1 expression differences following transfection with mock (nontargeting control), BRG1, or BRM siRNA. (K) Normalized luciferase activity of the THBS1 −2.8 kb promoter-luciferase fragment cotransfected with 0.05 to 0.5 μg of wild-type or mutant HA-mARID1a expression plasmids into NIH 3T3 cells. Cells cotransfected with the empty luciferase vector (−luc) or THBS1 −2.8 kb promoter-luciferase fragment and with empty pcDNA expression plasmids served as negative and positive controls, respectively. (L) Normalized luciferase activity of THBS1 −2.8 kb and −0.48 kb promoter-luciferase reporter plasmids cotransfected with 0.25 μg of pcDNA only (−) or wild-type or mutant HA-mARID1a expression plasmids. Empty luciferase reporter plasmid was used as a negative control. (M) Summary model of ChIP and expression data. Error bars in panels B to H and in panel J represent the SEMs. Error bars in panels K and L represent the standard deviations. Significant differences were calculated using a two-tailed Student t test (*, P
    Figure Legend Snippet: The ARID domain of ARID1a is required for BAF-A occupancy at THBS1. (A) Mouse/human VISTA alignment of the THBS1 promoter and 5′ transcribed region. Salmon-colored peaks denote evolutionarily conserved regions, whereas lavender peaks denote exons. The locations of ChIP amplicons within this interval are plotted. (B to H) Formaldehyde-cross-linked chromatin from wild-type and Arid1a V1068G/V1068G MEFs was immunoprecipitated with ARID1a, ARID1b, ARID2, BRG1, BRM, INI1/SNF5, or Pol II antibodies. DNA was amplified by quantitative PCR to determine if loss of ARID-DNA binding leads to changes in BAF-A occupancy across THBS1 . An intergenic, nonconserved downstream region (located at approximately kb +20) and two unlinked promoter control elements ( GAPDH and INS-1 ) were used as negative genomic controls. Data were plotted as the percentage of total input or chromatin bound. (I) Whole-embryo protein lysates from triplicate pooled samples were used to examine THBS1 protein (reduced, monomeric form) expression differences by Western blotting. An overexposed image of the Western blot was also included to further emphasize these expression differences. The constitutive nuclear matrix protein, nucleolin, was used as a loading control. (J) cDNA synthesized from RNA isolated from wild-type or Arid1a V1068G/V1068G MEFs was used in a quantitative PCR to examine THBS1 expression differences following transfection with mock (nontargeting control), BRG1, or BRM siRNA. (K) Normalized luciferase activity of the THBS1 −2.8 kb promoter-luciferase fragment cotransfected with 0.05 to 0.5 μg of wild-type or mutant HA-mARID1a expression plasmids into NIH 3T3 cells. Cells cotransfected with the empty luciferase vector (−luc) or THBS1 −2.8 kb promoter-luciferase fragment and with empty pcDNA expression plasmids served as negative and positive controls, respectively. (L) Normalized luciferase activity of THBS1 −2.8 kb and −0.48 kb promoter-luciferase reporter plasmids cotransfected with 0.25 μg of pcDNA only (−) or wild-type or mutant HA-mARID1a expression plasmids. Empty luciferase reporter plasmid was used as a negative control. (M) Summary model of ChIP and expression data. Error bars in panels B to H and in panel J represent the SEMs. Error bars in panels K and L represent the standard deviations. Significant differences were calculated using a two-tailed Student t test (*, P

    Techniques Used: Chromatin Immunoprecipitation, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Binding Assay, Expressing, Western Blot, Synthesized, Isolation, Transfection, Luciferase, Activity Assay, Mutagenesis, Plasmid Preparation, Negative Control, Two Tailed Test

    Loss of DNA binding correlates with reduced promoter occupancy and concurrent changes in SWI/SNF target gene expression. (A) Formaldehyde-cross-linked chromatin from wild-type and Arid1a V1068G/V1068G MEFs was immunoprecipitated using an ARID1a-specific antibody. DNA was amplified by quantitative PCR to determine if mutant ARID1a occupancy was reduced at known SWI/SNF target gene promoters ( THBS1 , ADAMTS1 , and CRABP1 ). Promoter control elements for a constitutive ( GAPDH ) or silent ( INS-1 ) gene were used as negative genomic controls. Data were plotted as the percentage of total input or chromatin bound. (B) cDNA synthesized from RNA isolated from wild-type or Arid1a V1068G/V1068G MEFs was used in a quantitative PCR to examine target gene expression differences. Error bars in both panels represent the SEMs, and significant differences between the wild type and mutant were calculated using a two-tailed Student t test (*, P
    Figure Legend Snippet: Loss of DNA binding correlates with reduced promoter occupancy and concurrent changes in SWI/SNF target gene expression. (A) Formaldehyde-cross-linked chromatin from wild-type and Arid1a V1068G/V1068G MEFs was immunoprecipitated using an ARID1a-specific antibody. DNA was amplified by quantitative PCR to determine if mutant ARID1a occupancy was reduced at known SWI/SNF target gene promoters ( THBS1 , ADAMTS1 , and CRABP1 ). Promoter control elements for a constitutive ( GAPDH ) or silent ( INS-1 ) gene were used as negative genomic controls. Data were plotted as the percentage of total input or chromatin bound. (B) cDNA synthesized from RNA isolated from wild-type or Arid1a V1068G/V1068G MEFs was used in a quantitative PCR to examine target gene expression differences. Error bars in both panels represent the SEMs, and significant differences between the wild type and mutant were calculated using a two-tailed Student t test (*, P

    Techniques Used: Binding Assay, Expressing, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Mutagenesis, Synthesized, Isolation, Two Tailed Test

    Related Articles

    Clone Assay:

    Article Title: Production of TRPV2-targeting functional antibody ameliorating dilated cardiomyopathy and muscular dystrophy in animal models.
    Article Snippet: .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD). .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD).

    Functional Assay:

    Article Title: Regulation of the p53 transcriptional response by structurally diverse core promoters
    Article Snippet: .. To extend our observation that the p21 and Fas/APO1 core promoters were each sufficient to direct dissimilar RNAP II-binding kinetics , we mapped the functional elements within each promoter by scanning mutagenesis of progressive 10-bp blocks to the transverse bases using a PCR-based strategy (Invitrogen) ( ). .. All mutations were generated in the context of the full-length promoters and were assessed by in vitro transcription using HeLa extracts.

    Amplification:

    Article Title: ARID1a-DNA Interactions Are Required for Promoter Occupancy by SWI/SNF
    Article Snippet: .. To construct the HA-tagged mouse ARID1a expression plasmids, we used a PCR-based strategy to clone ARID1a (isoform 2) from wild-type or Arid1a V1068G/V1068G MEFs. mRNA was reverse transcribed using Superscript III (Invitrogen), and the resulting cDNA was PCR amplified using Phusion ultra-high-fidelity polymerase (NEB) and the following primer set: F, ATG GATCAGATGGGAAAGATGAGACCTCAGC; R, TCATGACTGGCCAATCAAAAACAGTACATCACA (the start codon is underlined). .. The PCR products were gel purified and blunt cloned into the JET1.2 plasmid (Fermentas).

    Mutagenesis:

    Article Title: Regulation of the p53 transcriptional response by structurally diverse core promoters
    Article Snippet: .. To extend our observation that the p21 and Fas/APO1 core promoters were each sufficient to direct dissimilar RNAP II-binding kinetics , we mapped the functional elements within each promoter by scanning mutagenesis of progressive 10-bp blocks to the transverse bases using a PCR-based strategy (Invitrogen) ( ). .. All mutations were generated in the context of the full-length promoters and were assessed by in vitro transcription using HeLa extracts.

    Article Title: Diamond-Blackfan anemia: genotype-phenotype correlations in Italian patients with RPL5 and RPL11 mutations
    Article Snippet: .. A PCR-based strategy was applied to obtain mutant 64_66delCAA, using Platinum®Pfx DNA Polymerase (Invitrogen) and the primers, forward 5′-Phos-atggt-cattgatgtccttcaccc-3′, reverse 5′-tttcctctgaagtagtcggttggt-3′. ..

    Article Title: The Mechanisms of Human Hotdog-fold Thioesterase 2 (hTHEM2) Substrate Recognition and Catalysis Illuminated by a Structure and Function Based Analysis #The Mechanisms of Human Hotdog-fold Thioesterase 2 (hTHEM2) Substrate Recognition and Catalysis Illuminated by a Structure and Function Based Analysis # ,
    Article Snippet: .. Site directed mutagenesis was carried out using a PCR-based strategy with the WT-hTHEM2/pET-22b(+) plasmid as template, commercial primers (Invitrogen), the PCR kit supplied by Stratagene, and the Techgene thermal cycler manufactured by TECHNE (Princeton, NJ). .. The PCR products were used to transform competent E. coli BL21(DE3) cells and the plasmid was prepared using a QIAprep Spin Miniprep Kit (Qiagen).

    Subcloning:

    Article Title: Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: Specificity and substrate encounter rate
    Article Snippet: .. For expression of the CYP6B17 and CYP6B21 sequences, their 5′ UTR and introns were removed by using a PCR-based strategy before subcloning them into the pFASTBac1 baculovirus expression vector (Invitrogen). .. Briefly, this strategy involved amplifying the 5′ end 417 bp of the CYP6B17 or CYP6B21 coding sequences with a forward N1 primer (5′-CCGCTCGAGATCATGTTAACGATATTTAT-3′) that contains the start codon and a reverse C5 primer (5′-CGGCTTAAGTTTTCCTGACGTG-3′), and inserting the resulting PCR product into pBluescript SK vector.

    Construct:

    Article Title: Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism
    Article Snippet: .. GFP fusion vectors All GFP-SAR fusion constructs were generated using the previously described PCR-based strategy [ ] and subcloned into the pEGFP-C3 parental expression plasmid (Invitrogen Inc., Carlsbad, CA). ..

    Article Title: ARID1a-DNA Interactions Are Required for Promoter Occupancy by SWI/SNF
    Article Snippet: .. To construct the HA-tagged mouse ARID1a expression plasmids, we used a PCR-based strategy to clone ARID1a (isoform 2) from wild-type or Arid1a V1068G/V1068G MEFs. mRNA was reverse transcribed using Superscript III (Invitrogen), and the resulting cDNA was PCR amplified using Phusion ultra-high-fidelity polymerase (NEB) and the following primer set: F, ATG GATCAGATGGGAAAGATGAGACCTCAGC; R, TCATGACTGGCCAATCAAAAACAGTACATCACA (the start codon is underlined). .. The PCR products were gel purified and blunt cloned into the JET1.2 plasmid (Fermentas).

    Generated:

    Article Title: Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism
    Article Snippet: .. GFP fusion vectors All GFP-SAR fusion constructs were generated using the previously described PCR-based strategy [ ] and subcloned into the pEGFP-C3 parental expression plasmid (Invitrogen Inc., Carlsbad, CA). ..

    Expressing:

    Article Title: Production of TRPV2-targeting functional antibody ameliorating dilated cardiomyopathy and muscular dystrophy in animal models.
    Article Snippet: .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD). .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD).

    Article Title: Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism
    Article Snippet: .. GFP fusion vectors All GFP-SAR fusion constructs were generated using the previously described PCR-based strategy [ ] and subcloned into the pEGFP-C3 parental expression plasmid (Invitrogen Inc., Carlsbad, CA). ..

    Article Title: Functional Characterization of the Bari1 Transposition System
    Article Snippet: .. Expression Plasmids Construction A PCR-based strategy was used to clone the transposase ORF, and the derivatives amino and carboxyl terminal fragments into the pAC5.1/V5-His vector (Invitrogen). ..

    Article Title: Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: Specificity and substrate encounter rate
    Article Snippet: .. For expression of the CYP6B17 and CYP6B21 sequences, their 5′ UTR and introns were removed by using a PCR-based strategy before subcloning them into the pFASTBac1 baculovirus expression vector (Invitrogen). .. Briefly, this strategy involved amplifying the 5′ end 417 bp of the CYP6B17 or CYP6B21 coding sequences with a forward N1 primer (5′-CCGCTCGAGATCATGTTAACGATATTTAT-3′) that contains the start codon and a reverse C5 primer (5′-CGGCTTAAGTTTTCCTGACGTG-3′), and inserting the resulting PCR product into pBluescript SK vector.

    Article Title: ARID1a-DNA Interactions Are Required for Promoter Occupancy by SWI/SNF
    Article Snippet: .. To construct the HA-tagged mouse ARID1a expression plasmids, we used a PCR-based strategy to clone ARID1a (isoform 2) from wild-type or Arid1a V1068G/V1068G MEFs. mRNA was reverse transcribed using Superscript III (Invitrogen), and the resulting cDNA was PCR amplified using Phusion ultra-high-fidelity polymerase (NEB) and the following primer set: F, ATG GATCAGATGGGAAAGATGAGACCTCAGC; R, TCATGACTGGCCAATCAAAAACAGTACATCACA (the start codon is underlined). .. The PCR products were gel purified and blunt cloned into the JET1.2 plasmid (Fermentas).

    Polymerase Chain Reaction:

    Article Title: Regulation of the p53 transcriptional response by structurally diverse core promoters
    Article Snippet: .. To extend our observation that the p21 and Fas/APO1 core promoters were each sufficient to direct dissimilar RNAP II-binding kinetics , we mapped the functional elements within each promoter by scanning mutagenesis of progressive 10-bp blocks to the transverse bases using a PCR-based strategy (Invitrogen) ( ). .. All mutations were generated in the context of the full-length promoters and were assessed by in vitro transcription using HeLa extracts.

    Article Title: Production of TRPV2-targeting functional antibody ameliorating dilated cardiomyopathy and muscular dystrophy in animal models.
    Article Snippet: .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD). .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD).

    Article Title: Diamond-Blackfan anemia: genotype-phenotype correlations in Italian patients with RPL5 and RPL11 mutations
    Article Snippet: .. A PCR-based strategy was applied to obtain mutant 64_66delCAA, using Platinum®Pfx DNA Polymerase (Invitrogen) and the primers, forward 5′-Phos-atggt-cattgatgtccttcaccc-3′, reverse 5′-tttcctctgaagtagtcggttggt-3′. ..

    Article Title: Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism
    Article Snippet: .. GFP fusion vectors All GFP-SAR fusion constructs were generated using the previously described PCR-based strategy [ ] and subcloned into the pEGFP-C3 parental expression plasmid (Invitrogen Inc., Carlsbad, CA). ..

    Article Title: The Mechanisms of Human Hotdog-fold Thioesterase 2 (hTHEM2) Substrate Recognition and Catalysis Illuminated by a Structure and Function Based Analysis #The Mechanisms of Human Hotdog-fold Thioesterase 2 (hTHEM2) Substrate Recognition and Catalysis Illuminated by a Structure and Function Based Analysis # ,
    Article Snippet: .. Site directed mutagenesis was carried out using a PCR-based strategy with the WT-hTHEM2/pET-22b(+) plasmid as template, commercial primers (Invitrogen), the PCR kit supplied by Stratagene, and the Techgene thermal cycler manufactured by TECHNE (Princeton, NJ). .. The PCR products were used to transform competent E. coli BL21(DE3) cells and the plasmid was prepared using a QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Functional Characterization of the Bari1 Transposition System
    Article Snippet: .. Expression Plasmids Construction A PCR-based strategy was used to clone the transposase ORF, and the derivatives amino and carboxyl terminal fragments into the pAC5.1/V5-His vector (Invitrogen). ..

    Article Title: Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: Specificity and substrate encounter rate
    Article Snippet: .. For expression of the CYP6B17 and CYP6B21 sequences, their 5′ UTR and introns were removed by using a PCR-based strategy before subcloning them into the pFASTBac1 baculovirus expression vector (Invitrogen). .. Briefly, this strategy involved amplifying the 5′ end 417 bp of the CYP6B17 or CYP6B21 coding sequences with a forward N1 primer (5′-CCGCTCGAGATCATGTTAACGATATTTAT-3′) that contains the start codon and a reverse C5 primer (5′-CGGCTTAAGTTTTCCTGACGTG-3′), and inserting the resulting PCR product into pBluescript SK vector.

    Article Title: ARID1a-DNA Interactions Are Required for Promoter Occupancy by SWI/SNF
    Article Snippet: .. To construct the HA-tagged mouse ARID1a expression plasmids, we used a PCR-based strategy to clone ARID1a (isoform 2) from wild-type or Arid1a V1068G/V1068G MEFs. mRNA was reverse transcribed using Superscript III (Invitrogen), and the resulting cDNA was PCR amplified using Phusion ultra-high-fidelity polymerase (NEB) and the following primer set: F, ATG GATCAGATGGGAAAGATGAGACCTCAGC; R, TCATGACTGGCCAATCAAAAACAGTACATCACA (the start codon is underlined). .. The PCR products were gel purified and blunt cloned into the JET1.2 plasmid (Fermentas).

    Plasmid Preparation:

    Article Title: Production of TRPV2-targeting functional antibody ameliorating dilated cardiomyopathy and muscular dystrophy in animal models.
    Article Snippet: .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD). .. Abnormal Ca < sup > 2+ < /sup > handling is essential in the pathophysiology of degenerative muscle disorders, such as dilated cardiomyopathy (DCM) and muscular dystrophy (MD).

    Article Title: Mapping of ESE-1 subdomains required to initiate mammary epithelial cell transformation via a cytoplasmic mechanism
    Article Snippet: .. GFP fusion vectors All GFP-SAR fusion constructs were generated using the previously described PCR-based strategy [ ] and subcloned into the pEGFP-C3 parental expression plasmid (Invitrogen Inc., Carlsbad, CA). ..

    Article Title: The Mechanisms of Human Hotdog-fold Thioesterase 2 (hTHEM2) Substrate Recognition and Catalysis Illuminated by a Structure and Function Based Analysis #The Mechanisms of Human Hotdog-fold Thioesterase 2 (hTHEM2) Substrate Recognition and Catalysis Illuminated by a Structure and Function Based Analysis # ,
    Article Snippet: .. Site directed mutagenesis was carried out using a PCR-based strategy with the WT-hTHEM2/pET-22b(+) plasmid as template, commercial primers (Invitrogen), the PCR kit supplied by Stratagene, and the Techgene thermal cycler manufactured by TECHNE (Princeton, NJ). .. The PCR products were used to transform competent E. coli BL21(DE3) cells and the plasmid was prepared using a QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Functional Characterization of the Bari1 Transposition System
    Article Snippet: .. Expression Plasmids Construction A PCR-based strategy was used to clone the transposase ORF, and the derivatives amino and carboxyl terminal fragments into the pAC5.1/V5-His vector (Invitrogen). ..

    Article Title: Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: Specificity and substrate encounter rate
    Article Snippet: .. For expression of the CYP6B17 and CYP6B21 sequences, their 5′ UTR and introns were removed by using a PCR-based strategy before subcloning them into the pFASTBac1 baculovirus expression vector (Invitrogen). .. Briefly, this strategy involved amplifying the 5′ end 417 bp of the CYP6B17 or CYP6B21 coding sequences with a forward N1 primer (5′-CCGCTCGAGATCATGTTAACGATATTTAT-3′) that contains the start codon and a reverse C5 primer (5′-CGGCTTAAGTTTTCCTGACGTG-3′), and inserting the resulting PCR product into pBluescript SK vector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher polymerase chain reaction pcr based strategy
    Polymerase Chain Reaction Pcr Based Strategy, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr based strategy/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr based strategy - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    92
    Thermo Fisher array based dpcr strategies
    Array Based Dpcr Strategies, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/array based dpcr strategies/product/Thermo Fisher
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    array based dpcr strategies - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    94
    Thermo Fisher pcrs
    Pcrs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 553 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcrs/product/Thermo Fisher
    Average 94 stars, based on 553 article reviews
    Price from $9.99 to $1999.99
    pcrs - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results