pcr amplification  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    PCR Amplification Kit
    Description:
    The PCR Amplification Kit which includes TaKaRa Taq DNA Polymerase is designed to perform PCR on any DNA template and includes all of the reagents necessary for PCR including dNTP mixture two buffers with and without Mg2 and MgCl2 The kit comes with control template and primers for verifying amplification conditions DNA size markers and loading buffer
    Catalog Number:
    r011
    Price:
    None
    Size:
    100 Rxns
    Category:
    Takara Taq PCR kit Takara Taq products Standard PCR PCR
    Buy from Supplier


    Structured Review

    TaKaRa pcr amplification
    Characterization of <t>Math6</t> mRNA and protein expression. A. Northern analysis of altered Math6 expression between normal mouse (wild type, WT) podocytes and normal podocytes infected with a virus (WT+HIV) containing the HIV-1 proviral construct used to make the transgenic mouse model (ribosomal s14 as control). B. Math6 <t>RT/PCR</t> using RNA isolated from normal mouse podocytes (WT); podocytes from the HIV-1 transgenic mouse model (Tg26); E11.5 mouse metanephric mesenchyme (MM) cell line; and E11.5 mouse ureteric bud (UB) cell line. Glyceraldehyde-3-phosphate dehydrogenase (GAP) as control. C. Multi-tissue Northern blot from adult mouse demonstrating the restricted distribution and variable expression level in different adult tissues. D. Expression of Math6 during kidney development. Mouse total kidney RNA was harvested at various days during embryonic and post-natal development (GAP expression is used as a control). E. Semi-quantitative RT/PCR of Math6 expression in glomeruli isolated from normal and HIV-1 transgenic (Tg26) mouse kidneys. Example of a single animal comparison is shown at left using serial dilutions of input template. Quantification of replicas (mean±SD; normal n=4, and Tg26 n=6) is shown in graph at right and was statistical significant ( P =0.014). F. Characterization of Math6 antibody by Western blotting. Lane 1, HEK293T cells. Lane 2, HEK293T cells transfected with a Math6 expression plasmid. Lane 3, HEK293T cells transfected with a Math6 expression plasmid of the cDNA cloned in the reverse orientation.
    The PCR Amplification Kit which includes TaKaRa Taq DNA Polymerase is designed to perform PCR on any DNA template and includes all of the reagents necessary for PCR including dNTP mixture two buffers with and without Mg2 and MgCl2 The kit comes with control template and primers for verifying amplification conditions DNA size markers and loading buffer
    https://www.bioz.com/result/pcr amplification/product/TaKaRa
    Average 97 stars, based on 3125 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2021-01
    97/100 stars

    Images

    1) Product Images from "Math6 expression during kidney development and altered expression in a mouse model of glomerulosclerosis"

    Article Title: Math6 expression during kidney development and altered expression in a mouse model of glomerulosclerosis

    Journal: Developmental dynamics : an official publication of the American Association of Anatomists

    doi: 10.1002/dvdy.20934

    Characterization of Math6 mRNA and protein expression. A. Northern analysis of altered Math6 expression between normal mouse (wild type, WT) podocytes and normal podocytes infected with a virus (WT+HIV) containing the HIV-1 proviral construct used to make the transgenic mouse model (ribosomal s14 as control). B. Math6 RT/PCR using RNA isolated from normal mouse podocytes (WT); podocytes from the HIV-1 transgenic mouse model (Tg26); E11.5 mouse metanephric mesenchyme (MM) cell line; and E11.5 mouse ureteric bud (UB) cell line. Glyceraldehyde-3-phosphate dehydrogenase (GAP) as control. C. Multi-tissue Northern blot from adult mouse demonstrating the restricted distribution and variable expression level in different adult tissues. D. Expression of Math6 during kidney development. Mouse total kidney RNA was harvested at various days during embryonic and post-natal development (GAP expression is used as a control). E. Semi-quantitative RT/PCR of Math6 expression in glomeruli isolated from normal and HIV-1 transgenic (Tg26) mouse kidneys. Example of a single animal comparison is shown at left using serial dilutions of input template. Quantification of replicas (mean±SD; normal n=4, and Tg26 n=6) is shown in graph at right and was statistical significant ( P =0.014). F. Characterization of Math6 antibody by Western blotting. Lane 1, HEK293T cells. Lane 2, HEK293T cells transfected with a Math6 expression plasmid. Lane 3, HEK293T cells transfected with a Math6 expression plasmid of the cDNA cloned in the reverse orientation.
    Figure Legend Snippet: Characterization of Math6 mRNA and protein expression. A. Northern analysis of altered Math6 expression between normal mouse (wild type, WT) podocytes and normal podocytes infected with a virus (WT+HIV) containing the HIV-1 proviral construct used to make the transgenic mouse model (ribosomal s14 as control). B. Math6 RT/PCR using RNA isolated from normal mouse podocytes (WT); podocytes from the HIV-1 transgenic mouse model (Tg26); E11.5 mouse metanephric mesenchyme (MM) cell line; and E11.5 mouse ureteric bud (UB) cell line. Glyceraldehyde-3-phosphate dehydrogenase (GAP) as control. C. Multi-tissue Northern blot from adult mouse demonstrating the restricted distribution and variable expression level in different adult tissues. D. Expression of Math6 during kidney development. Mouse total kidney RNA was harvested at various days during embryonic and post-natal development (GAP expression is used as a control). E. Semi-quantitative RT/PCR of Math6 expression in glomeruli isolated from normal and HIV-1 transgenic (Tg26) mouse kidneys. Example of a single animal comparison is shown at left using serial dilutions of input template. Quantification of replicas (mean±SD; normal n=4, and Tg26 n=6) is shown in graph at right and was statistical significant ( P =0.014). F. Characterization of Math6 antibody by Western blotting. Lane 1, HEK293T cells. Lane 2, HEK293T cells transfected with a Math6 expression plasmid. Lane 3, HEK293T cells transfected with a Math6 expression plasmid of the cDNA cloned in the reverse orientation.

    Techniques Used: Expressing, Northern Blot, Infection, Construct, Transgenic Assay, Reverse Transcription Polymerase Chain Reaction, Isolation, Quantitative RT-PCR, Western Blot, Transfection, Plasmid Preparation, Clone Assay

    2) Product Images from "Osteopontin is Required for Unloading-Induced Osteoclast Recruitment and Modulation of RANKL Expression during Tooth Drift-associated Bone Remodeling, but Not for Super-Eruption"

    Article Title: Osteopontin is Required for Unloading-Induced Osteoclast Recruitment and Modulation of RANKL Expression during Tooth Drift-associated Bone Remodeling, but Not for Super-Eruption

    Journal: Bone

    doi: 10.1016/j.bone.2010.08.025

    Unloading of teeth induces OPN localization on distal alveolar bone surfaces (A) Expression of OPN in periodontal tissues during unloading, analyzed by real-time quantitative PCR (* P
    Figure Legend Snippet: Unloading of teeth induces OPN localization on distal alveolar bone surfaces (A) Expression of OPN in periodontal tissues during unloading, analyzed by real-time quantitative PCR (* P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Modulation of RANKL expression in periodontal ligament tissues as a result of occlusal unloading and OPN expression (A) and (B) are quantitative real-time PCR data for RANKL (A) and OPG (B) expression in WT and OPN−/− mice subjected to unloading. Occlusal unloading resulted in significant decreases in RANKL expression in WT and OPN−/− mice as a result of decreased PDL compression (A) while OPG expression in OPN−/− mice significantly increased during unloading and OPG levels in the WT decreased or remained unchanged (B). Note significantly reduced RANKL expression levels in OPN−/− mice compared to the WT controls. * P
    Figure Legend Snippet: Modulation of RANKL expression in periodontal ligament tissues as a result of occlusal unloading and OPN expression (A) and (B) are quantitative real-time PCR data for RANKL (A) and OPG (B) expression in WT and OPN−/− mice subjected to unloading. Occlusal unloading resulted in significant decreases in RANKL expression in WT and OPN−/− mice as a result of decreased PDL compression (A) while OPG expression in OPN−/− mice significantly increased during unloading and OPG levels in the WT decreased or remained unchanged (B). Note significantly reduced RANKL expression levels in OPN−/− mice compared to the WT controls. * P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Mouse Assay

    3) Product Images from "The Neuronal PAS Domain Protein 4 (Npas4) Is Required for New and Reactivated Fear Memories"

    Article Title: The Neuronal PAS Domain Protein 4 (Npas4) Is Required for New and Reactivated Fear Memories

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0023760

    Knockdown of Npas4 in vitro . (A) HEK293 cells were co-transfected with plasmids expressing Npas4-RFP and plasmids expressing shRNAs designed to deplete Npas4 mRNA [shNpas4(1) (ii, v) and shNpas4(5) (iii, vi)]. A control shRNA (shSCRM) (i, iv) that does not target Npas4 was used as a control. Ninety-six hrs following transfection, cells were visualized by fluorescence microcopy (20X) for the presence of the shRNA GFP plasmids, (panels i, ii, iii) and Npas4-RFP (panels iv, v, and vi). Cells transfected with shNPAS4(1) and shNPAS4(5) exhibited significantly less Npas4-RFP compared to cells transfected with shSCRM, suggesting that the shRNAs against Npas4 are targeting the Npas4-RFP mRNA for degradation resulting in less Npas4-RFP protein (panels v. and vi. versus iv.). Exposure times were the same for visualization of GFP images and RFP images, respectively. (B) qRT-PCR analysis of Npas4 mRNA from samples prepared as described above. Both shNpas4(1) and shNpas4(5) significantly depleted Npas4 mRNA relative to the shSCRM control (n = 3, each group). p
    Figure Legend Snippet: Knockdown of Npas4 in vitro . (A) HEK293 cells were co-transfected with plasmids expressing Npas4-RFP and plasmids expressing shRNAs designed to deplete Npas4 mRNA [shNpas4(1) (ii, v) and shNpas4(5) (iii, vi)]. A control shRNA (shSCRM) (i, iv) that does not target Npas4 was used as a control. Ninety-six hrs following transfection, cells were visualized by fluorescence microcopy (20X) for the presence of the shRNA GFP plasmids, (panels i, ii, iii) and Npas4-RFP (panels iv, v, and vi). Cells transfected with shNPAS4(1) and shNPAS4(5) exhibited significantly less Npas4-RFP compared to cells transfected with shSCRM, suggesting that the shRNAs against Npas4 are targeting the Npas4-RFP mRNA for degradation resulting in less Npas4-RFP protein (panels v. and vi. versus iv.). Exposure times were the same for visualization of GFP images and RFP images, respectively. (B) qRT-PCR analysis of Npas4 mRNA from samples prepared as described above. Both shNpas4(1) and shNpas4(5) significantly depleted Npas4 mRNA relative to the shSCRM control (n = 3, each group). p

    Techniques Used: In Vitro, Transfection, Expressing, shRNA, Fluorescence, Quantitative RT-PCR

    Regulation of Npas4 mRNA and protein in the LA following fear conditioning. (A) Schematic of the behavioral protocol for qRT-PCR and Western experiments. (B) Time course analysis of Npas4 mRNA expression in the LA following fear conditioning using qRT-PCR (n = 8/group). *p
    Figure Legend Snippet: Regulation of Npas4 mRNA and protein in the LA following fear conditioning. (A) Schematic of the behavioral protocol for qRT-PCR and Western experiments. (B) Time course analysis of Npas4 mRNA expression in the LA following fear conditioning using qRT-PCR (n = 8/group). *p

    Techniques Used: Quantitative RT-PCR, Western Blot, Expressing

    4) Product Images from "Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿ †"

    Article Title: Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿ †

    Journal:

    doi: 10.1128/MCB.01637-07

    Chp1 and Tas3, but not the RITS, are required for the maintenance of the silencing of telomeric transcripts. (A) Cartoon showing the location of subtelomeric tlh + genes (black) and the position of the PCR amplicon A within the helicase domain
    Figure Legend Snippet: Chp1 and Tas3, but not the RITS, are required for the maintenance of the silencing of telomeric transcripts. (A) Cartoon showing the location of subtelomeric tlh + genes (black) and the position of the PCR amplicon A within the helicase domain

    Techniques Used: Polymerase Chain Reaction, Amplification

    5) Product Images from "Different characteristics of mesenchymal stem cells isolated from different layers of full term placenta"

    Article Title: Different characteristics of mesenchymal stem cells isolated from different layers of full term placenta

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0172642

    Gene expression based on RT-PCR analysis. (A) Adipogenic differentiation, (B) Chondrogenic differentiation, and (C) Osteogenic differentiation. Lanes 1,3,5,7,9,11 and 13: undifferentiated; Lanes 2,4,6,8,10 and 12: induced for differentiation. Housekeeping gene GAPDH was amplified to check the integrity of synthesized cDNA.
    Figure Legend Snippet: Gene expression based on RT-PCR analysis. (A) Adipogenic differentiation, (B) Chondrogenic differentiation, and (C) Osteogenic differentiation. Lanes 1,3,5,7,9,11 and 13: undifferentiated; Lanes 2,4,6,8,10 and 12: induced for differentiation. Housekeeping gene GAPDH was amplified to check the integrity of synthesized cDNA.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Synthesized

    6) Product Images from "A vitamin C-derived DNA modification catalyzed by an algal TET homolog"

    Article Title: A vitamin C-derived DNA modification catalyzed by an algal TET homolog

    Journal: Nature

    doi: 10.1038/s41586-019-1160-0

    Purification of recombinant CMD1 and determination of DNA substrate specificity. a, Coomassie blue staining of the untagged full-length CMD1 protein purified from E. coli . An image for fractions collected from gel filtration chromatography column (eluted between 14–17 min, 1 ml/min) is shown. Representative image is shown from at least three independent experiments. b, . c, CMD1 mutants had no or significantly reduced activity to convert 5mC into P1 and P2. Data shown are representative of two independent experiments. d, P1 and P2 nucleosides accumulate over a period of 2 h upon incubation of the 5mC-DNA substrate with CMD1 shown by HPLC analysis of nucleosides in DNA samples collected at the indicated time points. Data shown are representative of two independent experiments. e, Time-course of the relative amounts of 5mC, P1 and P2 during incubation of 5mC-DNA with CMD1. The amount was determined based on the peak area of each nucleoside in HPLC analysis in panel d . Data shown are representative of two independent experiments. f, 5mC-, but not C- or 5hmC-containing DNA, serves as a substrate for CMD1. DNA substrates containing C, 5hmC or 5mC were prepared by PCR, incubated with CMD1, and then subjected to nucleoside composition analysis using HPLC. Note that P1 and P2 nucleosides only appear in 5mC-DNA upon incubation with WT CMD1. Mut CMD1 is an inactive mutant carrying point mutations (H345Y/D347A). Data shown are representative of two independent experiments.
    Figure Legend Snippet: Purification of recombinant CMD1 and determination of DNA substrate specificity. a, Coomassie blue staining of the untagged full-length CMD1 protein purified from E. coli . An image for fractions collected from gel filtration chromatography column (eluted between 14–17 min, 1 ml/min) is shown. Representative image is shown from at least three independent experiments. b, . c, CMD1 mutants had no or significantly reduced activity to convert 5mC into P1 and P2. Data shown are representative of two independent experiments. d, P1 and P2 nucleosides accumulate over a period of 2 h upon incubation of the 5mC-DNA substrate with CMD1 shown by HPLC analysis of nucleosides in DNA samples collected at the indicated time points. Data shown are representative of two independent experiments. e, Time-course of the relative amounts of 5mC, P1 and P2 during incubation of 5mC-DNA with CMD1. The amount was determined based on the peak area of each nucleoside in HPLC analysis in panel d . Data shown are representative of two independent experiments. f, 5mC-, but not C- or 5hmC-containing DNA, serves as a substrate for CMD1. DNA substrates containing C, 5hmC or 5mC were prepared by PCR, incubated with CMD1, and then subjected to nucleoside composition analysis using HPLC. Note that P1 and P2 nucleosides only appear in 5mC-DNA upon incubation with WT CMD1. Mut CMD1 is an inactive mutant carrying point mutations (H345Y/D347A). Data shown are representative of two independent experiments.

    Techniques Used: Purification, Recombinant, Staining, Filtration, Chromatography, Activity Assay, Incubation, High Performance Liquid Chromatography, Polymerase Chain Reaction, Mutagenesis

    Generation of a cmd1 strain using a CRISPR/Cas9-based co-selection strategy and co-segregation of the high light-sensitive phenotype with the CMD1 mutation. a, The conversion of indole to tryptophan is catalyzed by the tryptophan (Trp) synthase β subunit encoded by the endogenous MAA7 gene in C. reinhardtii . When 5-fluoroindole (5-FI) is used in place of indole, it will be converted into 5-fluorotryptophan, which is lethally toxic to cells. b, The CRISPR/Cas9-mediated co-selection strategy to introduce mutation in C. reinhardtii . Recombinant Cas9 protein purified from E. coli was assembled with single guide RNA (sgRNA) for both the MAA7 gene and a target gene of interest to form RNP complexes. Upon electroporation of the mixture of the two RNP complexes into cells, 5-FI resistant colonies were selected and genotyped to identify clones with a desired mutation in the targeted gene. The mutant strains were then backcrossed with the wild-type strain to segregate the target gene mutation from the MAA7 mutation or other off-target mutations if any. c, The genomic loci of CMD1 (also known as CrTET1 ) and its close paralog CrTET2 . At the CMD1 locus of cmd1 cells, there is an insertion of 245 bp in the exon 3, thus generating a frame-shift mutation. Chromosome locations of the two paralogs are indicated on the top. DNA sequences from the targeted loci in wild-type and cmd1 strains are shown on the bottom. The 3-nt PAM and 20-nt sgRNA-binding sequences are distinctively colored. d, Genomic PCR genotyping of the cmd1 strain using two primer pairs as shown in panel c. Sizes expected for the PCR products are indicated. Note that the forward primer of primer pair 1 (panel c ) can binds to both the CMD1 and CrTET2 genomic loci. The forward primer of primer pair 2 is specific for a site upstream of CMD1 . Representative image is shown from at least three independent experiments. e, Southern blot analysis of the CMD1 genomic locus. The locations of the probe (dark blue bar) and the SalI and NheI restriction sites used for the digestion of the genomic DNA are indicated in panel c. Two bands detected in the lane of the cmd1 DNA sample arose from the mutant CMD1 locus with a 245-bp insert and the unaltered CrTET2 paralogous locus of almost identical sequence, respectively. Expected lengths of the detected restriction fragments are given in the brackets. Representative image is shown from two independent experiments. f, RT-PCR analysis of the region spanning the targeted site of exon 3. The expected lengths of PCR products from the wild-type and cmd1 cells are given in the brackets. Representative image is shown from two independent experiments. g, Co-segregation analysis of the CMD1 mutation in the progeny of a cross between wild-type CC124 with the cmd1 strain. Equal amounts of the cells were dripped on agar plates and exposed to low light (20 μmol photons·m −2 ·s −1 ) or high light (1000 μmol photons·m −2 ·s −1 ) for 66 h. A1 and A2 are the cmd1 and wild-type CC124 cells respectively. Red circles mark the clones of the parental cmd1 .
    Figure Legend Snippet: Generation of a cmd1 strain using a CRISPR/Cas9-based co-selection strategy and co-segregation of the high light-sensitive phenotype with the CMD1 mutation. a, The conversion of indole to tryptophan is catalyzed by the tryptophan (Trp) synthase β subunit encoded by the endogenous MAA7 gene in C. reinhardtii . When 5-fluoroindole (5-FI) is used in place of indole, it will be converted into 5-fluorotryptophan, which is lethally toxic to cells. b, The CRISPR/Cas9-mediated co-selection strategy to introduce mutation in C. reinhardtii . Recombinant Cas9 protein purified from E. coli was assembled with single guide RNA (sgRNA) for both the MAA7 gene and a target gene of interest to form RNP complexes. Upon electroporation of the mixture of the two RNP complexes into cells, 5-FI resistant colonies were selected and genotyped to identify clones with a desired mutation in the targeted gene. The mutant strains were then backcrossed with the wild-type strain to segregate the target gene mutation from the MAA7 mutation or other off-target mutations if any. c, The genomic loci of CMD1 (also known as CrTET1 ) and its close paralog CrTET2 . At the CMD1 locus of cmd1 cells, there is an insertion of 245 bp in the exon 3, thus generating a frame-shift mutation. Chromosome locations of the two paralogs are indicated on the top. DNA sequences from the targeted loci in wild-type and cmd1 strains are shown on the bottom. The 3-nt PAM and 20-nt sgRNA-binding sequences are distinctively colored. d, Genomic PCR genotyping of the cmd1 strain using two primer pairs as shown in panel c. Sizes expected for the PCR products are indicated. Note that the forward primer of primer pair 1 (panel c ) can binds to both the CMD1 and CrTET2 genomic loci. The forward primer of primer pair 2 is specific for a site upstream of CMD1 . Representative image is shown from at least three independent experiments. e, Southern blot analysis of the CMD1 genomic locus. The locations of the probe (dark blue bar) and the SalI and NheI restriction sites used for the digestion of the genomic DNA are indicated in panel c. Two bands detected in the lane of the cmd1 DNA sample arose from the mutant CMD1 locus with a 245-bp insert and the unaltered CrTET2 paralogous locus of almost identical sequence, respectively. Expected lengths of the detected restriction fragments are given in the brackets. Representative image is shown from two independent experiments. f, RT-PCR analysis of the region spanning the targeted site of exon 3. The expected lengths of PCR products from the wild-type and cmd1 cells are given in the brackets. Representative image is shown from two independent experiments. g, Co-segregation analysis of the CMD1 mutation in the progeny of a cross between wild-type CC124 with the cmd1 strain. Equal amounts of the cells were dripped on agar plates and exposed to low light (20 μmol photons·m −2 ·s −1 ) or high light (1000 μmol photons·m −2 ·s −1 ) for 66 h. A1 and A2 are the cmd1 and wild-type CC124 cells respectively. Red circles mark the clones of the parental cmd1 .

    Techniques Used: CRISPR, Selection, Mutagenesis, Introduce, Recombinant, Purification, Electroporation, Clone Assay, Binding Assay, Polymerase Chain Reaction, Southern Blot, Sequencing, Reverse Transcription Polymerase Chain Reaction

    7) Product Images from "Neuronal Activity Induction of the Stathmin-Like Gene RB3 in the Rat Hippocampus: Possible Role in Neuronal Plasticity"

    Article Title: Neuronal Activity Induction of the Stathmin-Like Gene RB3 in the Rat Hippocampus: Possible Role in Neuronal Plasticity

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.18-23-09780.1998

    The intron and exon structure of RB3 genomic DNA, determined by PCR amplification. Rat genomic DNA was amplified using the primers shown ( arrows labeled A – H ). The resulting PCR products are shown as unlabeled double - headed arrows below the gene
    Figure Legend Snippet: The intron and exon structure of RB3 genomic DNA, determined by PCR amplification. Rat genomic DNA was amplified using the primers shown ( arrows labeled A – H ). The resulting PCR products are shown as unlabeled double - headed arrows below the gene

    Techniques Used: Polymerase Chain Reaction, Amplification, Labeling

    8) Product Images from "Identification of an Enhancer That Increases miR-200b~200a~429 Gene Expression in Breast Cancer Cells"

    Article Title: Identification of an Enhancer That Increases miR-200b~200a~429 Gene Expression in Breast Cancer Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075517

    miR-200b eRNA is transcribed from the upstream intergenic enhancer region of miR-200b~200a~429. (A) Schematic representation of the miR-200b~200a~429 locus. Black box indicates the position of the potential enhancer. A black arrow marks the TSS direction of the primary miR-200b~200a~429 transcript. Grey boxes indicated the mature miR-200b, miR-200a and miR-429 genes. Black bars indicate the positions (in kilobases, kb) of the PCR primers used for qRT-PCR. (B) Expression levels of HOTAIR, miR-200b eRNA and the primary miR-200b~200a~429 transcript as determined by qRT-PCR in epithelial and mesenchymal HMLE cells using random hexamer primed cDNA synthesized from total RNA. The x-axis shows the distance from the miR-200b~200a~429 TSS in kb. Data represents mean ± SD of three independent experiments. (C) Schematic representation of the enhancer region located relative to the miR-200b~200a~429 TSS. Boxes indicate the locations of PCR amplicons used to detect the miR-200b eRNA in Figure 3B . RACE PCR primers and their start locations relative to the miR-200b~200a~429 are indicated. 5’ and 3’ RACE-seq analysis of the miR-200b eRNA with cDNA prepared from total RNA of HMLE, mesHMLE, MDA-MB-468 and MDA-MB-231 cells as described in the Materials and Methods. 5’ and 3’ ends of the miR-200b eRNA transcript are mapped as % total reads for each cell line with extreme 5’ and 3’ ends indicated by colored arrows below. A consensus miR-200b eRNA transcript is indicated.
    Figure Legend Snippet: miR-200b eRNA is transcribed from the upstream intergenic enhancer region of miR-200b~200a~429. (A) Schematic representation of the miR-200b~200a~429 locus. Black box indicates the position of the potential enhancer. A black arrow marks the TSS direction of the primary miR-200b~200a~429 transcript. Grey boxes indicated the mature miR-200b, miR-200a and miR-429 genes. Black bars indicate the positions (in kilobases, kb) of the PCR primers used for qRT-PCR. (B) Expression levels of HOTAIR, miR-200b eRNA and the primary miR-200b~200a~429 transcript as determined by qRT-PCR in epithelial and mesenchymal HMLE cells using random hexamer primed cDNA synthesized from total RNA. The x-axis shows the distance from the miR-200b~200a~429 TSS in kb. Data represents mean ± SD of three independent experiments. (C) Schematic representation of the enhancer region located relative to the miR-200b~200a~429 TSS. Boxes indicate the locations of PCR amplicons used to detect the miR-200b eRNA in Figure 3B . RACE PCR primers and their start locations relative to the miR-200b~200a~429 are indicated. 5’ and 3’ RACE-seq analysis of the miR-200b eRNA with cDNA prepared from total RNA of HMLE, mesHMLE, MDA-MB-468 and MDA-MB-231 cells as described in the Materials and Methods. 5’ and 3’ ends of the miR-200b eRNA transcript are mapped as % total reads for each cell line with extreme 5’ and 3’ ends indicated by colored arrows below. A consensus miR-200b eRNA transcript is indicated.

    Techniques Used: Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Random Hexamer Labeling, Synthesized, Multiple Displacement Amplification

    Gene expression analysis of miR-200b eRNA , miR-200b~200a~429 and EMT-affiliated genes. (A) Real-time PCR of miR-200b eRNA , EMT markers and miR-200 genes in a panel of breast epithelial and mesenchymal cell lines. mRNA (top panel) is normalized to GAPDH while miRNA (bottom panel) is normalized to U6 snRNA. Comparative quantitation was used to determine expression profiles of the genes in the cell line panel. Expression of E-cadherin and miR-200b eRNA in HMLE cells is set to a value of 1, whereas Zeb-1 is expressed relative to mesHMLE cells having a value of 1. Error bars represent mean ± SD of three independent experiments. (B) Relative expression levels of miR-200b eRNA during EMT time course of HMLE cells treated with TGF-β1 for up to 18 days. The realtime PCR data is normalized to GAPDH. Expression of miR-200b eRNA is set to a value of 1 in HMLE cells (C) Relative concentration of miR-200b eRNA , U6, HOTAIR, GAPDH and βActin RNA transcripts in the nucleus and cytoplasm of HMLE cells. Absolute quantitation was used to determine the expression level of each gene in the cytoplasmic and nuclear fractions. Error bars represent mean ± SD of three independent experiments.
    Figure Legend Snippet: Gene expression analysis of miR-200b eRNA , miR-200b~200a~429 and EMT-affiliated genes. (A) Real-time PCR of miR-200b eRNA , EMT markers and miR-200 genes in a panel of breast epithelial and mesenchymal cell lines. mRNA (top panel) is normalized to GAPDH while miRNA (bottom panel) is normalized to U6 snRNA. Comparative quantitation was used to determine expression profiles of the genes in the cell line panel. Expression of E-cadherin and miR-200b eRNA in HMLE cells is set to a value of 1, whereas Zeb-1 is expressed relative to mesHMLE cells having a value of 1. Error bars represent mean ± SD of three independent experiments. (B) Relative expression levels of miR-200b eRNA during EMT time course of HMLE cells treated with TGF-β1 for up to 18 days. The realtime PCR data is normalized to GAPDH. Expression of miR-200b eRNA is set to a value of 1 in HMLE cells (C) Relative concentration of miR-200b eRNA , U6, HOTAIR, GAPDH and βActin RNA transcripts in the nucleus and cytoplasm of HMLE cells. Absolute quantitation was used to determine the expression level of each gene in the cytoplasmic and nuclear fractions. Error bars represent mean ± SD of three independent experiments.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitation Assay, Polymerase Chain Reaction, Concentration Assay

    9) Product Images from "Identification of an Enhancer That Increases miR-200b~200a~429 Gene Expression in Breast Cancer Cells"

    Article Title: Identification of an Enhancer That Increases miR-200b~200a~429 Gene Expression in Breast Cancer Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075517

    miR-200b eRNA is transcribed from the upstream intergenic enhancer region of miR-200b~200a~429. (A) Schematic representation of the miR-200b~200a~429 locus. Black box indicates the position of the potential enhancer. A black arrow marks the TSS direction of the primary miR-200b~200a~429 transcript. Grey boxes indicated the mature miR-200b, miR-200a and miR-429 genes. Black bars indicate the positions (in kilobases, kb) of the PCR primers used for qRT-PCR. (B) Expression levels of HOTAIR, miR-200b eRNA and the primary miR-200b~200a~429 transcript as determined by qRT-PCR in epithelial and mesenchymal HMLE cells using random hexamer primed cDNA synthesized from total RNA. The x-axis shows the distance from the miR-200b~200a~429 TSS in kb. Data represents mean ± SD of three independent experiments. (C) Schematic representation of the enhancer region located relative to the miR-200b~200a~429 TSS. Boxes indicate the locations of PCR amplicons used to detect the miR-200b eRNA in Figure 3B . RACE PCR primers and their start locations relative to the miR-200b~200a~429 are indicated. 5’ and 3’ RACE-seq analysis of the miR-200b eRNA with cDNA prepared from total RNA of HMLE, mesHMLE, MDA-MB-468 and MDA-MB-231 cells as described in the Materials and Methods. 5’ and 3’ ends of the miR-200b eRNA transcript are mapped as % total reads for each cell line with extreme 5’ and 3’ ends indicated by colored arrows below. A consensus miR-200b eRNA transcript is indicated.
    Figure Legend Snippet: miR-200b eRNA is transcribed from the upstream intergenic enhancer region of miR-200b~200a~429. (A) Schematic representation of the miR-200b~200a~429 locus. Black box indicates the position of the potential enhancer. A black arrow marks the TSS direction of the primary miR-200b~200a~429 transcript. Grey boxes indicated the mature miR-200b, miR-200a and miR-429 genes. Black bars indicate the positions (in kilobases, kb) of the PCR primers used for qRT-PCR. (B) Expression levels of HOTAIR, miR-200b eRNA and the primary miR-200b~200a~429 transcript as determined by qRT-PCR in epithelial and mesenchymal HMLE cells using random hexamer primed cDNA synthesized from total RNA. The x-axis shows the distance from the miR-200b~200a~429 TSS in kb. Data represents mean ± SD of three independent experiments. (C) Schematic representation of the enhancer region located relative to the miR-200b~200a~429 TSS. Boxes indicate the locations of PCR amplicons used to detect the miR-200b eRNA in Figure 3B . RACE PCR primers and their start locations relative to the miR-200b~200a~429 are indicated. 5’ and 3’ RACE-seq analysis of the miR-200b eRNA with cDNA prepared from total RNA of HMLE, mesHMLE, MDA-MB-468 and MDA-MB-231 cells as described in the Materials and Methods. 5’ and 3’ ends of the miR-200b eRNA transcript are mapped as % total reads for each cell line with extreme 5’ and 3’ ends indicated by colored arrows below. A consensus miR-200b eRNA transcript is indicated.

    Techniques Used: Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Random Hexamer Labeling, Synthesized, Multiple Displacement Amplification

    Gene expression analysis of miR-200b eRNA , miR-200b~200a~429 and EMT-affiliated genes. (A) Real-time PCR of miR-200b eRNA , EMT markers and miR-200 genes in a panel of breast epithelial and mesenchymal cell lines. mRNA (top panel) is normalized to GAPDH while miRNA (bottom panel) is normalized to U6 snRNA. Comparative quantitation was used to determine expression profiles of the genes in the cell line panel. Expression of E-cadherin and miR-200b eRNA in HMLE cells is set to a value of 1, whereas Zeb-1 is expressed relative to mesHMLE cells having a value of 1. Error bars represent mean ± SD of three independent experiments. (B) Relative expression levels of miR-200b eRNA during EMT time course of HMLE cells treated with TGF-β1 for up to 18 days. The realtime PCR data is normalized to GAPDH. Expression of miR-200b eRNA is set to a value of 1 in HMLE cells (C) Relative concentration of miR-200b eRNA , U6, HOTAIR, GAPDH and βActin RNA transcripts in the nucleus and cytoplasm of HMLE cells. Absolute quantitation was used to determine the expression level of each gene in the cytoplasmic and nuclear fractions. Error bars represent mean ± SD of three independent experiments.
    Figure Legend Snippet: Gene expression analysis of miR-200b eRNA , miR-200b~200a~429 and EMT-affiliated genes. (A) Real-time PCR of miR-200b eRNA , EMT markers and miR-200 genes in a panel of breast epithelial and mesenchymal cell lines. mRNA (top panel) is normalized to GAPDH while miRNA (bottom panel) is normalized to U6 snRNA. Comparative quantitation was used to determine expression profiles of the genes in the cell line panel. Expression of E-cadherin and miR-200b eRNA in HMLE cells is set to a value of 1, whereas Zeb-1 is expressed relative to mesHMLE cells having a value of 1. Error bars represent mean ± SD of three independent experiments. (B) Relative expression levels of miR-200b eRNA during EMT time course of HMLE cells treated with TGF-β1 for up to 18 days. The realtime PCR data is normalized to GAPDH. Expression of miR-200b eRNA is set to a value of 1 in HMLE cells (C) Relative concentration of miR-200b eRNA , U6, HOTAIR, GAPDH and βActin RNA transcripts in the nucleus and cytoplasm of HMLE cells. Absolute quantitation was used to determine the expression level of each gene in the cytoplasmic and nuclear fractions. Error bars represent mean ± SD of three independent experiments.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitation Assay, Polymerase Chain Reaction, Concentration Assay

    10) Product Images from "An Ebox Element in the Proximal Gata4 Promoter Is Required for Gata4 Expression In Vivo"

    Article Title: An Ebox Element in the Proximal Gata4 Promoter Is Required for Gata4 Expression In Vivo

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029038

    Targeting of the Ebox in the mouse Gata4 promoter upstream of exon 1a. (A) Schematic representation of the Gata4 locus, targeting vector and final Cre-recombined Gata4 EboxKO allele. The targeting construct was designed to allow replacement of the Gata4 Ebox (white circle) by a Hind III restriction site. A neomycin cassette flanked by LoxP sites (black triangles) was also included to allow G418-mediated selection in ES cells. Black arrows indicate oligonucleotide primers and solid black bars indicate the location of the probes used for Southern blotting. H, Hind III; S, Sac I. (B) Southern blot analyses confirming the predicted targeting event on both the 5′ and 3′ side for an ES cell clone used to generate chimeras. Genomic DNA was analyzed using the indicated combination of restriction endonuclease and probe. MW, 1 kb DNA ladder; ES, ES cell genomic DNA. (C) PCR analysis of tail genomic DNA from F1 offspring using the primers 1 and 2 to amplify the wild-type allele and primers 1 and 3 to identify the mutated allele.
    Figure Legend Snippet: Targeting of the Ebox in the mouse Gata4 promoter upstream of exon 1a. (A) Schematic representation of the Gata4 locus, targeting vector and final Cre-recombined Gata4 EboxKO allele. The targeting construct was designed to allow replacement of the Gata4 Ebox (white circle) by a Hind III restriction site. A neomycin cassette flanked by LoxP sites (black triangles) was also included to allow G418-mediated selection in ES cells. Black arrows indicate oligonucleotide primers and solid black bars indicate the location of the probes used for Southern blotting. H, Hind III; S, Sac I. (B) Southern blot analyses confirming the predicted targeting event on both the 5′ and 3′ side for an ES cell clone used to generate chimeras. Genomic DNA was analyzed using the indicated combination of restriction endonuclease and probe. MW, 1 kb DNA ladder; ES, ES cell genomic DNA. (C) PCR analysis of tail genomic DNA from F1 offspring using the primers 1 and 2 to amplify the wild-type allele and primers 1 and 3 to identify the mutated allele.

    Techniques Used: Plasmid Preparation, Construct, Selection, Southern Blot, Polymerase Chain Reaction

    11) Product Images from "DNA Methylation Is the Primary Silencing Mechanism for a Set of Germ Line- and Tumor-Specific Genes with a CpG-Rich Promoter"

    Article Title: DNA Methylation Is the Primary Silencing Mechanism for a Set of Germ Line- and Tumor-Specific Genes with a CpG-Rich Promoter

    Journal: Molecular and Cellular Biology

    doi:

    Lack of MAGE-A1 expression after in vitro methylation. (A) A fragment of the MAGE-A1 gene extending from −375 to +3036 was cloned upstream to the luciferase reporter gene. This construct, either unmethylated or methylated with Sss I methylase, was stably transfected into MZ2-MEL.2.2.5 cells. Transcription directed by the MAGE-A1 promoter was assessed by measuring the amount of luciferase activity in the transfectants. (B) A construct with a 12-kb genomic fragment containing MAGE-A1 was either unmethylated or methylated with Sss I and was stably transfected in MZ2-MEL.2.2.5 cells. RT-PCR were performed to test the expression of the transfected MAGE-A1 gene.
    Figure Legend Snippet: Lack of MAGE-A1 expression after in vitro methylation. (A) A fragment of the MAGE-A1 gene extending from −375 to +3036 was cloned upstream to the luciferase reporter gene. This construct, either unmethylated or methylated with Sss I methylase, was stably transfected into MZ2-MEL.2.2.5 cells. Transcription directed by the MAGE-A1 promoter was assessed by measuring the amount of luciferase activity in the transfectants. (B) A construct with a 12-kb genomic fragment containing MAGE-A1 was either unmethylated or methylated with Sss I and was stably transfected in MZ2-MEL.2.2.5 cells. RT-PCR were performed to test the expression of the transfected MAGE-A1 gene.

    Techniques Used: Expressing, In Vitro, Methylation, Clone Assay, Luciferase, Construct, Stable Transfection, Transfection, Activity Assay, Reverse Transcription Polymerase Chain Reaction

    The amount of MAGE-A1 PCR product is proportional to the amount of template RNA. Total RNA from the LB373-MEL cell line, which expresses MAGE-A1 , was progressively diluted in total RNA from the LB23-SAR cell line, which does not express MAGE-A1 . RNA samples containing the indicated amount of LB373-MEL RNA were converted to cDNA and amplified by PCR for MAGE-A1 (27 cycles) in the presence of [α- 32 P]dCTP. The PCR products were separated in a 1.7% agarose gel, and the incorporated radioactivity was counted with a PhosphorImager. The relative amount of 32 P incorporation is indicated below each band.
    Figure Legend Snippet: The amount of MAGE-A1 PCR product is proportional to the amount of template RNA. Total RNA from the LB373-MEL cell line, which expresses MAGE-A1 , was progressively diluted in total RNA from the LB23-SAR cell line, which does not express MAGE-A1 . RNA samples containing the indicated amount of LB373-MEL RNA were converted to cDNA and amplified by PCR for MAGE-A1 (27 cycles) in the presence of [α- 32 P]dCTP. The PCR products were separated in a 1.7% agarose gel, and the incorporated radioactivity was counted with a PhosphorImager. The relative amount of 32 P incorporation is indicated below each band.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Radioactivity

    MAGE-A1 expression levels in 5′-aza-2′-deoxycytidine-treated cell lines and clones. (A) RNA was extracted from cell lines LB23-SAR and MI665/2-MEL before treatment (−), at the end of 5′-aza-2′-deoxycytidine treatment (+Azadc), or at the number of days indicated after the end of treatment. RT-PCR amplifications were performed with primers specific to MAGE-A1 and in the presence of [α- 32 P]dCTP. Band intensities were quantified with a PhosphorImager. The expression level (below each PCR band) was normalized with the β-actin messenger level of the same sample and expressed relative to the expression level of melanoma cell line LB373-MEL. Values are the mean of two independent PCR experiments. (B) The same analysis was carried out with cell clones derived from the 5′-aza-2′-deoxycytidine-treated LB23-SAR and MI665/2-MEL cell lines.
    Figure Legend Snippet: MAGE-A1 expression levels in 5′-aza-2′-deoxycytidine-treated cell lines and clones. (A) RNA was extracted from cell lines LB23-SAR and MI665/2-MEL before treatment (−), at the end of 5′-aza-2′-deoxycytidine treatment (+Azadc), or at the number of days indicated after the end of treatment. RT-PCR amplifications were performed with primers specific to MAGE-A1 and in the presence of [α- 32 P]dCTP. Band intensities were quantified with a PhosphorImager. The expression level (below each PCR band) was normalized with the β-actin messenger level of the same sample and expressed relative to the expression level of melanoma cell line LB373-MEL. Values are the mean of two independent PCR experiments. (B) The same analysis was carried out with cell clones derived from the 5′-aza-2′-deoxycytidine-treated LB23-SAR and MI665/2-MEL cell lines.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Clone Assay, Derivative Assay

    Stable expression of gene MAGE-A1 in clones derived from cell lines LB23-SAR and MI665/2-MEL treated with 5′-aza-2′-deoxycytidine. Cell clones derived from the treated LB23-SAR cell line (S14 and S19) and from the treated MI665/2-MEL cell line (M8 and M18) were maintained in culture in the absence of the demethylating agent. The expression of MAGE-A1 was assessed by RT-PCR on RNA extracted from these clones at two different times. Indicated days correspond to the days after drug withdrawal from the two cell lines.
    Figure Legend Snippet: Stable expression of gene MAGE-A1 in clones derived from cell lines LB23-SAR and MI665/2-MEL treated with 5′-aza-2′-deoxycytidine. Cell clones derived from the treated LB23-SAR cell line (S14 and S19) and from the treated MI665/2-MEL cell line (M8 and M18) were maintained in culture in the absence of the demethylating agent. The expression of MAGE-A1 was assessed by RT-PCR on RNA extracted from these clones at two different times. Indicated days correspond to the days after drug withdrawal from the two cell lines.

    Techniques Used: Expressing, Clone Assay, Derivative Assay, Reverse Transcription Polymerase Chain Reaction

    12) Product Images from "MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5"

    Article Title: MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201501002

    TFEB translocates to the nucleus during mitophagy in a Parkin- and PINK1-dependent manner. (A) YFP-Parkin HeLa cells were treated with O/A for up to 10 h, fractionated, and immunoblotted. (B) Quantification of data in A. Endogenous TFEB expression was normalized to GAPDH (cytosol) or histone H3 (nuclear) and nuclear TFEB expressed as a percentage of total TFEB. Data are means ± SD ( n = 3). (C) mCherry-Parkin HeLa cells were left untreated (Control), starved (2 h), or treated with torin 1 (2 h), O/A (6 h), or valinomycin (Val; 6 h). CIP treatment of cell lysates was performed before immunoblotting. (D) WT and mCherry-Parkin HeLa cells were treated with DMSO or O/A (6 h), lysed, and immunoblotted. A CIP-treated control was included as a reference for total TFEB dephosphorylation. (E) WT and mCherry-Parkin HeLa cells were treated with DMSO, torin 1, or O/A for 18 h and analyzed by quantitative PCR for TFEB target gene expression. Data are means ± SD ( n = 3). (F) WT and PINK1 KO HeLa cells stably expressing TFEB-GFP with or without mCherry-Parkin were treated as in C. Fixed cells were stained with DAPI and analyzed by immunofluorescence. Bars, 10 µm. See Fig. S1 F for quantification. *, P
    Figure Legend Snippet: TFEB translocates to the nucleus during mitophagy in a Parkin- and PINK1-dependent manner. (A) YFP-Parkin HeLa cells were treated with O/A for up to 10 h, fractionated, and immunoblotted. (B) Quantification of data in A. Endogenous TFEB expression was normalized to GAPDH (cytosol) or histone H3 (nuclear) and nuclear TFEB expressed as a percentage of total TFEB. Data are means ± SD ( n = 3). (C) mCherry-Parkin HeLa cells were left untreated (Control), starved (2 h), or treated with torin 1 (2 h), O/A (6 h), or valinomycin (Val; 6 h). CIP treatment of cell lysates was performed before immunoblotting. (D) WT and mCherry-Parkin HeLa cells were treated with DMSO or O/A (6 h), lysed, and immunoblotted. A CIP-treated control was included as a reference for total TFEB dephosphorylation. (E) WT and mCherry-Parkin HeLa cells were treated with DMSO, torin 1, or O/A for 18 h and analyzed by quantitative PCR for TFEB target gene expression. Data are means ± SD ( n = 3). (F) WT and PINK1 KO HeLa cells stably expressing TFEB-GFP with or without mCherry-Parkin were treated as in C. Fixed cells were stained with DAPI and analyzed by immunofluorescence. Bars, 10 µm. See Fig. S1 F for quantification. *, P

    Techniques Used: Expressing, De-Phosphorylation Assay, Real-time Polymerase Chain Reaction, Stable Transfection, Staining, Immunofluorescence

    13) Product Images from "Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure, et al. Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure"

    Article Title: Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure, et al. Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure

    Journal: The Journal of Gene Medicine

    doi: 10.1002/jgm.3115

    Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively
    Figure Legend Snippet: Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Techniques Used: Derivative Assay, Transfection, Plasmid Preparation, Amplification, Polymerase Chain Reaction

    14) Product Images from "ZASC1 Stimulates HIV-1 Transcription Elongation by Recruiting P-TEFb and TAT to the LTR Promoter"

    Article Title: ZASC1 Stimulates HIV-1 Transcription Elongation by Recruiting P-TEFb and TAT to the LTR Promoter

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1003712

    ZASC1 recruits P-TEFb and TAT to the HIV-1 promoter in the absence of TAR. The ability of ZASC1 to recruit P-TEFb and TAT to the HIV promoter was assessed by stably transfecting HeLa cells with a reporter plasmid containing a HIV promoter lacking a TAR element (WT or a variant with all ZBS mutated) and driving expression of the gLUC reporter enzyme. For TAT ChIP, the cells were transfected with HA-tagged TAT. ChIP experiments against endogenous proteins or TAT were performed using antibodies against (A) ZASC1 (B) CycT1 (C) CDK9 (D) Hexim1 (E) HA epitope (TAT) and (F) SP1. Real-time PCR was performed in triplicate using a primer set that spans the ZBS at the U3/R boundary (−116 to +25). Error bars indicate the standard deviation of the data and are representative of three independent experiments. P-values were calculated using a standard Student's t-test.
    Figure Legend Snippet: ZASC1 recruits P-TEFb and TAT to the HIV-1 promoter in the absence of TAR. The ability of ZASC1 to recruit P-TEFb and TAT to the HIV promoter was assessed by stably transfecting HeLa cells with a reporter plasmid containing a HIV promoter lacking a TAR element (WT or a variant with all ZBS mutated) and driving expression of the gLUC reporter enzyme. For TAT ChIP, the cells were transfected with HA-tagged TAT. ChIP experiments against endogenous proteins or TAT were performed using antibodies against (A) ZASC1 (B) CycT1 (C) CDK9 (D) Hexim1 (E) HA epitope (TAT) and (F) SP1. Real-time PCR was performed in triplicate using a primer set that spans the ZBS at the U3/R boundary (−116 to +25). Error bars indicate the standard deviation of the data and are representative of three independent experiments. P-values were calculated using a standard Student's t-test.

    Techniques Used: Stable Transfection, Plasmid Preparation, Variant Assay, Expressing, Chromatin Immunoprecipitation, Transfection, Real-time Polymerase Chain Reaction, Standard Deviation

    15) Product Images from "Involvement of an alternatively spliced mitochondrial oxodicarboxylate carrier in adipogenesis in 3T3-L1 cells"

    Article Title: Involvement of an alternatively spliced mitochondrial oxodicarboxylate carrier in adipogenesis in 3T3-L1 cells

    Journal: Journal of Biomedical Science

    doi: 10.1186/1423-0127-16-92

    RT-PCR analysis of ODC-AS expression in 3T3-L1 cells . Expression of ODC-AS and ODC mRNA in 3T3-L1 Cells were detected with RT-PCR in mRNAs prepared at the indicated days from 3T3-L1 cell pre- and after differentiation, and visualized under UV after agarose gel electrophoresis with ethidium bromide. 1 kb DNA standards is shown on the right. The addition of differentiation reagents was indicated at the bottom. G3PDH was amplified as an internal control and shown below. L: 1 kb DNA ladder; PC: positive control for ODC from cloned cDNA plasmid; NC: negative control for G3PDH (water).
    Figure Legend Snippet: RT-PCR analysis of ODC-AS expression in 3T3-L1 cells . Expression of ODC-AS and ODC mRNA in 3T3-L1 Cells were detected with RT-PCR in mRNAs prepared at the indicated days from 3T3-L1 cell pre- and after differentiation, and visualized under UV after agarose gel electrophoresis with ethidium bromide. 1 kb DNA standards is shown on the right. The addition of differentiation reagents was indicated at the bottom. G3PDH was amplified as an internal control and shown below. L: 1 kb DNA ladder; PC: positive control for ODC from cloned cDNA plasmid; NC: negative control for G3PDH (water).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Amplification, Positive Control, Clone Assay, Plasmid Preparation, Negative Control

    ODC and ODC-AS expression in fat tissues . A. ODC-AS gene expression in fat tissues by cold exposure. ODC-AS expression in brown adipose tissue (BAT) and white adipose tissue (WAT) as quantified by real-time PCR and expressed as the fold increase of G3PDH, after 18 hour exposure of mice at 4°C and room temperature. Data shown are means ± S.D, n = 5. * indicates P
    Figure Legend Snippet: ODC and ODC-AS expression in fat tissues . A. ODC-AS gene expression in fat tissues by cold exposure. ODC-AS expression in brown adipose tissue (BAT) and white adipose tissue (WAT) as quantified by real-time PCR and expressed as the fold increase of G3PDH, after 18 hour exposure of mice at 4°C and room temperature. Data shown are means ± S.D, n = 5. * indicates P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Mouse Assay

    ODC-AS knockdown and qRT-PCR of marker genes in adipogenesis . 3T3-L1 preadipocytes were infected with lentivirus (Nsi, ODCi-3 or ODCi-5) before the induction for differentiation. Twenty four hours after induction, the cells were collected and examined for mRNA levels of PPARγ, C/EBPα, aP2 and CD36 (see Methods). Data were expressed as means ± SEM (n = 3), relative to Nsi. *compared with Nsi: P
    Figure Legend Snippet: ODC-AS knockdown and qRT-PCR of marker genes in adipogenesis . 3T3-L1 preadipocytes were infected with lentivirus (Nsi, ODCi-3 or ODCi-5) before the induction for differentiation. Twenty four hours after induction, the cells were collected and examined for mRNA levels of PPARγ, C/EBPα, aP2 and CD36 (see Methods). Data were expressed as means ± SEM (n = 3), relative to Nsi. *compared with Nsi: P

    Techniques Used: Quantitative RT-PCR, Marker, Infection

    16) Product Images from "Involvement of an alternatively spliced mitochondrial oxodicarboxylate carrier in adipogenesis in 3T3-L1 cells"

    Article Title: Involvement of an alternatively spliced mitochondrial oxodicarboxylate carrier in adipogenesis in 3T3-L1 cells

    Journal: Journal of Biomedical Science

    doi: 10.1186/1423-0127-16-92

    RT-PCR analysis of ODC-AS expression in 3T3-L1 cells . Expression of ODC-AS and ODC mRNA in 3T3-L1 Cells were detected with RT-PCR in mRNAs prepared at the indicated days from 3T3-L1 cell pre- and after differentiation, and visualized under UV after agarose gel electrophoresis with ethidium bromide. 1 kb DNA standards is shown on the right. The addition of differentiation reagents was indicated at the bottom. G3PDH was amplified as an internal control and shown below. L: 1 kb DNA ladder; PC: positive control for ODC from cloned cDNA plasmid; NC: negative control for G3PDH (water).
    Figure Legend Snippet: RT-PCR analysis of ODC-AS expression in 3T3-L1 cells . Expression of ODC-AS and ODC mRNA in 3T3-L1 Cells were detected with RT-PCR in mRNAs prepared at the indicated days from 3T3-L1 cell pre- and after differentiation, and visualized under UV after agarose gel electrophoresis with ethidium bromide. 1 kb DNA standards is shown on the right. The addition of differentiation reagents was indicated at the bottom. G3PDH was amplified as an internal control and shown below. L: 1 kb DNA ladder; PC: positive control for ODC from cloned cDNA plasmid; NC: negative control for G3PDH (water).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Amplification, Positive Control, Clone Assay, Plasmid Preparation, Negative Control

    ODC and ODC-AS expression in fat tissues . A. ODC-AS gene expression in fat tissues by cold exposure. ODC-AS expression in brown adipose tissue (BAT) and white adipose tissue (WAT) as quantified by real-time PCR and expressed as the fold increase of G3PDH, after 18 hour exposure of mice at 4°C and room temperature. Data shown are means ± S.D, n = 5. * indicates P
    Figure Legend Snippet: ODC and ODC-AS expression in fat tissues . A. ODC-AS gene expression in fat tissues by cold exposure. ODC-AS expression in brown adipose tissue (BAT) and white adipose tissue (WAT) as quantified by real-time PCR and expressed as the fold increase of G3PDH, after 18 hour exposure of mice at 4°C and room temperature. Data shown are means ± S.D, n = 5. * indicates P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Mouse Assay

    ODC-AS knockdown and qRT-PCR of marker genes in adipogenesis . 3T3-L1 preadipocytes were infected with lentivirus (Nsi, ODCi-3 or ODCi-5) before the induction for differentiation. Twenty four hours after induction, the cells were collected and examined for mRNA levels of PPARγ, C/EBPα, aP2 and CD36 (see Methods). Data were expressed as means ± SEM (n = 3), relative to Nsi. *compared with Nsi: P
    Figure Legend Snippet: ODC-AS knockdown and qRT-PCR of marker genes in adipogenesis . 3T3-L1 preadipocytes were infected with lentivirus (Nsi, ODCi-3 or ODCi-5) before the induction for differentiation. Twenty four hours after induction, the cells were collected and examined for mRNA levels of PPARγ, C/EBPα, aP2 and CD36 (see Methods). Data were expressed as means ± SEM (n = 3), relative to Nsi. *compared with Nsi: P

    Techniques Used: Quantitative RT-PCR, Marker, Infection

    17) Product Images from "The SPF27 Homologue Num1 Connects Splicing and Kinesin 1-Dependent Cytoplasmic Trafficking in Ustilago maydis"

    Article Title: The SPF27 Homologue Num1 Connects Splicing and Kinesin 1-Dependent Cytoplasmic Trafficking in Ustilago maydis

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1004046

    Reduced splicing efficiency of the rbf1 -gene leads to impaired function of the Rbf1 master regulator. ( A ) Plot depicting splicing efficiency of the rbf1 -gene. Plotted are the FPKM values (fragments per kilobase of sequence per million fragments mapped) across the genomic region indicated (coordinates in nucleotides) of three independent RNA-Seq experiments for AB31 wild-type (blue lines) and AB31 Δnum1 (red lines), respectively. Exons (E) and introns (I) are indicated. All four introns show increased intron retention rates in AB31 Δnum1 . ( B ) Western analysis showing abundance of Rbf1:3×HA and α-tubulin (loading control) from AB31 wild-type and Δ num1 -deletion strains. In AB31 Δnum1 , Rbf1 is reduced to 30% of wild-type-level (Quantification: ImageJ [109] ). ( C, D ) Gene expression analyses of b - and rbf1 -genes ( C ) as well as rbf1 -target genes ( D ) using qRT-PCR. RNA samples were isolated from strains AB31 and AB31 Δnum1 eight hours after induction of the bE1/bW2-heterodimer. Gene expression is shown relative to the highest expression value, using actin and eIF2b for normalization. Shown are the mean values of three biological and two technical replicates. Error bars represent the SD. ( E ) Venn diagram depicting the total number of genes repressed in AB31 Δnum1 and AB31 Δrbf1 . * RNA-Seq analysis, this study; ** Microarray analysis conducted five hours after induction of the bE1/bW2-heterodimer [2] .
    Figure Legend Snippet: Reduced splicing efficiency of the rbf1 -gene leads to impaired function of the Rbf1 master regulator. ( A ) Plot depicting splicing efficiency of the rbf1 -gene. Plotted are the FPKM values (fragments per kilobase of sequence per million fragments mapped) across the genomic region indicated (coordinates in nucleotides) of three independent RNA-Seq experiments for AB31 wild-type (blue lines) and AB31 Δnum1 (red lines), respectively. Exons (E) and introns (I) are indicated. All four introns show increased intron retention rates in AB31 Δnum1 . ( B ) Western analysis showing abundance of Rbf1:3×HA and α-tubulin (loading control) from AB31 wild-type and Δ num1 -deletion strains. In AB31 Δnum1 , Rbf1 is reduced to 30% of wild-type-level (Quantification: ImageJ [109] ). ( C, D ) Gene expression analyses of b - and rbf1 -genes ( C ) as well as rbf1 -target genes ( D ) using qRT-PCR. RNA samples were isolated from strains AB31 and AB31 Δnum1 eight hours after induction of the bE1/bW2-heterodimer. Gene expression is shown relative to the highest expression value, using actin and eIF2b for normalization. Shown are the mean values of three biological and two technical replicates. Error bars represent the SD. ( E ) Venn diagram depicting the total number of genes repressed in AB31 Δnum1 and AB31 Δrbf1 . * RNA-Seq analysis, this study; ** Microarray analysis conducted five hours after induction of the bE1/bW2-heterodimer [2] .

    Techniques Used: Sequencing, RNA Sequencing Assay, Western Blot, Expressing, Quantitative RT-PCR, Isolation, Microarray

    18) Product Images from "Divergent roles of endothelial NF-?B in multiple organ injury and bacterial clearance in mouse models of sepsis"

    Article Title: Divergent roles of endothelial NF-?B in multiple organ injury and bacterial clearance in mouse models of sepsis

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20071393

    I-κBαmt mRNA expression in whole blood cells of EC-rtTA/I-κBαmt mice. Mice 1 and 2 (Ms1 and Ms2) were not fed with Dox, and mice 3–5 (Ms3, Ms4, and Ms5) were fed with Dox for 4 d. RT-PCR detected no I-κBαmt expression in whole blood cells and lungs of Ms1 and Ms2 (without Dox), and detected a strong I-κBαmt band in lungs but not in whole blood cells of Ms3, Ms4, and Ms5 (with Dox). GAPDH serves as internal control. Bld, whole blood cells; Lug, lungs; M, DNA marker; P, positive control.
    Figure Legend Snippet: I-κBαmt mRNA expression in whole blood cells of EC-rtTA/I-κBαmt mice. Mice 1 and 2 (Ms1 and Ms2) were not fed with Dox, and mice 3–5 (Ms3, Ms4, and Ms5) were fed with Dox for 4 d. RT-PCR detected no I-κBαmt expression in whole blood cells and lungs of Ms1 and Ms2 (without Dox), and detected a strong I-κBαmt band in lungs but not in whole blood cells of Ms3, Ms4, and Ms5 (with Dox). GAPDH serves as internal control. Bld, whole blood cells; Lug, lungs; M, DNA marker; P, positive control.

    Techniques Used: Expressing, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Marker, Positive Control

    Generation of double TG EC-rtTA/I-κBαmt mice. (A) Schematic representation of VeCadrtTA and TreI-κBαmt transgenes. Transactivator (rtTA) expression is controlled by the endothelial-specific promoter VE–cadherin-5 (Ve-cad). Human I-κBαmt gene expression is controlled by a TRE-CMV fusion promoter, whose activation requires the binding of rtTA and Dox. (B and C) RT-PCR photograph showing Dox-induced I-κBαmt mRNA expression in EC-rtTA/I-κBαmt TG mice. Mouse TV616 was fed with Dox for 4 d, and mouse TV614, a transgene-positive littermate of TV616, was not fed with Dox. RT-PCR analysis detected I-κBαmt mRNA expression in 11 out of the 12 organs from mouse TV616 (B) but detected no I-κBαmt expression in any organ from mouse TV614 (C). GAPDH serves as internal control. Aot, aorta; Brn, brain; Ht, heart; Itn, intestine; Kid, kidney; Liv, liver; Lug, lungs; M, DNA marker; N, negative control; P, positive control; Skm, skeletal muscle; Spl, spleen; Stam, stomach; Thyd, thyroid; Ton, tongue. (D–F) Immunofluorescence staining for Dox-induced I-κBαmt protein expression in lung sections of EC-rtTA/I-κBαmt mice. (D) Dox + mice, preimmune IgG, no staining. (E) Dox − mice, anti–human I-κBα, weak staining (endogenous mouse I-κBα). (F) Dox + mice, anti–human I-κBα, stronger staining (Dox-induced I-κBαmt protein). Bars, 100 μm.
    Figure Legend Snippet: Generation of double TG EC-rtTA/I-κBαmt mice. (A) Schematic representation of VeCadrtTA and TreI-κBαmt transgenes. Transactivator (rtTA) expression is controlled by the endothelial-specific promoter VE–cadherin-5 (Ve-cad). Human I-κBαmt gene expression is controlled by a TRE-CMV fusion promoter, whose activation requires the binding of rtTA and Dox. (B and C) RT-PCR photograph showing Dox-induced I-κBαmt mRNA expression in EC-rtTA/I-κBαmt TG mice. Mouse TV616 was fed with Dox for 4 d, and mouse TV614, a transgene-positive littermate of TV616, was not fed with Dox. RT-PCR analysis detected I-κBαmt mRNA expression in 11 out of the 12 organs from mouse TV616 (B) but detected no I-κBαmt expression in any organ from mouse TV614 (C). GAPDH serves as internal control. Aot, aorta; Brn, brain; Ht, heart; Itn, intestine; Kid, kidney; Liv, liver; Lug, lungs; M, DNA marker; N, negative control; P, positive control; Skm, skeletal muscle; Spl, spleen; Stam, stomach; Thyd, thyroid; Ton, tongue. (D–F) Immunofluorescence staining for Dox-induced I-κBαmt protein expression in lung sections of EC-rtTA/I-κBαmt mice. (D) Dox + mice, preimmune IgG, no staining. (E) Dox − mice, anti–human I-κBα, weak staining (endogenous mouse I-κBα). (F) Dox + mice, anti–human I-κBα, stronger staining (Dox-induced I-κBαmt protein). Bars, 100 μm.

    Techniques Used: Mouse Assay, Expressing, Activation Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Immunofluorescence, Staining

    19) Product Images from "Systematic Screening, Rational Development, and Initial Optimization of Efficacious RNA Silencing Agents for Human Rod Opsin Therapeutics"

    Article Title: Systematic Screening, Rational Development, and Initial Optimization of Efficacious RNA Silencing Agents for Human Rod Opsin Therapeutics

    Journal: Translational Vision Science & Technology

    doi: 10.1167/tvst.8.6.28

    Rational optimization tests of the 725 hhRz. (A) In vitro co-synthesis with cleavage assay comparing the 725 hhRz with 4-bp stem II in the pPrislei versus pUC-VAL VAI RNA scaffolds against the short RHO target. Linearized plasmids in defined molar ratio (6:1 ribozyme:target) were transcribed by T7 RNA polymerase and cleavage emerged during the 3-hour incubation prior to analysis by PAGE-urea gel electrophoresis and staining with RNA dye (SYBR Gold). Substrate short RHO is labeled (green arrow) and the mobility of the different scaffold-hhRz RNAs is labeled (blue arrow). Note that the extent of cleavage products (P1, P2) (red arrows) with the 725 hhRz within the Prislei VAI scaffold is greater than with the same 725 hhRz within the pUC-VAL VAI scaffold. There is no cleavage without the hhRz within the scaffold (not shown for pPrislei) and inactivating mutations in the catalytic core of the 725 hhRz (G12C) obviates cleavage (data not shown for pPrislei). Eight percent (wt/vol) PEG 8000 was used to simulate the viscosity of the cytoplasm. (B) In cellula cotransfection of plasmids that express the 4-bp stem II hhRz within the pUC-VAL and pPrislei scaffolds with plasmid that expresses full-length fix-5′UT human RHO mRNA. Additional comparisons are the inactivated 725 hhRz, 725 hhRzs with upstream tertiary accessory elements (RzB, RzC, RzD). Human RHO mRNA was quantified by real time RT/PCR with hRHO cDNA standardized data comparison. For the pUC-VAL scaffold one-way ANOVA showed significant differences between samples (P = 0.042). There was a 49.4% reduction of hRHO mRNA by the active 725 hhRz relative to control (P = 0.03375). Catalytic core mutation caused 14.2% reduction of hRHO mRNA but this was not statistically different relative to control or to the active 725 hhRz (P > 0.05). In the pUC-VAL scaffold the remaining constructs (RzB, RzC, RzD) did not show significant knockdown of hRHO mRNA relative to control. For the pPrislei scaffold one-way ANOVA showed significant differences among all the samples (P = 1.92 E−5 ). The active 725 hhRz showed 68.4% knockdown of hRHO mRNA relative to control (scaffold alone; P = 1.36 E−6 ). The inactivated 725 hhRz exerted 23.8% knockdown but this was not significantly different from control (P = 0.17586). However, the active and inactivated 725 hhRzs showed significantly different knockdown of hRHO mRNA by t-test (P = 4.91 E−5 ). All other hhRzs within pPrislei with TAE elements did not achieve significant knockdown of hRHO (P > 0.05). (C) Verifying accessibility in the predicted large platform (nts: 653–763) of accessibility in hRHO mRNA (green arrow). Various hhRzs (blue arrow) within the pPrislei scaffold targeted sites both inside (725, 689, 700, 707) and outside (785) the predicted accessibility platform were tested for capacity to cleave hRHO mRNA. All targeting sites were GUC↓ cleavage motifs. Reaction conditions used were as in Figure 8A. Cleavage products (red arrows) are only present when attacking predicted accessible target sites. Cleavage sites vary in size depending upon the location of the cleavage motif. Inactivating the core of the hhRz prevents cleavage. The noncleaving 785 site is just outside the accessible region but is in one of the most stable regions of the target hRHO mRNA fold.
    Figure Legend Snippet: Rational optimization tests of the 725 hhRz. (A) In vitro co-synthesis with cleavage assay comparing the 725 hhRz with 4-bp stem II in the pPrislei versus pUC-VAL VAI RNA scaffolds against the short RHO target. Linearized plasmids in defined molar ratio (6:1 ribozyme:target) were transcribed by T7 RNA polymerase and cleavage emerged during the 3-hour incubation prior to analysis by PAGE-urea gel electrophoresis and staining with RNA dye (SYBR Gold). Substrate short RHO is labeled (green arrow) and the mobility of the different scaffold-hhRz RNAs is labeled (blue arrow). Note that the extent of cleavage products (P1, P2) (red arrows) with the 725 hhRz within the Prislei VAI scaffold is greater than with the same 725 hhRz within the pUC-VAL VAI scaffold. There is no cleavage without the hhRz within the scaffold (not shown for pPrislei) and inactivating mutations in the catalytic core of the 725 hhRz (G12C) obviates cleavage (data not shown for pPrislei). Eight percent (wt/vol) PEG 8000 was used to simulate the viscosity of the cytoplasm. (B) In cellula cotransfection of plasmids that express the 4-bp stem II hhRz within the pUC-VAL and pPrislei scaffolds with plasmid that expresses full-length fix-5′UT human RHO mRNA. Additional comparisons are the inactivated 725 hhRz, 725 hhRzs with upstream tertiary accessory elements (RzB, RzC, RzD). Human RHO mRNA was quantified by real time RT/PCR with hRHO cDNA standardized data comparison. For the pUC-VAL scaffold one-way ANOVA showed significant differences between samples (P = 0.042). There was a 49.4% reduction of hRHO mRNA by the active 725 hhRz relative to control (P = 0.03375). Catalytic core mutation caused 14.2% reduction of hRHO mRNA but this was not statistically different relative to control or to the active 725 hhRz (P > 0.05). In the pUC-VAL scaffold the remaining constructs (RzB, RzC, RzD) did not show significant knockdown of hRHO mRNA relative to control. For the pPrislei scaffold one-way ANOVA showed significant differences among all the samples (P = 1.92 E−5 ). The active 725 hhRz showed 68.4% knockdown of hRHO mRNA relative to control (scaffold alone; P = 1.36 E−6 ). The inactivated 725 hhRz exerted 23.8% knockdown but this was not significantly different from control (P = 0.17586). However, the active and inactivated 725 hhRzs showed significantly different knockdown of hRHO mRNA by t-test (P = 4.91 E−5 ). All other hhRzs within pPrislei with TAE elements did not achieve significant knockdown of hRHO (P > 0.05). (C) Verifying accessibility in the predicted large platform (nts: 653–763) of accessibility in hRHO mRNA (green arrow). Various hhRzs (blue arrow) within the pPrislei scaffold targeted sites both inside (725, 689, 700, 707) and outside (785) the predicted accessibility platform were tested for capacity to cleave hRHO mRNA. All targeting sites were GUC↓ cleavage motifs. Reaction conditions used were as in Figure 8A. Cleavage products (red arrows) are only present when attacking predicted accessible target sites. Cleavage sites vary in size depending upon the location of the cleavage motif. Inactivating the core of the hhRz prevents cleavage. The noncleaving 785 site is just outside the accessible region but is in one of the most stable regions of the target hRHO mRNA fold.

    Techniques Used: In Vitro, Cleavage Assay, Incubation, Polyacrylamide Gel Electrophoresis, Nucleic Acid Electrophoresis, Staining, Labeling, Cotransfection, Plasmid Preparation, Quantitative RT-PCR, Mutagenesis, Construct

    In vitro and in cellula 725 ribozyme cleavage assays-stem-II optimization. (A) In vitro transcription/cleavage reactions were performed and run on a 5% denaturing PAGE gel with 8 M urea relative to RNA size markers (lane 1). The mobility of the scaffold and active and inactive (G12C) ribozymes (lanes 2–4) and the short RHO substrate (511 nt; lane 5) are shown. Cleavage products of 371 nt (red arrow) and 140 nt (blue arrow) are only identified with a catalytically active 725 hhRz 16 is embedded in the scaffold (lane 7) but not from the pUC-VAL scaffold itself (lane 6) or with a 725 hhRz 16 that had a catalytic core inactivating mutation (G12C; lane 8). (B) In vitro analysis of short hRHO (511 nt) and full-length (1532 nt) hRHO mRNAs, transcribed in vitro but analyzed on nondenaturing PAGE gels relative to RNA size mobility markers. For the short hRHO (left panel) there are two prominent bands. For the full-length hRHO (right panel) there appear to be at least three well-populated conformational states. (C) In cellula assay to assess target hRHO mRNA knockdown in the pUC-VAI scaffold. HEK293S cells were transiently co-transfected with pNEB-VAI-hhRz-1 and pRHO-fix5UT. Total RNA was extracted from transfected cells 48 hours posttransfection and analyzed for relative hRHO mRNA levels using qRT-PCR. Mean percent control vector transfection hRHO mRNA levels are shown ± SEM (one-way ANOVA P = 3.54, P = 0.03). Asterisks denote significant (P
    Figure Legend Snippet: In vitro and in cellula 725 ribozyme cleavage assays-stem-II optimization. (A) In vitro transcription/cleavage reactions were performed and run on a 5% denaturing PAGE gel with 8 M urea relative to RNA size markers (lane 1). The mobility of the scaffold and active and inactive (G12C) ribozymes (lanes 2–4) and the short RHO substrate (511 nt; lane 5) are shown. Cleavage products of 371 nt (red arrow) and 140 nt (blue arrow) are only identified with a catalytically active 725 hhRz 16 is embedded in the scaffold (lane 7) but not from the pUC-VAL scaffold itself (lane 6) or with a 725 hhRz 16 that had a catalytic core inactivating mutation (G12C; lane 8). (B) In vitro analysis of short hRHO (511 nt) and full-length (1532 nt) hRHO mRNAs, transcribed in vitro but analyzed on nondenaturing PAGE gels relative to RNA size mobility markers. For the short hRHO (left panel) there are two prominent bands. For the full-length hRHO (right panel) there appear to be at least three well-populated conformational states. (C) In cellula assay to assess target hRHO mRNA knockdown in the pUC-VAI scaffold. HEK293S cells were transiently co-transfected with pNEB-VAI-hhRz-1 and pRHO-fix5UT. Total RNA was extracted from transfected cells 48 hours posttransfection and analyzed for relative hRHO mRNA levels using qRT-PCR. Mean percent control vector transfection hRHO mRNA levels are shown ± SEM (one-way ANOVA P = 3.54, P = 0.03). Asterisks denote significant (P

    Techniques Used: In Vitro, Polyacrylamide Gel Electrophoresis, Mutagenesis, Transfection, Quantitative RT-PCR, Plasmid Preparation

    Toward the development of RNA agents for use in preclinical trial of for adRP. HEK293S cells were transiently co-transfected with plasmids encoding PTGS agents and WT target or hardened hRHO targets containing either a single silent mutation at the RHO 725-hhRz cleavage site (RHO-725-HARD) or a double silent mutation at the RHO 725 and RHO 731-hhRz cleavage sites (RHO-725-731-HARD). Total RNA was extracted from transfected cells 48 hours posttransfection and analyzed for relative hRHO mRNA levels using qRT-PCR. Cytoplasmic protein was extracted from transfected cells 72 hours posttransfection and analyzed for relative RHO protein levels by western blotting. Mean percent control (scrambled shRNA or VAI control) vector transfection RHO mRNA or protein levels are shown ± SEM in bar graphs. Asterisks indicate significant (P
    Figure Legend Snippet: Toward the development of RNA agents for use in preclinical trial of for adRP. HEK293S cells were transiently co-transfected with plasmids encoding PTGS agents and WT target or hardened hRHO targets containing either a single silent mutation at the RHO 725-hhRz cleavage site (RHO-725-HARD) or a double silent mutation at the RHO 725 and RHO 731-hhRz cleavage sites (RHO-725-731-HARD). Total RNA was extracted from transfected cells 48 hours posttransfection and analyzed for relative hRHO mRNA levels using qRT-PCR. Cytoplasmic protein was extracted from transfected cells 72 hours posttransfection and analyzed for relative RHO protein levels by western blotting. Mean percent control (scrambled shRNA or VAI control) vector transfection RHO mRNA or protein levels are shown ± SEM in bar graphs. Asterisks indicate significant (P

    Techniques Used: Transfection, Mutagenesis, Quantitative RT-PCR, Western Blot, shRNA, Plasmid Preparation

    Impact of shRNAs and hhRzs targeting accessible regions of full-length hRHO mRNA target in HEK293S cells and HER224 cells. (A) HEK293S cells. shRNA agents were designed targeting RHO at the 310 region (RHOi2), the 725 region (RHOi-725), and the 266 region (RHOi-266). The pSUPER expression system was used, and HEK293S cells were transiently co-transfected with pSUPER plasmids along with pRHO-fix5UT. Total RNA was extracted from transfected cells 48 hours posttransfection and analyzed for relative hRHO mRNA levels using qRT-PCR. Mean percent of control vector (scrambled shRNA) transfection hRHO mRNA levels are shown ± SEM (one-way ANOVA F = 219.98, P = 9.44 E−11 ). Asterisks indicate significant (P
    Figure Legend Snippet: Impact of shRNAs and hhRzs targeting accessible regions of full-length hRHO mRNA target in HEK293S cells and HER224 cells. (A) HEK293S cells. shRNA agents were designed targeting RHO at the 310 region (RHOi2), the 725 region (RHOi-725), and the 266 region (RHOi-266). The pSUPER expression system was used, and HEK293S cells were transiently co-transfected with pSUPER plasmids along with pRHO-fix5UT. Total RNA was extracted from transfected cells 48 hours posttransfection and analyzed for relative hRHO mRNA levels using qRT-PCR. Mean percent of control vector (scrambled shRNA) transfection hRHO mRNA levels are shown ± SEM (one-way ANOVA F = 219.98, P = 9.44 E−11 ). Asterisks indicate significant (P

    Techniques Used: shRNA, Expressing, Transfection, Quantitative RT-PCR, Plasmid Preparation

    20) Product Images from "Dataset of gene cloning and gel filtration chromatography of R-est6"

    Article Title: Dataset of gene cloning and gel filtration chromatography of R-est6

    Journal: Data in Brief

    doi: 10.1016/j.dib.2016.04.034

    PCR of R-est6 gene, MCA0075 from Methylococcus capsulatus (bath strain, ATCC 33009). PCR product of 1008 base pairs is marked in white box with labeled 1 kb ladder in left lane.
    Figure Legend Snippet: PCR of R-est6 gene, MCA0075 from Methylococcus capsulatus (bath strain, ATCC 33009). PCR product of 1008 base pairs is marked in white box with labeled 1 kb ladder in left lane.

    Techniques Used: Polymerase Chain Reaction, Labeling

    21) Product Images from "Functional Dissection of the Chickpea (Cicer arietinum L.) Stay-Green Phenotype Associated with Molecular Variation at an Ortholog of Mendel’s I Gene for Cotyledon Color: Implications for Crop Production and Carotenoid Biofortification"

    Article Title: Functional Dissection of the Chickpea (Cicer arietinum L.) Stay-Green Phenotype Associated with Molecular Variation at an Ortholog of Mendel’s I Gene for Cotyledon Color: Implications for Crop Production and Carotenoid Biofortification

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms20225562

    Gene structure and genomic context of type chickpea stay-green gene CaStGR1. ( a ) Schematic of the gene structure of CaStGR1 are shown in ( a ), with the four exons denoted by gray boxes and the three introns as thin lines. Locations of the four small deletion alleles CaStGR1 through CaStGR4 are denoted by triangles above the exons. ( b ) Whole genome Illumina short read skim sequencing read pileups of three normal yellow cotyledon colored chickpea genotypes (ICCV 2, ICC 16,207 and ICCV 96029) are aligned to the chickpea reference of ‘CDC Frontier’, alongside those from genotype W6 25,975 that harbors the large deletion allele CaStGR1-5. Predicted genes Ca-02399 (CaStGR1) and two flanking low copy genes Ca-02398 (cytC) and Ca-02400 (5′ ORF) are marked by ovals. Location of oligonucleotides used in PCR amplification assays from the vicinity of CaStGR1 and falling within the large deletion are marked by gray arrows, and those from the deletion spanning amplification PCR are marked by blue arrows.
    Figure Legend Snippet: Gene structure and genomic context of type chickpea stay-green gene CaStGR1. ( a ) Schematic of the gene structure of CaStGR1 are shown in ( a ), with the four exons denoted by gray boxes and the three introns as thin lines. Locations of the four small deletion alleles CaStGR1 through CaStGR4 are denoted by triangles above the exons. ( b ) Whole genome Illumina short read skim sequencing read pileups of three normal yellow cotyledon colored chickpea genotypes (ICCV 2, ICC 16,207 and ICCV 96029) are aligned to the chickpea reference of ‘CDC Frontier’, alongside those from genotype W6 25,975 that harbors the large deletion allele CaStGR1-5. Predicted genes Ca-02399 (CaStGR1) and two flanking low copy genes Ca-02398 (cytC) and Ca-02400 (5′ ORF) are marked by ovals. Location of oligonucleotides used in PCR amplification assays from the vicinity of CaStGR1 and falling within the large deletion are marked by gray arrows, and those from the deletion spanning amplification PCR are marked by blue arrows.

    Techniques Used: Sequencing, Immunocytochemistry, Polymerase Chain Reaction, Amplification

    22) Product Images from "Biological characteristics and probiotic effect of Leuconostoc lactis strain isolated from the intestine of black porgy fish"

    Article Title: Biological characteristics and probiotic effect of Leuconostoc lactis strain isolated from the intestine of black porgy fish

    Journal: Brazilian Journal of Microbiology

    doi: 10.1590/S1517-83822013005000053

    Agarose gel electrophorsis of PCR product of 16S rDNA (M:DL 2,000 DNA Marker,1: 16S rDNA PCR product).
    Figure Legend Snippet: Agarose gel electrophorsis of PCR product of 16S rDNA (M:DL 2,000 DNA Marker,1: 16S rDNA PCR product).

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    23) Product Images from "Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression"

    Article Title: Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0132070

    Expression pattern of all 10 unigenes from the forward (A) and reverse (B) SSH library by real-time PCR. Shoots were treated with 20 μM COR and water. Cambia-containing tissues were collected half an hour (0.5 h), one hour (1 h), two hours (2 h), four hours (4 h), eight hours (8 h), one day (1 d), two days (2 d) and three days (3 d) after treatments. The relative expression was normalized to the housekeeping genes of HbACTIN and HbRH8 . The data were shown as averages ± SE. *, significant difference ( P
    Figure Legend Snippet: Expression pattern of all 10 unigenes from the forward (A) and reverse (B) SSH library by real-time PCR. Shoots were treated with 20 μM COR and water. Cambia-containing tissues were collected half an hour (0.5 h), one hour (1 h), two hours (2 h), four hours (4 h), eight hours (8 h), one day (1 d), two days (2 d) and three days (3 d) after treatments. The relative expression was normalized to the housekeeping genes of HbACTIN and HbRH8 . The data were shown as averages ± SE. *, significant difference ( P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    24) Product Images from "Phylogenetic and recombination analysis of Tobacco bushy top virus in China"

    Article Title: Phylogenetic and recombination analysis of Tobacco bushy top virus in China

    Journal: Virology Journal

    doi: 10.1186/s12985-015-0340-2

    DNA sequencing for 5’-RACE and 3’RACE PCR products of TBTV-JC. A. 5’ RACE of TBTV-JC, Up: 5’RACE by adding poly (G) at the 5’ end of cDNA; Down: 5’RACE by adding poly (C) at the 5’ end of cDNA. B. 3’RACE of TBTV-JC. Fold arrows indicating the first ( a ) and last ( b ) nucleotide of TBTV-JC genome, respectively
    Figure Legend Snippet: DNA sequencing for 5’-RACE and 3’RACE PCR products of TBTV-JC. A. 5’ RACE of TBTV-JC, Up: 5’RACE by adding poly (G) at the 5’ end of cDNA; Down: 5’RACE by adding poly (C) at the 5’ end of cDNA. B. 3’RACE of TBTV-JC. Fold arrows indicating the first ( a ) and last ( b ) nucleotide of TBTV-JC genome, respectively

    Techniques Used: DNA Sequencing, Polymerase Chain Reaction

    25) Product Images from "Antagonistic effects of exogenous Slit2 on VEGF-induced choroidal endothelial cell migration and tube formation"

    Article Title: Antagonistic effects of exogenous Slit2 on VEGF-induced choroidal endothelial cell migration and tube formation

    Journal: Experimental and Therapeutic Medicine

    doi: 10.3892/etm.2019.7235

    Detection of Slit2, Robo1 and Robo4 mRNA and protein expression in human CECs. (A) RT-PCR analysis yielded expected products at 176 bp and 226 bp for Slit2 and Robo4, respectively; no product for Robo1 was detected. ‘+’ indicates the addition of target-specific primers to the reaction and ‘-’ indicates the addition of no primers. (B-E) Immunocytochemistry analysis demonstrated positive staining for (B) Slit2, (C) Robo4 proteins and (D) Factor VIII-related antigen, but not (E) Robo1. (F) Negative control (immunocytochemistry performed without a primary antibody). Scale bar, 100 µm. Slit2, slit guidance ligand 2; Robo, roundabout guidance receptor; CECs, choroidal endothelial cells.
    Figure Legend Snippet: Detection of Slit2, Robo1 and Robo4 mRNA and protein expression in human CECs. (A) RT-PCR analysis yielded expected products at 176 bp and 226 bp for Slit2 and Robo4, respectively; no product for Robo1 was detected. ‘+’ indicates the addition of target-specific primers to the reaction and ‘-’ indicates the addition of no primers. (B-E) Immunocytochemistry analysis demonstrated positive staining for (B) Slit2, (C) Robo4 proteins and (D) Factor VIII-related antigen, but not (E) Robo1. (F) Negative control (immunocytochemistry performed without a primary antibody). Scale bar, 100 µm. Slit2, slit guidance ligand 2; Robo, roundabout guidance receptor; CECs, choroidal endothelial cells.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Immunocytochemistry, Staining, Negative Control

    26) Product Images from "The Impact of KLF2 Modulation on the Transcriptional Program and Function of CD8 T Cells"

    Article Title: The Impact of KLF2 Modulation on the Transcriptional Program and Function of CD8 T Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0077537

    The impact of failing to downregulate KLF2 on the transcriptional programme of TCR activated CD8 T cells. (A) Data show flow cytometric analysis of activated CD8 T cells transduced with either vector (evGFP) or a GFP-KLF2 fusion construct (data representative of 10 independent experiments). In all experiments using these constructs, CD8 T cells were transduced at 18 hours post-activation, washed out of peptide stimulation at 48 hours and then cultured with IL-2 for a further 48-72 hours prior to experimental procedures. (B) Data show KLF2 mRNA expression in purified naïve P14 CD8 T cells, P14 CD8 T cells treated with gp33-41 peptide for 4 hours, GFP positive activated CD8 T cells purified by FACS from activated CD8 T cells transduced with either evGFP or a GFP-KLF2 fusion protein. After reverse transcription, KLF2 mRNA was quantified by qRT-PCR against a standard curve of a KLF2 cDNA and is expressed as mRNA copy number. Data show mean + SEM of 3 independent experiments. (C) Heat map showing gene expression patterns of genes encoding trafficking molecules in GFP pos and GFP-KLF2 pos activated CD8 T cells, (D) CD8 T cell effector molecules, (E) cytokine receptors and (F) transcription factors. Heat maps are normalised to depict a 2-fold regulation as significant. Fold changes where shown are statistically significant (p
    Figure Legend Snippet: The impact of failing to downregulate KLF2 on the transcriptional programme of TCR activated CD8 T cells. (A) Data show flow cytometric analysis of activated CD8 T cells transduced with either vector (evGFP) or a GFP-KLF2 fusion construct (data representative of 10 independent experiments). In all experiments using these constructs, CD8 T cells were transduced at 18 hours post-activation, washed out of peptide stimulation at 48 hours and then cultured with IL-2 for a further 48-72 hours prior to experimental procedures. (B) Data show KLF2 mRNA expression in purified naïve P14 CD8 T cells, P14 CD8 T cells treated with gp33-41 peptide for 4 hours, GFP positive activated CD8 T cells purified by FACS from activated CD8 T cells transduced with either evGFP or a GFP-KLF2 fusion protein. After reverse transcription, KLF2 mRNA was quantified by qRT-PCR against a standard curve of a KLF2 cDNA and is expressed as mRNA copy number. Data show mean + SEM of 3 independent experiments. (C) Heat map showing gene expression patterns of genes encoding trafficking molecules in GFP pos and GFP-KLF2 pos activated CD8 T cells, (D) CD8 T cell effector molecules, (E) cytokine receptors and (F) transcription factors. Heat maps are normalised to depict a 2-fold regulation as significant. Fold changes where shown are statistically significant (p

    Techniques Used: Flow Cytometry, Transduction, Plasmid Preparation, Construct, Activation Assay, Cell Culture, Expressing, Purification, FACS, Quantitative RT-PCR

    KLF2 re-expression inhibits proliferation but not via c-myc repression. (A) Data show the cellular DNA content of GFP-KLF2 neg and GFP-KLF2 pos activated CD8 T cells. Data are representative of 4 independent experiments. (B) Expression of c-myc mRNA in FACS purified activated CD8 T cells quantified by qRT-PCR (data normalised to GFP neg and show mean + SEM of 3 independent experiments). (C) DNA synthesis measured by EdU uptake in the T cell populations shown (data show mean percentage EdU uptake + SEM, n=3). (D) Cell counts of GFP pos and KLF2 pos activated CD8 T cells; data shown are mean ± SEM of 3 independent experiments.
    Figure Legend Snippet: KLF2 re-expression inhibits proliferation but not via c-myc repression. (A) Data show the cellular DNA content of GFP-KLF2 neg and GFP-KLF2 pos activated CD8 T cells. Data are representative of 4 independent experiments. (B) Expression of c-myc mRNA in FACS purified activated CD8 T cells quantified by qRT-PCR (data normalised to GFP neg and show mean + SEM of 3 independent experiments). (C) DNA synthesis measured by EdU uptake in the T cell populations shown (data show mean percentage EdU uptake + SEM, n=3). (D) Cell counts of GFP pos and KLF2 pos activated CD8 T cells; data shown are mean ± SEM of 3 independent experiments.

    Techniques Used: Expressing, FACS, Purification, Quantitative RT-PCR, DNA Synthesis

    KLF2 represses CXCR3 expression and function. (A) Data show CXCR3 mRNA expression quantified by qRT-PCR in the indicated activated CD8 T cell populations normalised to GFP neg . (B) Data show flow cytometric analysis of CXCR3 surface expression and GFP expression in GFP pos or GFP-KLF2 pos activated CD8 T cells. (C) GFP-KLF2 neg and GFP-KLF2 pos activated CD8 T cells were competitively assayed for their ability to migrate to CXCL10. Data shown are the percentage of cells migrating (relative to input controls) at the given CXCL10 concentrations. (D) MFI of CXCR3 quantified by flow cytometry in naïve OT-1 CD8 T cells activated with N4, Q4, Q4R7 or Q4H7 for 24 hours. (E) CXCR3 expression measured by flow cytometry in naïve OT-1 CD8 T cells incubated with N4 peptide and PD184352 for 24 hours as indicated. Data in A, C D show mean + SEM of 3 independent experiments. Data in B and E representative of 3 independent experiments.
    Figure Legend Snippet: KLF2 represses CXCR3 expression and function. (A) Data show CXCR3 mRNA expression quantified by qRT-PCR in the indicated activated CD8 T cell populations normalised to GFP neg . (B) Data show flow cytometric analysis of CXCR3 surface expression and GFP expression in GFP pos or GFP-KLF2 pos activated CD8 T cells. (C) GFP-KLF2 neg and GFP-KLF2 pos activated CD8 T cells were competitively assayed for their ability to migrate to CXCL10. Data shown are the percentage of cells migrating (relative to input controls) at the given CXCL10 concentrations. (D) MFI of CXCR3 quantified by flow cytometry in naïve OT-1 CD8 T cells activated with N4, Q4, Q4R7 or Q4H7 for 24 hours. (E) CXCR3 expression measured by flow cytometry in naïve OT-1 CD8 T cells incubated with N4 peptide and PD184352 for 24 hours as indicated. Data in A, C D show mean + SEM of 3 independent experiments. Data in B and E representative of 3 independent experiments.

    Techniques Used: Expressing, Quantitative RT-PCR, Flow Cytometry, Cytometry, Incubation

    27) Product Images from "AGPAT6 Is a Novel Microsomal Glycerol-3-phosphate Acyltransferase *"

    Article Title: AGPAT6 Is a Novel Microsomal Glycerol-3-phosphate Acyltransferase *

    Journal:

    doi: 10.1074/jbc.M708151200

    Tissue distribution of human GPAT4. Quantitative PCR analysis was performed as described under “Experimental Procedures” using human normal tissue cDNA panel obtained from BioChain ( A ) or PrimGen ( B ). Data were expressed as mean ±
    Figure Legend Snippet: Tissue distribution of human GPAT4. Quantitative PCR analysis was performed as described under “Experimental Procedures” using human normal tissue cDNA panel obtained from BioChain ( A ) or PrimGen ( B ). Data were expressed as mean ±

    Techniques Used: Real-time Polymerase Chain Reaction

    28) Product Images from "Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR)"

    Article Title: Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR)

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms14036436

    Tth MutS suppressed DNA polymerase-generated mutations during PCR. ( A ) A 423-bp fragment of ttha1806 was amplified in the presence of 200 μM MnCl 2 with or without 1.1 μM Tth MutS, cloned into the pT7Blue vector and sequenced using the T7 promoter primer. The numbers of mutations in the fragment are shown; the values represent the mean ± standard deviation for five independent experiments; ( B ) A 423-bp fragment of ttha1806 was amplified in the presence of 200 μM MnCl 2 and 400 μM adenylyl imidodiphosphate (AMPPNP) with or without 1.1 μM Tth MutS, cloned into the pT7Blue vector and sequenced using the T7 promoter primer; ( C ) ttha1548 was amplified in the absence of MnCl 2 , cloned into the pT7Blue vector and sequenced using the T7 promoter and U-19-mer primers. Mutations in the 5′- and 3′-terminal 500 bp-regions of ttha1548 were counted.
    Figure Legend Snippet: Tth MutS suppressed DNA polymerase-generated mutations during PCR. ( A ) A 423-bp fragment of ttha1806 was amplified in the presence of 200 μM MnCl 2 with or without 1.1 μM Tth MutS, cloned into the pT7Blue vector and sequenced using the T7 promoter primer. The numbers of mutations in the fragment are shown; the values represent the mean ± standard deviation for five independent experiments; ( B ) A 423-bp fragment of ttha1806 was amplified in the presence of 200 μM MnCl 2 and 400 μM adenylyl imidodiphosphate (AMPPNP) with or without 1.1 μM Tth MutS, cloned into the pT7Blue vector and sequenced using the T7 promoter primer; ( C ) ttha1548 was amplified in the absence of MnCl 2 , cloned into the pT7Blue vector and sequenced using the T7 promoter and U-19-mer primers. Mutations in the 5′- and 3′-terminal 500 bp-regions of ttha1548 were counted.

    Techniques Used: Generated, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Standard Deviation

    Effects of Tth MutS on standard polymerase chain reaction (PCR) amplification of an 80-bp template. ( A ) Schema tic representation of the primers and templates used in ( B , C ). Perfectly matched, GT-mismatched or unpaired T-containing primers were used; ( B ) Perfectly matched (left), GT-mismatched (middle) or unpaired T-containing (right) primers were used to amplify the perfectly matched template; ( C ) The relative amounts of the products from perfectly matched (blue), GT-mismatched (red) or unpaired T-containing (purple) primers were plotted against the Tth MutS concentration for reactions using three polymerases: LA Taq (left), KOD polymerase (middle) and A. aeolicus DnaE (right). The amounts of the products were normalized by those at 0 μM Tth MutS.
    Figure Legend Snippet: Effects of Tth MutS on standard polymerase chain reaction (PCR) amplification of an 80-bp template. ( A ) Schema tic representation of the primers and templates used in ( B , C ). Perfectly matched, GT-mismatched or unpaired T-containing primers were used; ( B ) Perfectly matched (left), GT-mismatched (middle) or unpaired T-containing (right) primers were used to amplify the perfectly matched template; ( C ) The relative amounts of the products from perfectly matched (blue), GT-mismatched (red) or unpaired T-containing (purple) primers were plotted against the Tth MutS concentration for reactions using three polymerases: LA Taq (left), KOD polymerase (middle) and A. aeolicus DnaE (right). The amounts of the products were normalized by those at 0 μM Tth MutS.

    Techniques Used: Polymerase Chain Reaction, Amplification, Concentration Assay

    Model for Tth MutS suppression of mismatched primer-dependent amplification. ( A ) Schematic representation of the model. Mishybridization of primers at the annealing step generates mismatched bases that are tightly bound by MutS, which block the approach of DNA polymerases to the 3′ end of the primers; ( B ) The 80-bp perfectly matched template was amplified by AmpliTaq Gold DNA polymerase by real-time PCR using mismatched primers. The threshold cycle ( C t ) was determined and plotted against the distance between the mismatched bases and 3′ end of the primer (8, 11, 14, 17, 20 or 23 bp). PM, perfectly matched primer. Blue and gray bars indicate experiments with or without 1.0 μM Tth MutS, respectively. Experiments were repeated three times. Bars indicate standard deviations.
    Figure Legend Snippet: Model for Tth MutS suppression of mismatched primer-dependent amplification. ( A ) Schematic representation of the model. Mishybridization of primers at the annealing step generates mismatched bases that are tightly bound by MutS, which block the approach of DNA polymerases to the 3′ end of the primers; ( B ) The 80-bp perfectly matched template was amplified by AmpliTaq Gold DNA polymerase by real-time PCR using mismatched primers. The threshold cycle ( C t ) was determined and plotted against the distance between the mismatched bases and 3′ end of the primer (8, 11, 14, 17, 20 or 23 bp). PM, perfectly matched primer. Blue and gray bars indicate experiments with or without 1.0 μM Tth MutS, respectively. Experiments were repeated three times. Bars indicate standard deviations.

    Techniques Used: Amplification, Blocking Assay, Real-time Polymerase Chain Reaction

    PCR cycle-dependence of the amplification of a 423-bp region of ttha1806 . ( A ) The amplification was performed in the presence or absence in 1.1 μM Tth MutS and it was terminated at the end of 20, 25, 30, 35 or 40 PCR cycles. The 500-bp DNA ladder is indicated by the lane marked “M”; ( B ) The relative amounts of nonspecific and desired amplification products from (A) are shown in red and blue, respectively. The experiments were performed three times. Bars indicate standard deviations. The amounts of the products were normalized by the amount of total products at the end of twentieth cycle in the absence of Tth MutS; ( C ) Specificity factor for 1.1 μM Tth MutS at each PCR cycle.
    Figure Legend Snippet: PCR cycle-dependence of the amplification of a 423-bp region of ttha1806 . ( A ) The amplification was performed in the presence or absence in 1.1 μM Tth MutS and it was terminated at the end of 20, 25, 30, 35 or 40 PCR cycles. The 500-bp DNA ladder is indicated by the lane marked “M”; ( B ) The relative amounts of nonspecific and desired amplification products from (A) are shown in red and blue, respectively. The experiments were performed three times. Bars indicate standard deviations. The amounts of the products were normalized by the amount of total products at the end of twentieth cycle in the absence of Tth MutS; ( C ) Specificity factor for 1.1 μM Tth MutS at each PCR cycle.

    Techniques Used: Polymerase Chain Reaction, Amplification

    Effect of the number of mismatches in an 80-bp template on amplification efficiency in the presence of Tth MutS. ( A ) Templates containing zero, one, two or three unpaired T mismatches were used. PCR was performed using LA Taq Hot-Start version with perfectly matched primers in the absence or presence of 0.35 μM Tth MutS; ( B ) Quantification of the relative amounts of amplified fragments. Gray and blue columns indicate amplification in the absence or presence of Tth MutS, respectively. The amounts of the products were normalized by that from perfectly-matched template at 0 μM Tth MutS; ( C ) Model for the mechanism by which Tth MutS suppresses amplification from mismatched templates.
    Figure Legend Snippet: Effect of the number of mismatches in an 80-bp template on amplification efficiency in the presence of Tth MutS. ( A ) Templates containing zero, one, two or three unpaired T mismatches were used. PCR was performed using LA Taq Hot-Start version with perfectly matched primers in the absence or presence of 0.35 μM Tth MutS; ( B ) Quantification of the relative amounts of amplified fragments. Gray and blue columns indicate amplification in the absence or presence of Tth MutS, respectively. The amounts of the products were normalized by that from perfectly-matched template at 0 μM Tth MutS; ( C ) Model for the mechanism by which Tth MutS suppresses amplification from mismatched templates.

    Techniques Used: Amplification, Polymerase Chain Reaction

    Effects of Tth MutS on amplification of an 80-bp template by using real-time PCR. ( A ) An 80-bp perfectly matched dsDNA was amplified by AmpliTaq Gold DNA polymerase by using perfectly matched (left), GT-mismatched (middle) or unpaired T-containing (right) primers in the presence of 0, 0.2, 0.4, 0.6, 0.8 or 1.0 μM Tth MutS. The change in fluorescence (ΔRn) was plotted against the cycle number; ( B ) The threshold cycle ( C t ) was determined and plotted against the Tth MutS concentration. Blue, red and purple circles indicate amplification by using perfectly matched, GT-mismatched and unpaired T-containing primers, respectively. All experiments were repeated three times. Bars indicate standard deviations.
    Figure Legend Snippet: Effects of Tth MutS on amplification of an 80-bp template by using real-time PCR. ( A ) An 80-bp perfectly matched dsDNA was amplified by AmpliTaq Gold DNA polymerase by using perfectly matched (left), GT-mismatched (middle) or unpaired T-containing (right) primers in the presence of 0, 0.2, 0.4, 0.6, 0.8 or 1.0 μM Tth MutS. The change in fluorescence (ΔRn) was plotted against the cycle number; ( B ) The threshold cycle ( C t ) was determined and plotted against the Tth MutS concentration. Blue, red and purple circles indicate amplification by using perfectly matched, GT-mismatched and unpaired T-containing primers, respectively. All experiments were repeated three times. Bars indicate standard deviations.

    Techniques Used: Amplification, Real-time Polymerase Chain Reaction, Fluorescence, Concentration Assay

    Effects of Aae MutS on amplification of an 80-bp template. ( A ) Results of amplification of an 80-bp template in the presence of 0.2 μM Aae MutS. PM, GT and ΔT indicate perfectly matched, GT-mismatched and unpaired T-containing primers or templates, respectively; ( B ) Quantification of the relative amounts of PCR products from ( A ); ( C ) The same experiment as in Figure 6A was performed using Aae MutS. The amounts of the products were normalized by that from perfectly-matched template and primers at 0 μM Aae MutS; ( D ) Quantification of the relative amounts of nonspecific (red) and desired (blue) amplification products in ( C ). The amounts of the products were normalized by the amount of total products at 0 μM Aae MutS; ( E ) The ttha1806 gene was amplified in the presence of 0.3 μM Tth MutS or Aae MutS. At the end of the fifteenth cycle, 0 or 0.3 μM Tth MutS or Aae MutS was added to each reaction tube. Control amplification in the absence of Tth MutS or Aae MutS is indicated as “C”; ( F ) Quantification of the amplification products from ( E ). The amounts of the products were normalized by the amount of total products at 0 μM Aae MutS.
    Figure Legend Snippet: Effects of Aae MutS on amplification of an 80-bp template. ( A ) Results of amplification of an 80-bp template in the presence of 0.2 μM Aae MutS. PM, GT and ΔT indicate perfectly matched, GT-mismatched and unpaired T-containing primers or templates, respectively; ( B ) Quantification of the relative amounts of PCR products from ( A ); ( C ) The same experiment as in Figure 6A was performed using Aae MutS. The amounts of the products were normalized by that from perfectly-matched template and primers at 0 μM Aae MutS; ( D ) Quantification of the relative amounts of nonspecific (red) and desired (blue) amplification products in ( C ). The amounts of the products were normalized by the amount of total products at 0 μM Aae MutS; ( E ) The ttha1806 gene was amplified in the presence of 0.3 μM Tth MutS or Aae MutS. At the end of the fifteenth cycle, 0 or 0.3 μM Tth MutS or Aae MutS was added to each reaction tube. Control amplification in the absence of Tth MutS or Aae MutS is indicated as “C”; ( F ) Quantification of the amplification products from ( E ). The amounts of the products were normalized by the amount of total products at 0 μM Aae MutS.

    Techniques Used: Amplification, Polymerase Chain Reaction

    Effects of Tth MutS on standard PCR amplification of mismatched templates. ( A ) Schematic representations of the primers and templates used in ( B , C ); ( B ) A perfectly matched primer was used to amplify perfectly matched (left), GT-mismatched (middle) or unpaired T-containing (right) templates; ( C ) Relative amounts of amplified fragments from reactions using perfectly matched (blue), GT-mismatched (red) or unpaired T-containing (purple) templates were plotted against the Tth MutS concentration. The amounts of the products were normalized by those at 0 μM Tth MutS; ( D ) The effect of Tth MutS on amplification of the 80-bp mismatched template was examined by real-time PCR. The perfectly matched (blue), GT-mismatched (red) and unpaired T-containing (purple) templates were amplified by AmpliTaq Gold DNA polymerase by using perfectly matched primers. The threshold cycle ( C t ) was determined and plotted against the Tth MutS concentration. Experiments were repeated three times. Bars indicate standard deviations.
    Figure Legend Snippet: Effects of Tth MutS on standard PCR amplification of mismatched templates. ( A ) Schematic representations of the primers and templates used in ( B , C ); ( B ) A perfectly matched primer was used to amplify perfectly matched (left), GT-mismatched (middle) or unpaired T-containing (right) templates; ( C ) Relative amounts of amplified fragments from reactions using perfectly matched (blue), GT-mismatched (red) or unpaired T-containing (purple) templates were plotted against the Tth MutS concentration. The amounts of the products were normalized by those at 0 μM Tth MutS; ( D ) The effect of Tth MutS on amplification of the 80-bp mismatched template was examined by real-time PCR. The perfectly matched (blue), GT-mismatched (red) and unpaired T-containing (purple) templates were amplified by AmpliTaq Gold DNA polymerase by using perfectly matched primers. The threshold cycle ( C t ) was determined and plotted against the Tth MutS concentration. Experiments were repeated three times. Bars indicate standard deviations.

    Techniques Used: Polymerase Chain Reaction, Amplification, Concentration Assay, Real-time Polymerase Chain Reaction

    29) Product Images from "A neonatal murine model for evaluation of enterovirus E HY12 virus infection and pathogenicity"

    Article Title: A neonatal murine model for evaluation of enterovirus E HY12 virus infection and pathogenicity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0193155

    Minimal infective dose of HY12 to ICR suckling mice. 2 × 10 4 , 2 × 10 6 and 2 × 10 8 TCID 50 HY12 viruses were injected to mice subcutaneously to determine the minimal infective dose (MID). Tissue samples were collected 5 dpi and processed for RT-PCR to detect the virus genome fragment. Representative figure showing the PCR-amplified fragments with expected size from mice infected with 2 × 10 6 TCID 50 (lane 2) and 2 × 10 8 TCID 50 (lane 3), respectively. The negative and positive controls were presented in lane 4 and lane 5, respectively. M stands for the DNA ladder.
    Figure Legend Snippet: Minimal infective dose of HY12 to ICR suckling mice. 2 × 10 4 , 2 × 10 6 and 2 × 10 8 TCID 50 HY12 viruses were injected to mice subcutaneously to determine the minimal infective dose (MID). Tissue samples were collected 5 dpi and processed for RT-PCR to detect the virus genome fragment. Representative figure showing the PCR-amplified fragments with expected size from mice infected with 2 × 10 6 TCID 50 (lane 2) and 2 × 10 8 TCID 50 (lane 3), respectively. The negative and positive controls were presented in lane 4 and lane 5, respectively. M stands for the DNA ladder.

    Techniques Used: Mouse Assay, Injection, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Infection

    ICR suckling mice are susceptible to HY12 enterovirus infection. Three-day old Balb/c, Kunming, and IRC neonatal mice were subcutaneously inoculated with 2×10 6 TCID 50 HY12 viruses. Tissue samples including liver, lung, spleen, lymph node, kidney, and brain were collected from pups at 5 dpi and processed for amplification of HY12 genomic fragments using RT-PCR. Fragment with expected size was detected clearly from tissue samples in ICR (lane 2) suckling mice. No fragments were amplified from Balb/C suckling mice (lane 1) and Kunming suckling mice (lane 3) infected with HY12. Lane 4 and lane 5 were the positive and negative control, respectively. DNA ladder was presented as M and the size of expected fragment is indicated as arrow.
    Figure Legend Snippet: ICR suckling mice are susceptible to HY12 enterovirus infection. Three-day old Balb/c, Kunming, and IRC neonatal mice were subcutaneously inoculated with 2×10 6 TCID 50 HY12 viruses. Tissue samples including liver, lung, spleen, lymph node, kidney, and brain were collected from pups at 5 dpi and processed for amplification of HY12 genomic fragments using RT-PCR. Fragment with expected size was detected clearly from tissue samples in ICR (lane 2) suckling mice. No fragments were amplified from Balb/C suckling mice (lane 1) and Kunming suckling mice (lane 3) infected with HY12. Lane 4 and lane 5 were the positive and negative control, respectively. DNA ladder was presented as M and the size of expected fragment is indicated as arrow.

    Techniques Used: Mouse Assay, Infection, Amplification, Reverse Transcription Polymerase Chain Reaction, Negative Control

    30) Product Images from "Co-expression of S100A14 and S100A16 correlates with a poor prognosis in human breast cancer and promotes cancer cell invasion"

    Article Title: Co-expression of S100A14 and S100A16 correlates with a poor prognosis in human breast cancer and promotes cancer cell invasion

    Journal: BMC Cancer

    doi: 10.1186/s12885-015-1059-6

    Expression and localization of S100A14 and S100A16 in human breast cancer cell lines. A , Relative mRNA expression levels measured by real-time RT-PCR. Expression levels were normalized to β-actin levels within the same sample. B , Protein expression of S100A14 and S100A16. Expression levels and subcellular localization were visualized using immunofluorescence staining. Scale bar; 50 μm. C , Subcellular localization of the S100A14 protein on the cell membrane. Z-axis images of confluent MCF7 cells were constructed using confocal laser scanning microscopy. Scale bar; 10 μm. D , Effect of omission of cell permeabilization on the immunofluorescent staining of S100A14. Following fixation with 4% paraformaldehyde, the cells were treated with or without 0.1% Triton X-100 in PBS prior to staining. Scale bar; 50 μm. E , Ca 2 -independent localization of S100A14 on the cell membrane. MCF7 cells transfected with the S100A14-GFP expression vector were observed by fluorescence microscopy over 180 min after addition of 10 mM EGTA in PBS. Scale bar; 50 μm.
    Figure Legend Snippet: Expression and localization of S100A14 and S100A16 in human breast cancer cell lines. A , Relative mRNA expression levels measured by real-time RT-PCR. Expression levels were normalized to β-actin levels within the same sample. B , Protein expression of S100A14 and S100A16. Expression levels and subcellular localization were visualized using immunofluorescence staining. Scale bar; 50 μm. C , Subcellular localization of the S100A14 protein on the cell membrane. Z-axis images of confluent MCF7 cells were constructed using confocal laser scanning microscopy. Scale bar; 10 μm. D , Effect of omission of cell permeabilization on the immunofluorescent staining of S100A14. Following fixation with 4% paraformaldehyde, the cells were treated with or without 0.1% Triton X-100 in PBS prior to staining. Scale bar; 50 μm. E , Ca 2 -independent localization of S100A14 on the cell membrane. MCF7 cells transfected with the S100A14-GFP expression vector were observed by fluorescence microscopy over 180 min after addition of 10 mM EGTA in PBS. Scale bar; 50 μm.

    Techniques Used: Expressing, Quantitative RT-PCR, Immunofluorescence, Staining, Construct, Confocal Laser Scanning Microscopy, Transfection, Plasmid Preparation, Fluorescence, Microscopy

    31) Product Images from "Study of the activation of the PI3K/Akt pathway by the motif of σA and σNS proteins of avian reovirus"

    Article Title: Study of the activation of the PI3K/Akt pathway by the motif of σA and σNS proteins of avian reovirus

    Journal: Innate Immunity

    doi: 10.1177/1753425919890648

    Identification of the recombinant plasmids by PCR. Lane M: 100-bp DNA ladder; Lane 1: σA-M1-pcAGEN; Lane 2: σA-M2-pcAGEN; Lane 3: σA-M3-pcAGEN; Lane 4: σA-M4-pcAGEN; Lane 5: σA-M5-pcAGEN; Lane 6: σA-M6-pcAGEN; Lane 7: σNS-M1-pcAGEN; Lane 8: σNS-M2-pcAGEN; Lane 9: σNS-M3-pcAGEN.
    Figure Legend Snippet: Identification of the recombinant plasmids by PCR. Lane M: 100-bp DNA ladder; Lane 1: σA-M1-pcAGEN; Lane 2: σA-M2-pcAGEN; Lane 3: σA-M3-pcAGEN; Lane 4: σA-M4-pcAGEN; Lane 5: σA-M5-pcAGEN; Lane 6: σA-M6-pcAGEN; Lane 7: σNS-M1-pcAGEN; Lane 8: σNS-M2-pcAGEN; Lane 9: σNS-M3-pcAGEN.

    Techniques Used: Recombinant, Polymerase Chain Reaction

    32) Product Images from "Cell Density-dependent Anammox Activity of Candidatus Brocadia sinica Regulated by N-acyl Homoserine Lactone-mediated Quorum Sensing"

    Article Title: Cell Density-dependent Anammox Activity of Candidatus Brocadia sinica Regulated by N-acyl Homoserine Lactone-mediated Quorum Sensing

    Journal: Microbes and Environments

    doi: 10.1264/jsme2.ME20086

    Transcription analysis of candidate genes involved in N -acyl homoserine lactone (AHL) biosynthesis and reception. Total RNA samples were extracted from dispersed granular and planktonic biomasses (cell density; 10 9 ‍ ‍cells‍ ‍mL –1 ) of Brocadia sinica (designated as RNA-G and RNA-P, respectively), and subjected to cDNA synthesis (cDNA-G and cDNA-P, respectively) and subsequent RT-PCR experiments. As positive and negative controls of PCR amplification, PCR was performed using the genomic DNA of B. sinica and distilled water as a template (PC and NC, respectively). Locus tags of the target genes registered in the B. sinica genome are shown at the top of electrophoresis images. Amplicons of expected molecular sizes were detected on all gels.
    Figure Legend Snippet: Transcription analysis of candidate genes involved in N -acyl homoserine lactone (AHL) biosynthesis and reception. Total RNA samples were extracted from dispersed granular and planktonic biomasses (cell density; 10 9 ‍ ‍cells‍ ‍mL –1 ) of Brocadia sinica (designated as RNA-G and RNA-P, respectively), and subjected to cDNA synthesis (cDNA-G and cDNA-P, respectively) and subsequent RT-PCR experiments. As positive and negative controls of PCR amplification, PCR was performed using the genomic DNA of B. sinica and distilled water as a template (PC and NC, respectively). Locus tags of the target genes registered in the B. sinica genome are shown at the top of electrophoresis images. Amplicons of expected molecular sizes were detected on all gels.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Electrophoresis

    33) Product Images from "A novel compensating wheat–Thinopyrum elongatum Robertsonian translocation line with a positive effect on flour quality"

    Article Title: A novel compensating wheat–Thinopyrum elongatum Robertsonian translocation line with a positive effect on flour quality

    Journal: Breeding Science

    doi: 10.1270/jsbbs.17058

    Representative examples of the PCR analyses used to assign the wheat homoeologous group-1 PLUG markers to the Th. elongatum chromosome 1E. The plants tested were: CS, Chinese Spring; N61, Norin 61; CSDAL1E, a homoeologous group-1 disomic addition line of Th. elongatum in CS background; and TAS1.1EL, the TAS1.1EL disomic plant in the CS and N61 background. The open and closed arrowheads indicate the presence or absence of the PCR product on chromosome 1E, respectively.
    Figure Legend Snippet: Representative examples of the PCR analyses used to assign the wheat homoeologous group-1 PLUG markers to the Th. elongatum chromosome 1E. The plants tested were: CS, Chinese Spring; N61, Norin 61; CSDAL1E, a homoeologous group-1 disomic addition line of Th. elongatum in CS background; and TAS1.1EL, the TAS1.1EL disomic plant in the CS and N61 background. The open and closed arrowheads indicate the presence or absence of the PCR product on chromosome 1E, respectively.

    Techniques Used: Polymerase Chain Reaction

    34) Product Images from "Identity of the elusive IgM Fc receptor (Fc?R) in humans"

    Article Title: Identity of the elusive IgM Fc receptor (Fc?R) in humans

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20091107

    Isolation of IgM-binding subclones and identification of cDNA inserts. (A) Cells transduced by the retroviral expression construct containing CLL-derived (top) or PMA-activated 697 pre–B cell–derived (bottom) cDNA libraries were enriched for IgM binding by FACS and subcloned for limiting dilution. Three representative subclones from each library are shown for their IgM-binding activity or lack of binding, as determined by flow cytometry. (B) Agarose gel electrophoresis analysis of RT-PCR products. RNA isolated from nontransduced control BW5147 T cells (lane 1) and from IgM-binding (lanes 3–5 and 7–9) or IgM-nonbinding (lanes 2 and 6) subclones from CLL-derived (lanes 2–5) and PMA-activated 697 pre–B cell–derived (lanes 6–9) cDNA libraries were subjected to RT-PCR as described in Materials and methods. Amplified products were electrophoresed in 0.7% agarose and stained with ethidium bromide. Lane 10 is a PCR control without a first-strand cDNA template. Hin dIII-digested λ DNA was used as a size marker. The experiments were performed once for A and twice for B.
    Figure Legend Snippet: Isolation of IgM-binding subclones and identification of cDNA inserts. (A) Cells transduced by the retroviral expression construct containing CLL-derived (top) or PMA-activated 697 pre–B cell–derived (bottom) cDNA libraries were enriched for IgM binding by FACS and subcloned for limiting dilution. Three representative subclones from each library are shown for their IgM-binding activity or lack of binding, as determined by flow cytometry. (B) Agarose gel electrophoresis analysis of RT-PCR products. RNA isolated from nontransduced control BW5147 T cells (lane 1) and from IgM-binding (lanes 3–5 and 7–9) or IgM-nonbinding (lanes 2 and 6) subclones from CLL-derived (lanes 2–5) and PMA-activated 697 pre–B cell–derived (lanes 6–9) cDNA libraries were subjected to RT-PCR as described in Materials and methods. Amplified products were electrophoresed in 0.7% agarose and stained with ethidium bromide. Lane 10 is a PCR control without a first-strand cDNA template. Hin dIII-digested λ DNA was used as a size marker. The experiments were performed once for A and twice for B.

    Techniques Used: Isolation, Binding Assay, Expressing, Construct, Derivative Assay, FACS, Activity Assay, Flow Cytometry, Cytometry, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Amplification, Staining, Polymerase Chain Reaction, Marker

    35) Product Images from "Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops"

    Article Title: Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2018.00367

    Mutations of the two AP2 orthologs in the scm of B. rapa. (A) Schematic of the two AP2 gene mutations in scm . The BrAP2a cDNA from scm ( SCM-a ) had a 119-bp sequence repeat mutation, which was derived from the transcription of a 291-bp repeat in genomic DNA that consisted of nucleotides 648–938 repeated after nucleotide 938. BrAP2b cDNA of scm ( SCM-b ) had an A to C single nucleotide mutation that transformed the 18th glutamic acid into aspartic acid (E18D). (B) A schematic of the location of the designed primers. The relative locations of the AP2 primers in the scm and wild-type B. rapa (WTr) sequences are shown (upper part). PCR amplification of genome DNA and cDNA of WTr and the scm using primer pairs of AP2-F/R, AP2-F/R2, and AP2-F2/R (lower part).
    Figure Legend Snippet: Mutations of the two AP2 orthologs in the scm of B. rapa. (A) Schematic of the two AP2 gene mutations in scm . The BrAP2a cDNA from scm ( SCM-a ) had a 119-bp sequence repeat mutation, which was derived from the transcription of a 291-bp repeat in genomic DNA that consisted of nucleotides 648–938 repeated after nucleotide 938. BrAP2b cDNA of scm ( SCM-b ) had an A to C single nucleotide mutation that transformed the 18th glutamic acid into aspartic acid (E18D). (B) A schematic of the location of the designed primers. The relative locations of the AP2 primers in the scm and wild-type B. rapa (WTr) sequences are shown (upper part). PCR amplification of genome DNA and cDNA of WTr and the scm using primer pairs of AP2-F/R, AP2-F/R2, and AP2-F2/R (lower part).

    Techniques Used: Sequencing, Mutagenesis, Derivative Assay, Transformation Assay, Polymerase Chain Reaction, Amplification

    Wild type and an ap2 weak mutant of Arabidopsis transformed with AP2 genes from B. rapa. (A) Wild-type Arabidopsis (Col-0) transformed with AtAP2 (control) and two AP2 genes of B. rapa . Their over-expressed lines p35S:AtAP2/Col , p35S::BrAP2a/Col , and p35S::BrAP2b/Col had normal flowers similar to the wild-type flower. (B) The AP2 mutant of Arabidopsis ( ap2-5 ), which has a mild sepal-to-carpel and petal-to-stamen phenotype, transformed with AtAP2 gene and two B. rapa AP2 genes. All three transgenic plants, p35S:AtAP2/ap2-5 , p35S::BrAP2a/ap2-5 , and p35S::BrAP2a/ap2-5 , rescued the ap2-5 mutant defect and developed normal sepals and petals. (C) The knockdown lines, p35S::AtAP2/ap2-5 KD, p35S::BrAP2a/ap2-5 KD, and p35S::BrAP2b/ap2-5 KD, from three transgenic group of p35S:AtAP2/ap2-5 , p35S::BrAP2a/ap2-5 , and p35S::BrAP2a/ap2-5 . (D) semi-quantitative RT-PCR and Western blot assays to validate the transgenic lines. Bars, 500 μm.
    Figure Legend Snippet: Wild type and an ap2 weak mutant of Arabidopsis transformed with AP2 genes from B. rapa. (A) Wild-type Arabidopsis (Col-0) transformed with AtAP2 (control) and two AP2 genes of B. rapa . Their over-expressed lines p35S:AtAP2/Col , p35S::BrAP2a/Col , and p35S::BrAP2b/Col had normal flowers similar to the wild-type flower. (B) The AP2 mutant of Arabidopsis ( ap2-5 ), which has a mild sepal-to-carpel and petal-to-stamen phenotype, transformed with AtAP2 gene and two B. rapa AP2 genes. All three transgenic plants, p35S:AtAP2/ap2-5 , p35S::BrAP2a/ap2-5 , and p35S::BrAP2a/ap2-5 , rescued the ap2-5 mutant defect and developed normal sepals and petals. (C) The knockdown lines, p35S::AtAP2/ap2-5 KD, p35S::BrAP2a/ap2-5 KD, and p35S::BrAP2b/ap2-5 KD, from three transgenic group of p35S:AtAP2/ap2-5 , p35S::BrAP2a/ap2-5 , and p35S::BrAP2a/ap2-5 . (D) semi-quantitative RT-PCR and Western blot assays to validate the transgenic lines. Bars, 500 μm.

    Techniques Used: Mutagenesis, Transformation Assay, Transgenic Assay, Quantitative RT-PCR, Western Blot

    36) Product Images from "Structural basis underlying viral hijacking of a histone chaperone complex"

    Article Title: Structural basis underlying viral hijacking of a histone chaperone complex

    Journal: Nature Communications

    doi: 10.1038/ncomms12707

    BNRF1-DAXX interaction is essential for EBV latent cycle gene expression during primary infection and B-cell immortalization. ( a ) Primary human B-lymphocytes were mock treated or infected with recombinant EBV wt (orange) or BNRF1 D568A/D569A genomes at a MOI of 30 for 1 week and then assayed by RT–PCR for EBV latency-associated genes EBNA1, EBNA2, EBNA3C or lytic immediate early gene ZTA, or cellular proliferation marker Ki67. The bar graph represents means±s.d. from at least three independent infection experiments. P value was calculated by two-tailed t -test. ( b ) The same as in a , except that BNRF1 V546D/L548D mutant virus was used to infect primary B cells. ( c ) Resazurin assay measuring the relative cell survival for B-cells infected with mock, EBV wt, D568A/D569A or V546D/L548D recombinant virus at 4 weeks post infection. Data represent means±s.d ( n =3), two-tailed t -test. ( d ) Colony formation assay for primary B cells infected with mock, EBV wt, D568A/D569A or V546D/L548D recombinant virus at 3 weeks post infection. Data represent means±s.d ( n =3), two-tailed t -test. ( e ) Representative images of the B-cell clonal proliferation used for quantification, as shown in d . BF indicates bright-field imaging, and scale bar, 200 μm. ( f ) Primary B-lymphocytes were infected at a MOI of 10 with recombinant EBV virus generated by trans-complementation of the BNRF1 deletion mutant (ΔBNRF1) with either empty vector, FLAG-BNRF1 wt, Y390A, V546A/L548A or Y390A/K461A. EBNA1 and EBNA2 expression was assayed by quantitative real-time PCR at 1 week post infection. Data represent means±s.d from two independent experiments with triplicates. No RT controls shown in green. ( g ) WB for virions generated by trans-complementation with FLAG-BNRF1 wt or mutants, as indicated, and probed with FLAG, BLAF2 or actin. MOI, multiplicity of infection; RT–PCR, PCR with reverse transcription.
    Figure Legend Snippet: BNRF1-DAXX interaction is essential for EBV latent cycle gene expression during primary infection and B-cell immortalization. ( a ) Primary human B-lymphocytes were mock treated or infected with recombinant EBV wt (orange) or BNRF1 D568A/D569A genomes at a MOI of 30 for 1 week and then assayed by RT–PCR for EBV latency-associated genes EBNA1, EBNA2, EBNA3C or lytic immediate early gene ZTA, or cellular proliferation marker Ki67. The bar graph represents means±s.d. from at least three independent infection experiments. P value was calculated by two-tailed t -test. ( b ) The same as in a , except that BNRF1 V546D/L548D mutant virus was used to infect primary B cells. ( c ) Resazurin assay measuring the relative cell survival for B-cells infected with mock, EBV wt, D568A/D569A or V546D/L548D recombinant virus at 4 weeks post infection. Data represent means±s.d ( n =3), two-tailed t -test. ( d ) Colony formation assay for primary B cells infected with mock, EBV wt, D568A/D569A or V546D/L548D recombinant virus at 3 weeks post infection. Data represent means±s.d ( n =3), two-tailed t -test. ( e ) Representative images of the B-cell clonal proliferation used for quantification, as shown in d . BF indicates bright-field imaging, and scale bar, 200 μm. ( f ) Primary B-lymphocytes were infected at a MOI of 10 with recombinant EBV virus generated by trans-complementation of the BNRF1 deletion mutant (ΔBNRF1) with either empty vector, FLAG-BNRF1 wt, Y390A, V546A/L548A or Y390A/K461A. EBNA1 and EBNA2 expression was assayed by quantitative real-time PCR at 1 week post infection. Data represent means±s.d from two independent experiments with triplicates. No RT controls shown in green. ( g ) WB for virions generated by trans-complementation with FLAG-BNRF1 wt or mutants, as indicated, and probed with FLAG, BLAF2 or actin. MOI, multiplicity of infection; RT–PCR, PCR with reverse transcription.

    Techniques Used: Expressing, Infection, Recombinant, Reverse Transcription Polymerase Chain Reaction, Marker, Two Tailed Test, Mutagenesis, Resazurin Assay, Colony Assay, Imaging, Generated, Plasmid Preparation, Real-time Polymerase Chain Reaction, Western Blot, Polymerase Chain Reaction

    37) Product Images from "Variants in the 3' UTR of General Transcription Factor IIF, polypeptide 2 affect female calving efficiency in Japanese Black cattle"

    Article Title: Variants in the 3' UTR of General Transcription Factor IIF, polypeptide 2 affect female calving efficiency in Japanese Black cattle

    Journal: BMC Genetics

    doi: 10.1186/1471-2156-14-41

    The allelic imbalance test for levels of GTF2F2 mRNA in the heterozygotes. The cDNA from primary dermal fibroblasts and ovaries and genomic (g) DNA from heterozygous animals was amplified using primers to BovineHD1200004611 (15,465,327 bp) on BTA12, which is located in the exon of GTF2F2 (Additional files 3 and 5 ). The PCR product was directly sequenced. Peak height at the SNP was quantified using PeakPicker 2 software [ 8 ]. The y -axis shows the ratio of the ratios of the peak height of the Q allele over the q allele in the cDNA and in the gDNA from the same animal. Red bars show the mean expression in primary dermal fibroblasts (n = 13, mean = 1.336) and ovaries (n =19, mean = 1.325). The P values for the difference between the ratios of the peak height of the Q allele over the q allele in the cDNA and the ratios of the peak height of the Q allele over the q allele in the gDNA were 0.002 (primary dermal fibroblast) and 0.0011 (ovary), respectively, as determined by t -test.
    Figure Legend Snippet: The allelic imbalance test for levels of GTF2F2 mRNA in the heterozygotes. The cDNA from primary dermal fibroblasts and ovaries and genomic (g) DNA from heterozygous animals was amplified using primers to BovineHD1200004611 (15,465,327 bp) on BTA12, which is located in the exon of GTF2F2 (Additional files 3 and 5 ). The PCR product was directly sequenced. Peak height at the SNP was quantified using PeakPicker 2 software [ 8 ]. The y -axis shows the ratio of the ratios of the peak height of the Q allele over the q allele in the cDNA and in the gDNA from the same animal. Red bars show the mean expression in primary dermal fibroblasts (n = 13, mean = 1.336) and ovaries (n =19, mean = 1.325). The P values for the difference between the ratios of the peak height of the Q allele over the q allele in the cDNA and the ratios of the peak height of the Q allele over the q allele in the gDNA were 0.002 (primary dermal fibroblast) and 0.0011 (ovary), respectively, as determined by t -test.

    Techniques Used: Amplification, Polymerase Chain Reaction, Software, Expressing

    38) Product Images from "EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer"

    Article Title: EARE-1, a Transcriptionally Active Ty1/Copia-Like Retrotransposon Has Colonized the Genome of Excoecaria agallocha through Horizontal Transfer

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.00045

    Structural characteristics of EARE-1 from E. agallocha . (A) Schematic presentation of EARE-1 . LTRs and coding regions are indicated with arrows and boxes, respectively. The sequences of PBS and PPT are underlined. Lines indicate the locations of PCR products that were used to estimate the copy number of EARE-1 in E. agallocha . (B) ML tree of EARE-1 and known LTR retrotransposons based on the RT amino acid sequences. Numbers above branches indicate bootstrap values > 50% based on 1000 replicates. The retrotransposon sequences used were: EARE-1 (GenBank accession number: KU198316 ), Tork4 ( EU105455.1 ), Rider ( ABO36622.1 ), Ta1-3 ( X13291 ), Tnt1-94 ( X13777 ), Tto1 ( D83003 ), Sto-4 ( AF082133 ), SORE-1 ( AB370254 ), RIRE1 ( D85597 ), BARE-1 ( Z17327 ), Angela ( AY485644.1 ), maximus ( TREP1654 ), SIRE1-4 ( AY205608.1 ), HORPIA ( AY6615581 ), leojyg ( AY268139.1 ), Tgmr ( U96748 ), Retrofit ( AH005614 ), TY1B ( Z35766.1 ), Bianca ( AF521177.1 ), and TY3B ( CAA97115.1 ).
    Figure Legend Snippet: Structural characteristics of EARE-1 from E. agallocha . (A) Schematic presentation of EARE-1 . LTRs and coding regions are indicated with arrows and boxes, respectively. The sequences of PBS and PPT are underlined. Lines indicate the locations of PCR products that were used to estimate the copy number of EARE-1 in E. agallocha . (B) ML tree of EARE-1 and known LTR retrotransposons based on the RT amino acid sequences. Numbers above branches indicate bootstrap values > 50% based on 1000 replicates. The retrotransposon sequences used were: EARE-1 (GenBank accession number: KU198316 ), Tork4 ( EU105455.1 ), Rider ( ABO36622.1 ), Ta1-3 ( X13291 ), Tnt1-94 ( X13777 ), Tto1 ( D83003 ), Sto-4 ( AF082133 ), SORE-1 ( AB370254 ), RIRE1 ( D85597 ), BARE-1 ( Z17327 ), Angela ( AY485644.1 ), maximus ( TREP1654 ), SIRE1-4 ( AY205608.1 ), HORPIA ( AY6615581 ), leojyg ( AY268139.1 ), Tgmr ( U96748 ), Retrofit ( AH005614 ), TY1B ( Z35766.1 ), Bianca ( AF521177.1 ), and TY3B ( CAA97115.1 ).

    Techniques Used: Polymerase Chain Reaction

    The transcriptional activity of EARE-1 in E. agallocha . (A) Expression of EARE-1 in different organs of E. agallocha . R, root; SF, staminate flower; PF, pistillate flower; L, leaf and S, seed. β-actin was used as an internal control. (+): reactions with reverse transcriptase; (−): reactions without reverse transcriptase. (B) Stress-responsive expression of EARE-1 determined by qRT-PCR. The data shown are the relative expression levels of EARE-1 in the stress-treated vs. untreated (control) leaves of E. agallocha normalized using the expression levels of β -actin . Cold, 4°C treatment; drought, 20% PEG 6000; NAA, 50 μM 1-naphthylacetic acid; NaCl, 200 mM NaCl; SA, 1 mM salicylic acid and wounding. Three biological replicates were conducted for each treatment. The significance determined by a two-tailed t -test is shown as * , P
    Figure Legend Snippet: The transcriptional activity of EARE-1 in E. agallocha . (A) Expression of EARE-1 in different organs of E. agallocha . R, root; SF, staminate flower; PF, pistillate flower; L, leaf and S, seed. β-actin was used as an internal control. (+): reactions with reverse transcriptase; (−): reactions without reverse transcriptase. (B) Stress-responsive expression of EARE-1 determined by qRT-PCR. The data shown are the relative expression levels of EARE-1 in the stress-treated vs. untreated (control) leaves of E. agallocha normalized using the expression levels of β -actin . Cold, 4°C treatment; drought, 20% PEG 6000; NAA, 50 μM 1-naphthylacetic acid; NaCl, 200 mM NaCl; SA, 1 mM salicylic acid and wounding. Three biological replicates were conducted for each treatment. The significance determined by a two-tailed t -test is shown as * , P

    Techniques Used: Activity Assay, Expressing, Quantitative RT-PCR, Two Tailed Test

    39) Product Images from "CRISPR-Mediated Non-Viral Site-Specific Gene Integration and Expression in T Cells: Protocol and Application for T-Cell Therapy"

    Article Title: CRISPR-Mediated Non-Viral Site-Specific Gene Integration and Expression in T Cells: Protocol and Application for T-Cell Therapy

    Journal: Cancers

    doi: 10.3390/cancers12061704

    Overview of the steps to generate transgene knock-in in T cell: ( a ) Molecular steps considering vector design, amplification, purification, and concentration DNA. ( b ) Electroporation of RNA ribonucleoproteins (RNPs) and donor template to T cells using Lonza instrument. ( c ) Human T-cell preparation before electroporation. Complete and detailed knock-in protocol can be found in the Supplementary Materials . ( d ) The 1% agarose gel showing PCR amplicons that were gel purified vs. non-gel purified. ( e ) Concentration of dsDNA template after purification and concentration ( n = 24).
    Figure Legend Snippet: Overview of the steps to generate transgene knock-in in T cell: ( a ) Molecular steps considering vector design, amplification, purification, and concentration DNA. ( b ) Electroporation of RNA ribonucleoproteins (RNPs) and donor template to T cells using Lonza instrument. ( c ) Human T-cell preparation before electroporation. Complete and detailed knock-in protocol can be found in the Supplementary Materials . ( d ) The 1% agarose gel showing PCR amplicons that were gel purified vs. non-gel purified. ( e ) Concentration of dsDNA template after purification and concentration ( n = 24).

    Techniques Used: Knock-In, Plasmid Preparation, Amplification, Purification, Concentration Assay, Electroporation, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    40) Product Images from "Characterization of an Archaeal Two-Component System That Regulates Methanogenesis in Methanosaeta harundinacea"

    Article Title: Characterization of an Archaeal Two-Component System That Regulates Methanogenesis in Methanosaeta harundinacea

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0095502

    ChIP-PCR and ChIP-qPCR detected FilR1 associations with the promoters of genes for methanogenesis inside M. harundinacea cells. (A) PCR products amplified with the indicated primers using anti-FilR1 antibody immunoprecipitated DNA (AbFilR1) as a template and mock-IP DNA as a negative control (CK). (B) qPCR assays detected the enrichment of DNA fragments in anti-FilR1 antibody immunoprecipitated samples (AbFilR1, gray bar) over mock-IP negative control samples (CK, black bar). P acs1 , promoter region of operon acs1 ; P acs4 , promoter region of acs4 ; P mtr , promoter region of operon mtr ; P fwd , promoter region of the operon fwdCABD ; P omp , promoter region of omp and 16s, intragenic DNA fragment of 16S rDNA used as the control.
    Figure Legend Snippet: ChIP-PCR and ChIP-qPCR detected FilR1 associations with the promoters of genes for methanogenesis inside M. harundinacea cells. (A) PCR products amplified with the indicated primers using anti-FilR1 antibody immunoprecipitated DNA (AbFilR1) as a template and mock-IP DNA as a negative control (CK). (B) qPCR assays detected the enrichment of DNA fragments in anti-FilR1 antibody immunoprecipitated samples (AbFilR1, gray bar) over mock-IP negative control samples (CK, black bar). P acs1 , promoter region of operon acs1 ; P acs4 , promoter region of acs4 ; P mtr , promoter region of operon mtr ; P fwd , promoter region of the operon fwdCABD ; P omp , promoter region of omp and 16s, intragenic DNA fragment of 16S rDNA used as the control.

    Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Amplification, Immunoprecipitation, Negative Control

    Cotranscription of filI and filR2 in M. harundinacea . (A) Schematic arrangement of filI and fliR2 in the genome. (B) Agarose gel electrophoresis of PCR products amplified from the intergenic region between filI and filR2 . (C) The intergenic spacer between filR2 and its upstream gene encoding a ferredoxin using the respective template labeled at the top of each gel: -, no DNA; RNA, total RNA extracted form M. harundinacea cells; cDNA, reverse transcripts from the total RNA; gDNA, genomic DNA of M. harundinacea . M, DL2000 marker with the sizes shown at the right. Primers spacer-IR2-R/F and spacer-gen-F/R were used for PCR reactions in (B) and (C), respectively.
    Figure Legend Snippet: Cotranscription of filI and filR2 in M. harundinacea . (A) Schematic arrangement of filI and fliR2 in the genome. (B) Agarose gel electrophoresis of PCR products amplified from the intergenic region between filI and filR2 . (C) The intergenic spacer between filR2 and its upstream gene encoding a ferredoxin using the respective template labeled at the top of each gel: -, no DNA; RNA, total RNA extracted form M. harundinacea cells; cDNA, reverse transcripts from the total RNA; gDNA, genomic DNA of M. harundinacea . M, DL2000 marker with the sizes shown at the right. Primers spacer-IR2-R/F and spacer-gen-F/R were used for PCR reactions in (B) and (C), respectively.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Labeling, Marker

    ChIP assays showed FilR1 binding to the promoters of its own (P filR1 ) and filI-filR2 operon (P filR1-filR2 ) inside the cells of M. hurandiacea 6AC. (A) PCR products of the promoters of its own (P filR1 ) and filI-filR2 operon (P filR1-filR2 ) were amplified from the anti-FilR1 antibody immunoprecipitated DNA (Ab FilR1 ), and input DNA sample before immunoprecipitation ( Material and Methods ) as a positive control (Input). Almost no PCR products were amplified from the mock-IP DNA (CK) samples. (B) qPCR detected the enrichment folds of the DNA fragments in anti-FilR1 antibody immunoprecipitated DNA (Ab FilR1 , gray bar) over mock-IP control (CK, black bar). PCR amplifications were performed using the specific primers for the promoter regions of filR1 (P filR1 ) and filI-filR2 operon (P filI-R2 ). An intragenic DNA fragment of the16S rRNA gene (16 s) was included as the negative control.
    Figure Legend Snippet: ChIP assays showed FilR1 binding to the promoters of its own (P filR1 ) and filI-filR2 operon (P filR1-filR2 ) inside the cells of M. hurandiacea 6AC. (A) PCR products of the promoters of its own (P filR1 ) and filI-filR2 operon (P filR1-filR2 ) were amplified from the anti-FilR1 antibody immunoprecipitated DNA (Ab FilR1 ), and input DNA sample before immunoprecipitation ( Material and Methods ) as a positive control (Input). Almost no PCR products were amplified from the mock-IP DNA (CK) samples. (B) qPCR detected the enrichment folds of the DNA fragments in anti-FilR1 antibody immunoprecipitated DNA (Ab FilR1 , gray bar) over mock-IP control (CK, black bar). PCR amplifications were performed using the specific primers for the promoter regions of filR1 (P filR1 ) and filI-filR2 operon (P filI-R2 ). An intragenic DNA fragment of the16S rRNA gene (16 s) was included as the negative control.

    Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Polymerase Chain Reaction, Amplification, Immunoprecipitation, Positive Control, Real-time Polymerase Chain Reaction, Negative Control

    Related Articles

    Clone Assay:

    Article Title: The Neuronal PAS Domain Protein 4 (Npas4) Is Required for New and Reactivated Fear Memories
    Article Snippet: .. cDNA constructs Rat Npas4 (GenBank Accession No. NM_153626) cDNA was obtained by PCR amplification with gene specific primers (Forward primer: CCGCTCG-AGATGGACCGATCCACCAAGGGC; Reverse primer: GGAATTCGAAACGTTG-GTTCCCCTCCAC) from oligo dT primed rat brain cDNA and cloned into the XhoI and EcoRI sites of the pdsRedN-N1 (Clontech). .. Short-hairpin oligonucleotides designed to target Npas4 mRNA for degradation were annealed and cloned into SapI/XbaI sites of the AAV-GFP plasmid, a modified pCMV-MCS AAV vector .

    Amplification:

    Article Title: Osteopontin is Required for Unloading-Induced Osteoclast Recruitment and Modulation of RANKL Expression during Tooth Drift-associated Bone Remodeling, but Not for Super-Eruption
    Article Snippet: .. The presence or absence of OPN was confirmed by PCR amplification of genomic DNA extracted from tail snips using Taq polymerase (Clontech, Mountain View, CA) and primer sequences provided by Jackson Labs. .. All animal experiments and procedures followed the guidelines of the University of Illinois at Chicago Animal Care Committee.

    Article Title: Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System
    Article Snippet: .. The target site of the BmNPV genome was amplified with a PCR reagent kit (Takara, Dalian, China) using the indicated primers ( Supplementary Table ). .. Then, the PCR products were reannealed in NEBuffer 2 (NEB, United States) using the following conditions: 95°C for 5 min; 95–85°C at -2°C/s; 85–25°C at -0.1°C/s; hold at 4°C, and then digested with T7 endonuclease I (T7EI) for 30 min at 37°C.

    Article Title: Rampant Nuclear Transfer and Substitutions of Plastid Genes in Passiflora
    Article Snippet: .. Validation of Intron in the Nuclear rps7 and rpl20 Introns in nuclear-encoded rps7 and rpl20 were validated with polymerase chain reaction (PCR) amplification. .. Genomic DNAs were isolated for six Passiflora species using NucleoSpin Plant II DNA Extraction Kit (MACHEREY-NAGEL, Düren, Germany).

    Article Title: Different characteristics of mesenchymal stem cells isolated from different layers of full term placenta
    Article Snippet: .. GAPDH was included as a positive control. cDNA was used as template for PCR amplification using a Thermal cycler TP6000 (Takara Bio Inc co., Ltd). ..

    Article Title: A vitamin C-derived DNA modification catalyzed by an algal TET homolog
    Article Snippet: .. The bisulfite-treated DNA was subjected to PCR amplification using Taq HS polymerase (TAKARA). ..

    Article Title: The Neuronal PAS Domain Protein 4 (Npas4) Is Required for New and Reactivated Fear Memories
    Article Snippet: .. cDNA constructs Rat Npas4 (GenBank Accession No. NM_153626) cDNA was obtained by PCR amplification with gene specific primers (Forward primer: CCGCTCG-AGATGGACCGATCCACCAAGGGC; Reverse primer: GGAATTCGAAACGTTG-GTTCCCCTCCAC) from oligo dT primed rat brain cDNA and cloned into the XhoI and EcoRI sites of the pdsRedN-N1 (Clontech). .. Short-hairpin oligonucleotides designed to target Npas4 mRNA for degradation were annealed and cloned into SapI/XbaI sites of the AAV-GFP plasmid, a modified pCMV-MCS AAV vector .

    Article Title: Math6 expression during kidney development and altered expression in a mouse model of glomerulosclerosis
    Article Snippet: .. One tenth of each RT reactions was used for PCR amplification with primers specific for the Math6 3’ untranslated region (forward: GTCTTCCTCAAGATGCTGCC and reverse: GCAATGATGTGGTTTTGTGC), and with glyceraldehyde-3-phosphate dehydrogenase (GAP) primers purchased from Clontech. .. Recommended conditions for hot start PCR using Platinum Taq (Invitrogen) were used with an annealing temperature of 50°C for 30 cycles.

    Article Title: Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿ †
    Article Snippet: .. Yeast two-hybrid vectors were generated as described previously ( ) by PCR amplification of domains of the Tas3 and Chp1 open reading frames and by subcloning them into pGBKT7 (Chp1) and pGADT7 (Tas3) vectors (Clontech). .. The vector for the reintegration of clr4 + (JP-1084) was previously described and allows the reintegration of a genomic clone of clr4 + (under the control of its endogenous regulatory sequences) into clr4 null cells ( ).

    Positive Control:

    Article Title: Different characteristics of mesenchymal stem cells isolated from different layers of full term placenta
    Article Snippet: .. GAPDH was included as a positive control. cDNA was used as template for PCR amplification using a Thermal cycler TP6000 (Takara Bio Inc co., Ltd). ..

    Subcloning:

    Article Title: Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿ †
    Article Snippet: .. Yeast two-hybrid vectors were generated as described previously ( ) by PCR amplification of domains of the Tas3 and Chp1 open reading frames and by subcloning them into pGBKT7 (Chp1) and pGADT7 (Tas3) vectors (Clontech). .. The vector for the reintegration of clr4 + (JP-1084) was previously described and allows the reintegration of a genomic clone of clr4 + (under the control of its endogenous regulatory sequences) into clr4 null cells ( ).

    Construct:

    Article Title: The Neuronal PAS Domain Protein 4 (Npas4) Is Required for New and Reactivated Fear Memories
    Article Snippet: .. cDNA constructs Rat Npas4 (GenBank Accession No. NM_153626) cDNA was obtained by PCR amplification with gene specific primers (Forward primer: CCGCTCG-AGATGGACCGATCCACCAAGGGC; Reverse primer: GGAATTCGAAACGTTG-GTTCCCCTCCAC) from oligo dT primed rat brain cDNA and cloned into the XhoI and EcoRI sites of the pdsRedN-N1 (Clontech). .. Short-hairpin oligonucleotides designed to target Npas4 mRNA for degradation were annealed and cloned into SapI/XbaI sites of the AAV-GFP plasmid, a modified pCMV-MCS AAV vector .

    Generated:

    Article Title: Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿ †
    Article Snippet: .. Yeast two-hybrid vectors were generated as described previously ( ) by PCR amplification of domains of the Tas3 and Chp1 open reading frames and by subcloning them into pGBKT7 (Chp1) and pGADT7 (Tas3) vectors (Clontech). .. The vector for the reintegration of clr4 + (JP-1084) was previously described and allows the reintegration of a genomic clone of clr4 + (under the control of its endogenous regulatory sequences) into clr4 null cells ( ).

    Polymerase Chain Reaction:

    Article Title: Osteopontin is Required for Unloading-Induced Osteoclast Recruitment and Modulation of RANKL Expression during Tooth Drift-associated Bone Remodeling, but Not for Super-Eruption
    Article Snippet: .. The presence or absence of OPN was confirmed by PCR amplification of genomic DNA extracted from tail snips using Taq polymerase (Clontech, Mountain View, CA) and primer sequences provided by Jackson Labs. .. All animal experiments and procedures followed the guidelines of the University of Illinois at Chicago Animal Care Committee.

    Article Title: Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System
    Article Snippet: .. The target site of the BmNPV genome was amplified with a PCR reagent kit (Takara, Dalian, China) using the indicated primers ( Supplementary Table ). .. Then, the PCR products were reannealed in NEBuffer 2 (NEB, United States) using the following conditions: 95°C for 5 min; 95–85°C at -2°C/s; 85–25°C at -0.1°C/s; hold at 4°C, and then digested with T7 endonuclease I (T7EI) for 30 min at 37°C.

    Article Title: Rampant Nuclear Transfer and Substitutions of Plastid Genes in Passiflora
    Article Snippet: .. Validation of Intron in the Nuclear rps7 and rpl20 Introns in nuclear-encoded rps7 and rpl20 were validated with polymerase chain reaction (PCR) amplification. .. Genomic DNAs were isolated for six Passiflora species using NucleoSpin Plant II DNA Extraction Kit (MACHEREY-NAGEL, Düren, Germany).

    Article Title: Different characteristics of mesenchymal stem cells isolated from different layers of full term placenta
    Article Snippet: .. GAPDH was included as a positive control. cDNA was used as template for PCR amplification using a Thermal cycler TP6000 (Takara Bio Inc co., Ltd). ..

    Article Title: A vitamin C-derived DNA modification catalyzed by an algal TET homolog
    Article Snippet: .. The bisulfite-treated DNA was subjected to PCR amplification using Taq HS polymerase (TAKARA). ..

    Article Title: The Neuronal PAS Domain Protein 4 (Npas4) Is Required for New and Reactivated Fear Memories
    Article Snippet: .. cDNA constructs Rat Npas4 (GenBank Accession No. NM_153626) cDNA was obtained by PCR amplification with gene specific primers (Forward primer: CCGCTCG-AGATGGACCGATCCACCAAGGGC; Reverse primer: GGAATTCGAAACGTTG-GTTCCCCTCCAC) from oligo dT primed rat brain cDNA and cloned into the XhoI and EcoRI sites of the pdsRedN-N1 (Clontech). .. Short-hairpin oligonucleotides designed to target Npas4 mRNA for degradation were annealed and cloned into SapI/XbaI sites of the AAV-GFP plasmid, a modified pCMV-MCS AAV vector .

    Article Title: Math6 expression during kidney development and altered expression in a mouse model of glomerulosclerosis
    Article Snippet: .. One tenth of each RT reactions was used for PCR amplification with primers specific for the Math6 3’ untranslated region (forward: GTCTTCCTCAAGATGCTGCC and reverse: GCAATGATGTGGTTTTGTGC), and with glyceraldehyde-3-phosphate dehydrogenase (GAP) primers purchased from Clontech. .. Recommended conditions for hot start PCR using Platinum Taq (Invitrogen) were used with an annealing temperature of 50°C for 30 cycles.

    Article Title: Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿Chp1-Tas3 Interaction Is Required To Recruit RITS to Fission Yeast Centromeres and for Maintenance of Centromeric Heterochromatin ▿ †
    Article Snippet: .. Yeast two-hybrid vectors were generated as described previously ( ) by PCR amplification of domains of the Tas3 and Chp1 open reading frames and by subcloning them into pGBKT7 (Chp1) and pGADT7 (Tas3) vectors (Clontech). .. The vector for the reintegration of clr4 + (JP-1084) was previously described and allows the reintegration of a genomic clone of clr4 + (under the control of its endogenous regulatory sequences) into clr4 null cells ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa pcr amplificaion system
    Pcr Amplificaion System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplificaion system/product/TaKaRa
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplificaion system - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    97
    TaKaRa pcr amplification48 h
    Pcr Amplification48 H, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification48 h/product/TaKaRa
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplification48 h - by Bioz Stars, 2021-01
    97/100 stars
      Buy from Supplier

    88
    TaKaRa pcr amplificationwas
    Pcr Amplificationwas, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplificationwas/product/TaKaRa
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplificationwas - by Bioz Stars, 2021-01
    88/100 stars
      Buy from Supplier

    Image Search Results