pblunt vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Thermo Fisher pblunt vector
    Pblunt Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pblunt vector/product/Thermo Fisher
    Average 89 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    pblunt vector - by Bioz Stars, 2020-08
    89/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The Mediator Complex Subunit PFT1 Is a Key Regulator of Jasmonate-Dependent Defense in Arabidopsis [C] [C] [W]
    Article Snippet: .. The amplification product was cloned into the pBlunt vector (Invitrogen) and confirmed by sequencing. .. Ta PFT1 was released by digesting the plasmid with Bam HI and cloned into the Bam H1-digested binary vector pPCV91 , which was then mobilized into the Agrobacterium tumefaciens strain GV3101.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: .. The Gc ruvB and ruvC loci were cloned into the pBLUNT vector (Invitrogen) using the primers RUVBFOR (CCATTCCGCCCCCGACATA), RUVBREV (GCTGATGTGGGTCAACCCC), RUVCFOR2 (GGCGAATGTCGAAAACAATAAAT), and RUVCREV2 (CAAATAATGCTTATTGCGGTAG) and mutated using a deletion/insertion strategy. .. Briefly, 925 bp of the ruvB gene was deleted using the Bbs I (NEB) restriction endonuclease (RE) and an ermC cassette was inserted between the Bbs I sites.

    Article Title: Identification of a novel cell type-specific intronic enhancer of macrophage migration inhibitory factor (MIF) and its regulation by mithramycin
    Article Snippet: .. The amplicons were cloned initially into pBLUNT vector (Invitrogen), subcloned into pGL3-promoter vector (Promega, Southampton, UK) and then sequenced, and for each construct a clone with the intron in the sense (S) or anti-sense (AS) orientation was isolated. ..

    Article Title: Analysis of the Piv Recombinase-Related Gene Family of Neisseria gonorrhoeae
    Article Snippet: .. The following mutant irg genes were created and introduced into FA1090 recA6 in the order presented to create a strain with all eight irg genes knocked out. irg5 , irg6 , and irg8 were PCR amplified by using either PivDir (5′-TCGGGATTTACGCCGATTTG-3′) with PivPrimer (5′-ATAAGGGTAATCCCTG-3′) for irg6 or PivFor (5′-CGCCGAAAGGAACGTGTATGCT-3′) with PivRev2 (5′-CGGATTTCAGACGCGGCAAAGCA-3′) for irg5 and irg8 and cloned into the pBlunt vector (Invitrogen). ..

    Article Title: Evaluation of Canonical siRNA and Dicer Substrate RNA for Inhibition of Hepatitis C Virus Genome Replication – A Comparative Study
    Article Snippet: .. The PCR product was subsequently cloned into a pBlunt vector (Thermo Scientific) and transformed into Z-competent E. Coli (Zymo Research). .. Nineteen clones were selected and submitted for sequencing using the BigDye Terminator (Life technologies), and the products were sequenced in an ABI 3130XL Sequencer (Life technologies).

    Amplification:

    Article Title: The Mediator Complex Subunit PFT1 Is a Key Regulator of Jasmonate-Dependent Defense in Arabidopsis [C] [C] [W]
    Article Snippet: .. The amplification product was cloned into the pBlunt vector (Invitrogen) and confirmed by sequencing. .. Ta PFT1 was released by digesting the plasmid with Bam HI and cloned into the Bam H1-digested binary vector pPCV91 , which was then mobilized into the Agrobacterium tumefaciens strain GV3101.

    Article Title: Analysis of the Piv Recombinase-Related Gene Family of Neisseria gonorrhoeae
    Article Snippet: .. The following mutant irg genes were created and introduced into FA1090 recA6 in the order presented to create a strain with all eight irg genes knocked out. irg5 , irg6 , and irg8 were PCR amplified by using either PivDir (5′-TCGGGATTTACGCCGATTTG-3′) with PivPrimer (5′-ATAAGGGTAATCCCTG-3′) for irg6 or PivFor (5′-CGCCGAAAGGAACGTGTATGCT-3′) with PivRev2 (5′-CGGATTTCAGACGCGGCAAAGCA-3′) for irg5 and irg8 and cloned into the pBlunt vector (Invitrogen). ..

    Mutagenesis:

    Article Title: Analysis of the Piv Recombinase-Related Gene Family of Neisseria gonorrhoeae
    Article Snippet: .. The following mutant irg genes were created and introduced into FA1090 recA6 in the order presented to create a strain with all eight irg genes knocked out. irg5 , irg6 , and irg8 were PCR amplified by using either PivDir (5′-TCGGGATTTACGCCGATTTG-3′) with PivPrimer (5′-ATAAGGGTAATCCCTG-3′) for irg6 or PivFor (5′-CGCCGAAAGGAACGTGTATGCT-3′) with PivRev2 (5′-CGGATTTCAGACGCGGCAAAGCA-3′) for irg5 and irg8 and cloned into the pBlunt vector (Invitrogen). ..

    Isolation:

    Article Title: Identification of a novel cell type-specific intronic enhancer of macrophage migration inhibitory factor (MIF) and its regulation by mithramycin
    Article Snippet: .. The amplicons were cloned initially into pBLUNT vector (Invitrogen), subcloned into pGL3-promoter vector (Promega, Southampton, UK) and then sequenced, and for each construct a clone with the intron in the sense (S) or anti-sense (AS) orientation was isolated. ..

    Construct:

    Article Title: Identification of a novel cell type-specific intronic enhancer of macrophage migration inhibitory factor (MIF) and its regulation by mithramycin
    Article Snippet: .. The amplicons were cloned initially into pBLUNT vector (Invitrogen), subcloned into pGL3-promoter vector (Promega, Southampton, UK) and then sequenced, and for each construct a clone with the intron in the sense (S) or anti-sense (AS) orientation was isolated. ..

    Sequencing:

    Article Title: The Mediator Complex Subunit PFT1 Is a Key Regulator of Jasmonate-Dependent Defense in Arabidopsis [C] [C] [W]
    Article Snippet: .. The amplification product was cloned into the pBlunt vector (Invitrogen) and confirmed by sequencing. .. Ta PFT1 was released by digesting the plasmid with Bam HI and cloned into the Bam H1-digested binary vector pPCV91 , which was then mobilized into the Agrobacterium tumefaciens strain GV3101.

    Polymerase Chain Reaction:

    Article Title: Analysis of the Piv Recombinase-Related Gene Family of Neisseria gonorrhoeae
    Article Snippet: .. The following mutant irg genes were created and introduced into FA1090 recA6 in the order presented to create a strain with all eight irg genes knocked out. irg5 , irg6 , and irg8 were PCR amplified by using either PivDir (5′-TCGGGATTTACGCCGATTTG-3′) with PivPrimer (5′-ATAAGGGTAATCCCTG-3′) for irg6 or PivFor (5′-CGCCGAAAGGAACGTGTATGCT-3′) with PivRev2 (5′-CGGATTTCAGACGCGGCAAAGCA-3′) for irg5 and irg8 and cloned into the pBlunt vector (Invitrogen). ..

    Article Title: Evaluation of Canonical siRNA and Dicer Substrate RNA for Inhibition of Hepatitis C Virus Genome Replication – A Comparative Study
    Article Snippet: .. The PCR product was subsequently cloned into a pBlunt vector (Thermo Scientific) and transformed into Z-competent E. Coli (Zymo Research). .. Nineteen clones were selected and submitted for sequencing using the BigDye Terminator (Life technologies), and the products were sequenced in an ABI 3130XL Sequencer (Life technologies).

    Transformation Assay:

    Article Title: Evaluation of Canonical siRNA and Dicer Substrate RNA for Inhibition of Hepatitis C Virus Genome Replication – A Comparative Study
    Article Snippet: .. The PCR product was subsequently cloned into a pBlunt vector (Thermo Scientific) and transformed into Z-competent E. Coli (Zymo Research). .. Nineteen clones were selected and submitted for sequencing using the BigDye Terminator (Life technologies), and the products were sequenced in an ABI 3130XL Sequencer (Life technologies).

    Plasmid Preparation:

    Article Title: The Mediator Complex Subunit PFT1 Is a Key Regulator of Jasmonate-Dependent Defense in Arabidopsis [C] [C] [W]
    Article Snippet: .. The amplification product was cloned into the pBlunt vector (Invitrogen) and confirmed by sequencing. .. Ta PFT1 was released by digesting the plasmid with Bam HI and cloned into the Bam H1-digested binary vector pPCV91 , which was then mobilized into the Agrobacterium tumefaciens strain GV3101.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: .. The Gc ruvB and ruvC loci were cloned into the pBLUNT vector (Invitrogen) using the primers RUVBFOR (CCATTCCGCCCCCGACATA), RUVBREV (GCTGATGTGGGTCAACCCC), RUVCFOR2 (GGCGAATGTCGAAAACAATAAAT), and RUVCREV2 (CAAATAATGCTTATTGCGGTAG) and mutated using a deletion/insertion strategy. .. Briefly, 925 bp of the ruvB gene was deleted using the Bbs I (NEB) restriction endonuclease (RE) and an ermC cassette was inserted between the Bbs I sites.

    Article Title: Identification of a novel cell type-specific intronic enhancer of macrophage migration inhibitory factor (MIF) and its regulation by mithramycin
    Article Snippet: .. The amplicons were cloned initially into pBLUNT vector (Invitrogen), subcloned into pGL3-promoter vector (Promega, Southampton, UK) and then sequenced, and for each construct a clone with the intron in the sense (S) or anti-sense (AS) orientation was isolated. ..

    Article Title: Analysis of the Piv Recombinase-Related Gene Family of Neisseria gonorrhoeae
    Article Snippet: .. The following mutant irg genes were created and introduced into FA1090 recA6 in the order presented to create a strain with all eight irg genes knocked out. irg5 , irg6 , and irg8 were PCR amplified by using either PivDir (5′-TCGGGATTTACGCCGATTTG-3′) with PivPrimer (5′-ATAAGGGTAATCCCTG-3′) for irg6 or PivFor (5′-CGCCGAAAGGAACGTGTATGCT-3′) with PivRev2 (5′-CGGATTTCAGACGCGGCAAAGCA-3′) for irg5 and irg8 and cloned into the pBlunt vector (Invitrogen). ..

    Article Title: Evaluation of Canonical siRNA and Dicer Substrate RNA for Inhibition of Hepatitis C Virus Genome Replication – A Comparative Study
    Article Snippet: .. The PCR product was subsequently cloned into a pBlunt vector (Thermo Scientific) and transformed into Z-competent E. Coli (Zymo Research). .. Nineteen clones were selected and submitted for sequencing using the BigDye Terminator (Life technologies), and the products were sequenced in an ABI 3130XL Sequencer (Life technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Thermo Fisher pblunt vector
    Pblunt Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pblunt vector/product/Thermo Fisher
    Average 89 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    pblunt vector - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results