oneshot top10  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher oneshot top10
    Oneshot Top10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oneshot top10/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oneshot top10 - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher). .. Twelve clones were sequenced and analyzed using Serial Cloner.

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: .. G418 resistant clones were scraped and pooled; DNA was prepared and transformed into OneShot TOP10 chemically competent bacteria (Life Technologies). .. Bacterial transformants were selected on LB-carbenicillin plates and analyzed by restriction digest to identify the repaired plasmid.

    Article Title: Arsenic induces structural and compositional colonic microbiome change and promotes host nitrogen and amino acid metabolism
    Article Snippet: The PCR products obtained from each of the sample were ligated into the pCR2.1®-TOPO vector and transformed into OneShot Top10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. Positive clones were picked randomly from each sample and used to inoculate 5 ml of LB broth containing ampicilllin.

    Article Title: The Bacillus anthracis Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ †
    Article Snippet: .. OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen) were used as the host for all of the cloning procedures. .. E. coli strain GM2163 (New England Biolabs) was used to obtain unmethylated plasmid DNA for transformation of B. anthracis .

    Article Title: Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism
    Article Snippet: DNA constructs Expression construct for TIA-1 was cloned form HeLa cell library and constructed as described earlier ( ). .. To create a construct for maltose-binding protein (MBP)-TIA-1 fusion protein production, TIA-1 cDNA was inserted into pMAL-c4x using EcoR1 and HindIII restriction sites and the ligated vector was transformed to OneShot Top10 chemically competent Escherichia coli cells (Invitrogen).

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. The colony direct PCR assay was used to determine whether colonies included the correct PCR insert.

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies). .. Positive clones were identified by restriction enzymes analysis of purified plasmid and verified by DNA sequencing.

    Luciferase:

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: These plasmids contained the TATA-box basal promoter firefly and the Renilla luciferase reporter genes, respectively, and were constructed by insertion via HindIII linkers of the nucleotides −31 and +31 region of the herpes simplex virus thymidine kinase promoter into pGL3-Basic and phRG-B (Promega, Madison, WI, USA) . .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    TA Cloning:

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: .. PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions. .. Target plasmids were identified using PCR and isolated using the PureLink Quick Plasmid Miniprep Kit (Invitrogen).

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. The colony direct PCR assay was used to determine whether colonies included the correct PCR insert.

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen). .. Transformed cells were grown on LB agar plates containing 100 μg mL−1 ampicillin (selective for transformed cells containing a ligated vector).

    Construct:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: First, the pCL2 plasmid backbone was constructed by gap repair in yeast as follows: the yeast 2-micron ADE2 plasmid, pRS422 , was cut with Bgl II. .. G418 resistant clones were scraped and pooled; DNA was prepared and transformed into OneShot TOP10 chemically competent bacteria (Life Technologies).

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: These plasmids contained the TATA-box basal promoter firefly and the Renilla luciferase reporter genes, respectively, and were constructed by insertion via HindIII linkers of the nucleotides −31 and +31 region of the herpes simplex virus thymidine kinase promoter into pGL3-Basic and phRG-B (Promega, Madison, WI, USA) . .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    Article Title: Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism
    Article Snippet: .. To create a construct for maltose-binding protein (MBP)-TIA-1 fusion protein production, TIA-1 cDNA was inserted into pMAL-c4x using EcoR1 and HindIII restriction sites and the ligated vector was transformed to OneShot Top10 chemically competent Escherichia coli cells (Invitrogen). .. RNA probe preparation cDNA was used as a template for polymerase chain reaction (PCR) reactions whereby T7 RNA polymerase promoter sequence was added to the 5′-end of all fragments and a 30 bases long poly-A tail was included in the 3′-oligos for production of polyadenylated RNA probes for affinity purification.

    Adsorption:

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: All bands of the appropriate size were excised from the gels and purified by adsorption to a silica matrix (QIAquick Gel Extraction Kit, Qiagen). .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: qRT-PCR Quantitative PCR assays were carried out on an Illumina Eco machine in 20 μL reactions ( ). .. PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions.

    Amplification:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: .. The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen). .. Transduced RAW cells were isolated by puromycin selection and diluted to a single‐cell suspension before subculturing.

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher). .. Twelve clones were sequenced and analyzed using Serial Cloner.

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: An SPS2::EGFP::kanMX4 cassette was amplified from BC257 (gift of Barak Cohen) using primers Gap1.1_F and Gap1.1_R ( ) that bear homology to both the SPS2 genomic and plasmid DNA sequences. .. G418 resistant clones were scraped and pooled; DNA was prepared and transformed into OneShot TOP10 chemically competent bacteria (Life Technologies).

    Article Title: Arsenic induces structural and compositional colonic microbiome change and promotes host nitrogen and amino acid metabolism
    Article Snippet: Near full length 16S rRNA genes were amplified from the microbial community DNA using the universal primers 8F ( ) and 1492R ( ). .. The PCR products obtained from each of the sample were ligated into the pCR2.1®-TOPO vector and transformed into OneShot Top10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: In order to create template/target DNA for standard curve generation for the unknown assays the four possible targets (fl, fl-5, sh and sh-5) were amplified from “affected” (homozygous for the SINE insertion) or “unaffected” (homozygous for the wildtype allele) blood cDNA using PCR (as described above using HotStarTaq Plus DNA Polymerase). .. PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions.

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. The colony direct PCR assay was used to determine whether colonies included the correct PCR insert.

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: The TRBV region was amplified using the Advantage® 2 PCR enzyme system and the SMARTer™ cDNA RACE Kit (Clontech Laboratories, Inc) and the MBC2 reverse primer (5′‐TGCTTCTGATGGCTCAAACACAGCGACCT‐3′; Sigma‐Aldrich, St Louis, MO, USA). .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen).

    Activity Assay:

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: Estrogen Response Element activity was determined via Luciferase assays with pERE(5X)TA-ffLuc and pTA-srLuc reporter plasmids. .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    Subculturing Assay:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen). .. Transduced RAW cells were isolated by puromycin selection and diluted to a single‐cell suspension before subculturing.

    Expressing:

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: For transient expression of wild-type ERα and 351 aspartate-to-glycine-substituted mutant ERα, pSG5HEGO and pSG5D351GER plasmids were used respectively. pSG5HEGO was originally provided by Professor Pierre Chambon, University of Strasbourg, France, and pSG5D351GER was generated using QuichChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and pSG5HEGO as a template . .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    Article Title: Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism
    Article Snippet: DNA constructs Expression construct for TIA-1 was cloned form HeLa cell library and constructed as described earlier ( ). .. To create a construct for maltose-binding protein (MBP)-TIA-1 fusion protein production, TIA-1 cDNA was inserted into pMAL-c4x using EcoR1 and HindIII restriction sites and the ligated vector was transformed to OneShot Top10 chemically competent Escherichia coli cells (Invitrogen).

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The GeneSilencer shRNA vector contain the U6 RNA polymerase III promoter, allowing optimal expression of shRNA and a GFP reporter gene under the control of CMV promoter. .. The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies).

    Transformation Assay:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher). .. Twelve clones were sequenced and analyzed using Serial Cloner.

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: .. G418 resistant clones were scraped and pooled; DNA was prepared and transformed into OneShot TOP10 chemically competent bacteria (Life Technologies). .. Bacterial transformants were selected on LB-carbenicillin plates and analyzed by restriction digest to identify the repaired plasmid.

    Article Title: Arsenic induces structural and compositional colonic microbiome change and promotes host nitrogen and amino acid metabolism
    Article Snippet: .. The PCR products obtained from each of the sample were ligated into the pCR2.1®-TOPO vector and transformed into OneShot Top10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. Positive clones were picked randomly from each sample and used to inoculate 5 ml of LB broth containing ampicilllin.

    Article Title: The Bacillus anthracis Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ †
    Article Snippet: OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen) were used as the host for all of the cloning procedures. .. E. coli strain GM2163 (New England Biolabs) was used to obtain unmethylated plasmid DNA for transformation of B. anthracis .

    Article Title: Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism
    Article Snippet: .. To create a construct for maltose-binding protein (MBP)-TIA-1 fusion protein production, TIA-1 cDNA was inserted into pMAL-c4x using EcoR1 and HindIII restriction sites and the ligated vector was transformed to OneShot Top10 chemically competent Escherichia coli cells (Invitrogen). .. RNA probe preparation cDNA was used as a template for polymerase chain reaction (PCR) reactions whereby T7 RNA polymerase promoter sequence was added to the 5′-end of all fragments and a 30 bases long poly-A tail was included in the 3′-oligos for production of polyadenylated RNA probes for affinity purification.

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: .. PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions. .. Target plasmids were identified using PCR and isolated using the PureLink Quick Plasmid Miniprep Kit (Invitrogen).

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: .. The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies). .. Positive clones were identified by restriction enzymes analysis of purified plasmid and verified by DNA sequencing.

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen). .. Transformed cells were grown on LB agar plates containing 100 μg mL−1 ampicillin (selective for transformed cells containing a ligated vector).

    Over Expression:

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: Paragraph title: Construction of shRNA vectors and pCIG overexpression vectors. ... The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies).

    Electroporation:

    Article Title: Caulobacter crescentus as a Whole-Cell Uranium Biosensor ▿ as a Whole-Cell Uranium Biosensor ▿ †
    Article Snippet: .. OneShot Top10 chemically competent Escherichia coli and 0.1-cm electroporation cuvettes were purchased from Invitrogen (Carlsbad, CA). ..

    Ligation:

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: .. The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies). .. Positive clones were identified by restriction enzymes analysis of purified plasmid and verified by DNA sequencing.

    Serial Dilution:

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions. .. Reaction efficiencies were calculated from a standard curve created using a seven point 2X serial dilution of blood cDNA or plasmids containing the target.

    Multiple Displacement Amplification:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: PCR and clonal sequencing Genomic DNA from MDA-MB-231 TET1 CRISPR knockout cells was amplified using primers surrounding the gRNA target sequencing and Phusion High-Fidelity DNA polymerase (Neb). .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher).

    Generated:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: GENERATION OF msr1 KNOCKDOWN CELL LINE A panel of four 29‐mer short hairpin RNA (shRNA) plasmids targeted against the murine msr1 gene was generated by and obtained from OriGene (Rockville, MD). .. The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen).

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: For transient expression of wild-type ERα and 351 aspartate-to-glycine-substituted mutant ERα, pSG5HEGO and pSG5D351GER plasmids were used respectively. pSG5HEGO was originally provided by Professor Pierre Chambon, University of Strasbourg, France, and pSG5D351GER was generated using QuichChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and pSG5HEGO as a template . .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The pU6-Bclaf1 small hairpin RNA (shRNA) was generated by ligation of the following annealed oligonucleotides into the pGSU6 RNAi vector (Genlantis) according to the supplier's instructions: 5′-GatccGCAGCTTCCGGCGACATTTgaagcttgAAATGTCGCCGGAAGCTGCttttttggaagc-3′ and 5′-ggccgcttccaaaaaaGCAGCTTCCGGCGACATTTcaagcttcAAATGTCGCCGGAAGCTGCg-3′. .. The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies).

    Gel Extraction:

    Article Title: Caulobacter crescentus as a Whole-Cell Uranium Biosensor ▿ as a Whole-Cell Uranium Biosensor ▿ †
    Article Snippet: OneShot Top10 chemically competent Escherichia coli and 0.1-cm electroporation cuvettes were purchased from Invitrogen (Carlsbad, CA). .. DNA miniprep and gel extraction kits were purchased from Qiagen (Valencia, CA).

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: All bands of the appropriate size were excised from the gels and purified by adsorption to a silica matrix (QIAquick Gel Extraction Kit, Qiagen). .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions.

    DNA Sequencing:

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. The colony direct PCR assay was used to determine whether colonies included the correct PCR insert.

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies). .. Positive clones were identified by restriction enzymes analysis of purified plasmid and verified by DNA sequencing.

    Sequencing:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: Paragraph title: PCR and clonal sequencing ... Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher).

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. The colony direct PCR assay was used to determine whether colonies included the correct PCR insert.

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies). .. The rat Bclaf1 ( ) was cloned using the gateway technology (Life Technologies) into a pCIG-eGFP vector that contained an internal ribosome entry site sequence to generate enhanced green fluorescent protein (eGFP) under the control of the same β-actin promoter ( ).

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen). .. Transformed cells were grown on LB agar plates containing 100 μg mL−1 ampicillin (selective for transformed cells containing a ligated vector).

    Mutagenesis:

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: For transient expression of wild-type ERα and 351 aspartate-to-glycine-substituted mutant ERα, pSG5HEGO and pSG5D351GER plasmids were used respectively. pSG5HEGO was originally provided by Professor Pierre Chambon, University of Strasbourg, France, and pSG5D351GER was generated using QuichChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and pSG5HEGO as a template . .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA).

    Article Title: The Bacillus anthracis Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ †
    Article Snippet: Plasmid pTV1-OK ( ) was used for Tn 917 transposon mutagenesis in B. anthracis ΔANR, and pCN55 ( ) was the backbone plasmid for the construction of p mprF used for complementation. .. OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen) were used as the host for all of the cloning procedures.

    Isolation:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: .. The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen). .. Transduced RAW cells were isolated by puromycin selection and diluted to a single‐cell suspension before subculturing.

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions. .. Target plasmids were identified using PCR and isolated using the PureLink Quick Plasmid Miniprep Kit (Invitrogen).

    Purification:

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. MCF-7:WS8 cells were cultured in estrogen-free RPMI media for 24 h prior to transfection.

    Article Title: Arsenic induces structural and compositional colonic microbiome change and promotes host nitrogen and amino acid metabolism
    Article Snippet: The PCR products obtained from each of the sample were ligated into the pCR2.1®-TOPO vector and transformed into OneShot Top10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. Plasmid extraction from the liquid cultures was performed using the Wizard SV DNA column purification kit (Promega, Madison WI), and the inserts sequenced using M13 forward and reverse primers at the Genomics and Proteomics Core Laboratory, University of Pittsburgh, PA using a ABI 3730 sequencer (Applied Biosystems, Foster City, CA, USA).

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: All bands of the appropriate size were excised from the gels and purified by adsorption to a silica matrix (QIAquick Gel Extraction Kit, Qiagen). .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions.

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies). .. Positive clones were identified by restriction enzymes analysis of purified plasmid and verified by DNA sequencing.

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: Briefly, RNA was reverse transcribed using the SMARTer™ cDNA RACE Kit (Clontech Laboratories, Inc, Mountain View, CA, USA) and then purified using the Wizard® SV gel and PCR Clean‐Up System (Promega, Madison, WI, USA) according to manufacturers' instructions. .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher). .. Twelve clones were sequenced and analyzed using Serial Cloner.

    Article Title: Arsenic induces structural and compositional colonic microbiome change and promotes host nitrogen and amino acid metabolism
    Article Snippet: .. The PCR products obtained from each of the sample were ligated into the pCR2.1®-TOPO vector and transformed into OneShot Top10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. Positive clones were picked randomly from each sample and used to inoculate 5 ml of LB broth containing ampicilllin.

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: .. PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions. .. Target plasmids were identified using PCR and isolated using the PureLink Quick Plasmid Miniprep Kit (Invitrogen).

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. The colony direct PCR assay was used to determine whether colonies included the correct PCR insert.

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen). .. Transformed cells were grown on LB agar plates containing 100 μg mL−1 ampicillin (selective for transformed cells containing a ligated vector).

    shRNA:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: Each of the four anti‐msr 1 shRNA plasmids and the scramble control plasmid were packaged into lentiviral particles and transduced into RAW 264.7 cells following the manufacturer's instructions. .. The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen).

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: Paragraph title: Construction of shRNA vectors and pCIG overexpression vectors. ... The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies).

    Quantitative RT-PCR:

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: Paragraph title: qRT-PCR ... PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions.

    CRISPR:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: PCR and clonal sequencing Genomic DNA from MDA-MB-231 TET1 CRISPR knockout cells was amplified using primers surrounding the gRNA target sequencing and Phusion High-Fidelity DNA polymerase (Neb). .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher).

    Rapid Amplification of cDNA Ends:

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: T‐cell receptor clonotypes were analysed using 5′ Rapid Amplification of cDNA Ends (RACE) PCR (Clontech), as previously described. .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen).

    Plasmid Preparation:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: .. The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen). .. Transduced RAW cells were isolated by puromycin selection and diluted to a single‐cell suspension before subculturing.

    Article Title: Structure Function Relationships of Estrogenic Triphenylethylenes Related to Endoxifen and 4-Hydroxytamoxifen
    Article Snippet: .. All plasmids for this study were purified using HiSpeed Plasmid Maxi Kit (Qiagen, Valencia, CA, USA), and were grown via OneShot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. MCF-7:WS8 cells were cultured in estrogen-free RPMI media for 24 h prior to transfection.

    Article Title: Arsenic induces structural and compositional colonic microbiome change and promotes host nitrogen and amino acid metabolism
    Article Snippet: .. The PCR products obtained from each of the sample were ligated into the pCR2.1®-TOPO vector and transformed into OneShot Top10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA, USA). .. Positive clones were picked randomly from each sample and used to inoculate 5 ml of LB broth containing ampicilllin.

    Article Title: The Bacillus anthracis Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ †
    Article Snippet: Plasmid pTV1-OK ( ) was used for Tn 917 transposon mutagenesis in B. anthracis ΔANR, and pCN55 ( ) was the backbone plasmid for the construction of p mprF used for complementation. .. OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen) were used as the host for all of the cloning procedures.

    Article Title: Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism
    Article Snippet: .. To create a construct for maltose-binding protein (MBP)-TIA-1 fusion protein production, TIA-1 cDNA was inserted into pMAL-c4x using EcoR1 and HindIII restriction sites and the ligated vector was transformed to OneShot Top10 chemically competent Escherichia coli cells (Invitrogen). .. RNA probe preparation cDNA was used as a template for polymerase chain reaction (PCR) reactions whereby T7 RNA polymerase promoter sequence was added to the 5′-end of all fragments and a 30 bases long poly-A tail was included in the 3′-oligos for production of polyadenylated RNA probes for affinity purification.

    Article Title: An Intronic SINE Insertion in FAM161A that Causes Exon-Skipping Is Associated with Progressive Retinal Atrophy in Tibetan Spaniels and Tibetan Terriers
    Article Snippet: .. PCR products were ligated into pCR2.1 plasmid vector and transformed into OneShot TOP10 Chemically Competent E.coli , both part of the TA Cloning Kit (Invitrogen), according to the manufacturer's instructions. .. Target plasmids were identified using PCR and isolated using the PureLink Quick Plasmid Miniprep Kit (Invitrogen).

    Article Title: Involvement of Bcl-2-Associated Transcription Factor 1 in the Differentiation of Early-Born Retinal Cells
    Article Snippet: The GeneSilencer shRNA vector contain the U6 RNA polymerase III promoter, allowing optimal expression of shRNA and a GFP reporter gene under the control of CMV promoter. .. The ligation product was transformed into OneShot TOP10 chemically competent Escherichia coli cells (Life Technologies).

    Article Title: Circulating gluten‐specific, but not CMV‐specific, CD39+ regulatory T cells have an oligoclonal TCR repertoire
    Article Snippet: .. Gel‐purified TRBV DNA was ligated by TA cloning into the pCR® 4‐TOPO® vector, using the TOPO TA Cloning® Kit for Sequencing (Invitrogen) and transformed into OneShot® TOP10 Chemically Competent Escherichia coli (Invitrogen). .. Transformed cells were grown on LB agar plates containing 100 μg mL−1 ampicillin (selective for transformed cells containing a ligated vector).

    Software:

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. .. Sequences were analyzed with the ImMunoGeneTics V-Quest (IMGT V-QUEST) software ( http://www.imgt.org ).

    Selection:

    Article Title: Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis
    Article Snippet: The packaging plasmids, ENV pCMV‐VSVG, pRSV‐REV, and Gag/Pol pMDLg/pRRE, were kindly provided by Dr. Tim Bender (University of Virginia), amplified using OneShot TOP10 chemically competent Escherichia coli (Invitrogen, Carlsbad, CA), and isolated using an Endotoxin‐Free Plasmid Maxi Kit (Qiagen). .. Transduced RAW cells were isolated by puromycin selection and diluted to a single‐cell suspension before subculturing.

    Agarose Gel Electrophoresis:

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions.

    Knock-Out:

    Article Title: A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
    Article Snippet: PCR and clonal sequencing Genomic DNA from MDA-MB-231 TET1 CRISPR knockout cells was amplified using primers surrounding the gRNA target sequencing and Phusion High-Fidelity DNA polymerase (Neb). .. Amplified PCR products were cloned into the Zero Blunt TOPO pCR4 system and OneShot Top10 chemically competent Escherichia coli were transformed following the manufacturer’s protocol. (ThermoFisher).

    Article Title: The Bacillus anthracis Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ Protein MprF Is Required for Synthesis of Lysylphosphatidylglycerols and for Resistance to Cationic Antimicrobial Peptides ▿ †
    Article Snippet: B. anthracis Sterne 34F2 strain (pXO1+ , pXO2− ) was the parental strain used for the construction of a clean knockout mutant strain. .. OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen) were used as the host for all of the cloning procedures.

    Concentration Assay:

    Article Title: High-throughput Tetrad Analysis
    Article Snippet: G418 resistant clones were scraped and pooled; DNA was prepared and transformed into OneShot TOP10 chemically competent bacteria (Life Technologies). .. Next, a complex library of random barcodes was inserted as follows: 20 nmoles of a 200-mer oligo , including a high complexity 15-base degenerate region, was amplified by 20 rounds of PCR using Phusion High-Fidelity DNA Polymerase (Thermo Fisher) with BC_F and BC_R primers ( ) at a final concentration of 20 pM each.

    Staining:

    Article Title: Biased Use of the IGHV4 Family and Evidence for Antigen Selection in Chlamydophila psittaci-Negative Ocular Adnexal Extranodal Marginal Zone Lymphomas
    Article Snippet: PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. .. If a direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned using a TOPO TA cloning kit and OneShot TOP10' chemically competent E. coli cells (Invitrogen, Carlsbad, CA) according to the manufacturer instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher top10 oneshot e coli cells
    Top10 Oneshot E Coli Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/top10 oneshot e coli cells/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    top10 oneshot e coli cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher oneshot top10
    Oneshot Top10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oneshot top10/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    oneshot top10 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    91
    Thermo Fisher oneshot top10 competent cells
    Oneshot Top10 Competent Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oneshot top10 competent cells/product/Thermo Fisher
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oneshot top10 competent cells - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    Image Search Results