one shot omnimax 2 t1r  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    One Shot OmniMAX 2 T1R Chemically Competent E coli
    Description:
    The One Shot OmniMAX 2 T1R E coli strain is an improved chemically competent cell line perfect for use in all cloning applications including the Gateway technology OmniMAX 2 T1R cells offer the highest transformation efficiency of any chemically competent cells in a One Shot format with 5 x 109 transformants µg pUC19 They also provide efficient transformation of highly methylated DNA since OmniMAX 2 T1R cells lack the E coli K12 restriction systems mcrA Δ mrr hsdRMS mcrBC In addition the strain carries the tonA genotype which confers resistance to T1 and T5 phage infection This protects your samples and minimizes the possibility of downtime in your lab due to phage contamination The highly versatile OmniMAX 2 T1R strain offers the following benefits • Ideal for transformation of Gateway and TOPO reactions• Resistance to T1 and T5 phage tonA • Construction of more representative genomic libraries due to the elimination of mcrA mcrBC mrr and hsdRMS• Blue white screening of recombinant clones lacZΔM15 Genotype F proAB lacIq lacZΔM15 Tn10 TetR Δ ccdAB mcrA Δ mrr hsdRMS mcrBC Φ 80 lacZ ΔM15 Δ lacZYA argF U169 endA1 recA1 supE44 thi 1 gyrA96 relA1 tonA panD
    Catalog Number:
    c854003
    Price:
    None
    Applications:
    Chemically Competent Cells for Cloning|Cloning|Transformation
    Category:
    Competent Cells Strains
    Buy from Supplier


    Structured Review

    Thermo Fisher one shot omnimax 2 t1r
    The One Shot OmniMAX 2 T1R E coli strain is an improved chemically competent cell line perfect for use in all cloning applications including the Gateway technology OmniMAX 2 T1R cells offer the highest transformation efficiency of any chemically competent cells in a One Shot format with 5 x 109 transformants µg pUC19 They also provide efficient transformation of highly methylated DNA since OmniMAX 2 T1R cells lack the E coli K12 restriction systems mcrA Δ mrr hsdRMS mcrBC In addition the strain carries the tonA genotype which confers resistance to T1 and T5 phage infection This protects your samples and minimizes the possibility of downtime in your lab due to phage contamination The highly versatile OmniMAX 2 T1R strain offers the following benefits • Ideal for transformation of Gateway and TOPO reactions• Resistance to T1 and T5 phage tonA • Construction of more representative genomic libraries due to the elimination of mcrA mcrBC mrr and hsdRMS• Blue white screening of recombinant clones lacZΔM15 Genotype F proAB lacIq lacZΔM15 Tn10 TetR Δ ccdAB mcrA Δ mrr hsdRMS mcrBC Φ 80 lacZ ΔM15 Δ lacZYA argF U169 endA1 recA1 supE44 thi 1 gyrA96 relA1 tonA panD
    https://www.bioz.com/result/one shot omnimax 2 t1r/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    one shot omnimax 2 t1r - by Bioz Stars, 2020-08
    93/100 stars

    Related Products / Commonly Used Together

    competent escherichia coli

    Images

    Related Articles

    Clone Assay:

    Article Title: Beyond Helper Phage: Using "Helper Cells" to Select Peptide Affinity Ligands
    Article Snippet: .. Extensive characterization of helper cells derived from various combinations of helper plasmids and E . coli strains ( ) led us to choose the high transformation efficiency cell line SS320-M13cp for cloning and production of primary libraries, and the high infectability and high phage-producing cell lines OmniMAX (Invitrogen F’ cell line #C854003) -M13cp-CT and XL1-blue-M13-DG3 for production of secondary libraries as well as amplification during panning ( ). .. As part of our thorough characterization of helper cells, we investigated if helper cells could be used to create scFv library uncontaminated with helper phage by transforming our primary phagemid antibody library into the M13cp cells and using the phagemid particles obtained to infect M13cp-CT derivatives of cre recombinase expressing cells, and subsequently M13cp-CT DH5alpha (Invitrogen F’ cell line #18288019) to produce the scFv display library.

    Amplification:

    Article Title: Beyond Helper Phage: Using "Helper Cells" to Select Peptide Affinity Ligands
    Article Snippet: .. Extensive characterization of helper cells derived from various combinations of helper plasmids and E . coli strains ( ) led us to choose the high transformation efficiency cell line SS320-M13cp for cloning and production of primary libraries, and the high infectability and high phage-producing cell lines OmniMAX (Invitrogen F’ cell line #C854003) -M13cp-CT and XL1-blue-M13-DG3 for production of secondary libraries as well as amplification during panning ( ). .. As part of our thorough characterization of helper cells, we investigated if helper cells could be used to create scFv library uncontaminated with helper phage by transforming our primary phagemid antibody library into the M13cp cells and using the phagemid particles obtained to infect M13cp-CT derivatives of cre recombinase expressing cells, and subsequently M13cp-CT DH5alpha (Invitrogen F’ cell line #18288019) to produce the scFv display library.

    Ligation:

    Article Title: A Luciferase Immunoprecipitation System (LIPS) Assay for Profiling Human Norovirus Antibodies
    Article Snippet: .. The ligation mixtures were used to transform One Shot® OmniMAX™ 2 T1R Chemically Competent E. coli cells (Thermo Fisher Scientific), and transformed cells were plated on LB agar plates with 50 μg/mL kanamycin at 37°C overnight. ..

    Article Title: The Self-Identity Protein IdsD Is Communicated between Cells in Swarming Proteus mirabilis Colonies
    Article Snippet: .. Ligation products were transformed into One Shot OmniMax 2 T1R chemically competent Escherichia coli (Thermo Fisher Scientific, Waltham, MA). .. Oligonucleotides were synthesized by Integrated DNA Technologies, Inc., and DNA sequencing was performed by Genewiz (South Plainfield, NJ).

    Mutagenesis:

    Article Title: ULK1 inhibits mTORC1 signaling, promotes multisite Raptor phosphorylation and hinders substrate binding
    Article Snippet: .. The Rheb Q64L mutation was introduced by site-directed mutagenesis using Phusion polymerase (Finnzymes, F-530S) for the PCR reaction and transformation into Omnimax 2-T1 cells (Invitrogen, C854003). .. ULK1 and ULK2 were subcloned from IMAGE clones 3526749 and 5268025 (Source Bioscience LifeSciences), respectively, into pcDNA3.1/nV5-DEST using the Gateway system (Invitrogen, 12290-010).

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Sequencing:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Plasmid Preparation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Cytokine exocytosis and JAK/STAT activation in the Drosophila ovary requires the vesicle trafficking regulator α-Snap
    Article Snippet: .. The BP reaction was carried out using a pDNOR221 vector (Invitrogen, 12536-017) and Gateway BP Clonase II enzyme mix (Invitrogen, 11789020) followed by heat shock-induced transformation into One Shot OmniMax 2T1 competent E. coli cells (Invitrogen, C854003). .. Successful cloning of α-Snap into pDONR221 was confirmed by sequencing using M13F(-21) and M13R primers (Genewiz).

    Polymerase Chain Reaction:

    Article Title: ULK1 inhibits mTORC1 signaling, promotes multisite Raptor phosphorylation and hinders substrate binding
    Article Snippet: .. The Rheb Q64L mutation was introduced by site-directed mutagenesis using Phusion polymerase (Finnzymes, F-530S) for the PCR reaction and transformation into Omnimax 2-T1 cells (Invitrogen, C854003). .. ULK1 and ULK2 were subcloned from IMAGE clones 3526749 and 5268025 (Source Bioscience LifeSciences), respectively, into pcDNA3.1/nV5-DEST using the Gateway system (Invitrogen, 12290-010).

    Transformation Assay:

    Article Title: Beyond Helper Phage: Using "Helper Cells" to Select Peptide Affinity Ligands
    Article Snippet: .. Extensive characterization of helper cells derived from various combinations of helper plasmids and E . coli strains ( ) led us to choose the high transformation efficiency cell line SS320-M13cp for cloning and production of primary libraries, and the high infectability and high phage-producing cell lines OmniMAX (Invitrogen F’ cell line #C854003) -M13cp-CT and XL1-blue-M13-DG3 for production of secondary libraries as well as amplification during panning ( ). .. As part of our thorough characterization of helper cells, we investigated if helper cells could be used to create scFv library uncontaminated with helper phage by transforming our primary phagemid antibody library into the M13cp cells and using the phagemid particles obtained to infect M13cp-CT derivatives of cre recombinase expressing cells, and subsequently M13cp-CT DH5alpha (Invitrogen F’ cell line #18288019) to produce the scFv display library.

    Article Title: A Luciferase Immunoprecipitation System (LIPS) Assay for Profiling Human Norovirus Antibodies
    Article Snippet: .. The ligation mixtures were used to transform One Shot® OmniMAX™ 2 T1R Chemically Competent E. coli cells (Thermo Fisher Scientific), and transformed cells were plated on LB agar plates with 50 μg/mL kanamycin at 37°C overnight. ..

    Article Title: Cytokine exocytosis and JAK/STAT activation in the Drosophila ovary requires the vesicle trafficking regulator α-Snap
    Article Snippet: .. The BP reaction was carried out using a pDNOR221 vector (Invitrogen, 12536-017) and Gateway BP Clonase II enzyme mix (Invitrogen, 11789020) followed by heat shock-induced transformation into One Shot OmniMax 2T1 competent E. coli cells (Invitrogen, C854003). .. Successful cloning of α-Snap into pDONR221 was confirmed by sequencing using M13F(-21) and M13R primers (Genewiz).

    Article Title: ULK1 inhibits mTORC1 signaling, promotes multisite Raptor phosphorylation and hinders substrate binding
    Article Snippet: .. The Rheb Q64L mutation was introduced by site-directed mutagenesis using Phusion polymerase (Finnzymes, F-530S) for the PCR reaction and transformation into Omnimax 2-T1 cells (Invitrogen, C854003). .. ULK1 and ULK2 were subcloned from IMAGE clones 3526749 and 5268025 (Source Bioscience LifeSciences), respectively, into pcDNA3.1/nV5-DEST using the Gateway system (Invitrogen, 12290-010).

    Article Title: The Self-Identity Protein IdsD Is Communicated between Cells in Swarming Proteus mirabilis Colonies
    Article Snippet: .. Ligation products were transformed into One Shot OmniMax 2 T1R chemically competent Escherichia coli (Thermo Fisher Scientific, Waltham, MA). .. Oligonucleotides were synthesized by Integrated DNA Technologies, Inc., and DNA sequencing was performed by Genewiz (South Plainfield, NJ).

    Derivative Assay:

    Article Title: Beyond Helper Phage: Using "Helper Cells" to Select Peptide Affinity Ligands
    Article Snippet: .. Extensive characterization of helper cells derived from various combinations of helper plasmids and E . coli strains ( ) led us to choose the high transformation efficiency cell line SS320-M13cp for cloning and production of primary libraries, and the high infectability and high phage-producing cell lines OmniMAX (Invitrogen F’ cell line #C854003) -M13cp-CT and XL1-blue-M13-DG3 for production of secondary libraries as well as amplification during panning ( ). .. As part of our thorough characterization of helper cells, we investigated if helper cells could be used to create scFv library uncontaminated with helper phage by transforming our primary phagemid antibody library into the M13cp cells and using the phagemid particles obtained to infect M13cp-CT derivatives of cre recombinase expressing cells, and subsequently M13cp-CT DH5alpha (Invitrogen F’ cell line #18288019) to produce the scFv display library.

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher one shot omnimax 2 t1r chemically competent e coli
    One Shot Omnimax 2 T1r Chemically Competent E Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one shot omnimax 2 t1r chemically competent e coli/product/Thermo Fisher
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    one shot omnimax 2 t1r chemically competent e coli - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    Image Search Results