oligos  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Oligo d T 18 no 5 Phosphate
    Description:
    Oligo d T 18 no 5 Phosphate 5 0 A260 units
    Catalog Number:
    s1316s
    Price:
    93
    Size:
    5 0 A260 units
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs oligos
    Oligo d T 18 no 5 Phosphate
    Oligo d T 18 no 5 Phosphate 5 0 A260 units
    https://www.bioz.com/result/oligos/product/New England Biolabs
    Average 95 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Molecular Factors Affecting the Accumulation of Recombinant Proteins in the Chlamydomonas reinhardtii Chloroplast"

    Article Title: Molecular Factors Affecting the Accumulation of Recombinant Proteins in the Chlamydomonas reinhardtii Chloroplast

    Journal: Molecular Biotechnology

    doi: 10.1007/s12033-010-9348-4

    Toeprint analyses of translation initiation complexes on atpA and atpA – gfp RNAs. In vitro transcribed atpA – atpA ( left panels ) and atpA – gfp ( right panels ) RNAs (20 nM) were extended from [γ- 32 P] ATP-labeled oligos that anneal 120-nt downstream of the initiator AUGs, either alone or in the presence of tRNA Met , 30S subunit or both. Sequencing reactions were run alongside. The treatments are indicated at the top of each panel. The positions of the toeprints respective to the initiator AUG (+1) are indicated with lines on the side. a Toeprint reactions using 100-nM 30S subunit, b Inset showing the toeprint area of experiments similar to ( a ) with 200-nM 30S subunit. The figure shows representative autoradiographs obtained from three independent experiments
    Figure Legend Snippet: Toeprint analyses of translation initiation complexes on atpA and atpA – gfp RNAs. In vitro transcribed atpA – atpA ( left panels ) and atpA – gfp ( right panels ) RNAs (20 nM) were extended from [γ- 32 P] ATP-labeled oligos that anneal 120-nt downstream of the initiator AUGs, either alone or in the presence of tRNA Met , 30S subunit or both. Sequencing reactions were run alongside. The treatments are indicated at the top of each panel. The positions of the toeprints respective to the initiator AUG (+1) are indicated with lines on the side. a Toeprint reactions using 100-nM 30S subunit, b Inset showing the toeprint area of experiments similar to ( a ) with 200-nM 30S subunit. The figure shows representative autoradiographs obtained from three independent experiments

    Techniques Used: In Vitro, Labeling, Sequencing

    2) Product Images from "Multimerization Domains are Associated with Apparent Strand Exchange Activity in BLM and WRN DNA helicases"

    Article Title: Multimerization Domains are Associated with Apparent Strand Exchange Activity in BLM and WRN DNA helicases

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2014.07.015

    Characterization of apparent DNA strand exchange activity in SA proteins. (A) The reaction illustrated at the top of the panel was performed using a 32 bp radiolabeled dsDNA with flush ends as donor (oligos #4*/#5) and an unlabeled 57 nt oligo (#6) as recipient. Reactions containing 5 nM donor and 20 nM recipient were initiated by addition of the indicated concentrations of Rad52N, Sgs1 103–322 , or Rad59. Following incubation at 37°C for 30 min, the reactions were terminated and the products analyzed by 10% native PAGE and phosphorimaging. ( B ) SE reactions were carried out as in (A) except that aliquots of the reactions were removed at the indicated times and treated as above. ( C ) SE reactions were performed with Rad52 mutants. ( D ) SE assays were performed with sub-domains of WRN 235–526 .
    Figure Legend Snippet: Characterization of apparent DNA strand exchange activity in SA proteins. (A) The reaction illustrated at the top of the panel was performed using a 32 bp radiolabeled dsDNA with flush ends as donor (oligos #4*/#5) and an unlabeled 57 nt oligo (#6) as recipient. Reactions containing 5 nM donor and 20 nM recipient were initiated by addition of the indicated concentrations of Rad52N, Sgs1 103–322 , or Rad59. Following incubation at 37°C for 30 min, the reactions were terminated and the products analyzed by 10% native PAGE and phosphorimaging. ( B ) SE reactions were carried out as in (A) except that aliquots of the reactions were removed at the indicated times and treated as above. ( C ) SE reactions were performed with Rad52 mutants. ( D ) SE assays were performed with sub-domains of WRN 235–526 .

    Techniques Used: Activity Assay, Incubation, Clear Native PAGE

    3) Product Images from "Action of CMG with strand-specific DNA blocks supports an internal unwinding mode for the eukaryotic replicative helicase"

    Article Title: Action of CMG with strand-specific DNA blocks supports an internal unwinding mode for the eukaryotic replicative helicase

    Journal: eLife

    doi: 10.7554/eLife.23449

    Substrate single strands do not spontaneously reanneal at 30˚C. To determine whether unwound substrate oligos spontaneously reanneal under our reaction conditions, we mixed 0.5 nM final concentration of radiolabeled 50duplex LAG oligo ( Table 1 ) with 0.5 nM unlabeled 50 duplex LEAD oligo under reaction conditions identical to those of Figure 3 in a total reaction volume of 55 μl. Complete reactions were mixed on ice and started by incubating at 30°C. At the indicated time points, 10 μl aliquots were removed and flash frozen in liquid nitrogen. Lack of re-annealing of the unwound strands allowed us to perform unwinding reactions in Figure 3 and subsequent Figures in the absence of a trap, eliminating potential side interactions between CMG and the unlabeled trap DNA. DOI: http://dx.doi.org/10.7554/eLife.23449.010
    Figure Legend Snippet: Substrate single strands do not spontaneously reanneal at 30˚C. To determine whether unwound substrate oligos spontaneously reanneal under our reaction conditions, we mixed 0.5 nM final concentration of radiolabeled 50duplex LAG oligo ( Table 1 ) with 0.5 nM unlabeled 50 duplex LEAD oligo under reaction conditions identical to those of Figure 3 in a total reaction volume of 55 μl. Complete reactions were mixed on ice and started by incubating at 30°C. At the indicated time points, 10 μl aliquots were removed and flash frozen in liquid nitrogen. Lack of re-annealing of the unwound strands allowed us to perform unwinding reactions in Figure 3 and subsequent Figures in the absence of a trap, eliminating potential side interactions between CMG and the unlabeled trap DNA. DOI: http://dx.doi.org/10.7554/eLife.23449.010

    Techniques Used: Concentration Assay

    CMG requires a 3’ dT 40 /ssDNA tail for loading. . ( A ) Schematic of the substrates used in Figure 2 and in part ( B ) of this Figure. Further details on the oligos used are in Table 1 . The flush duplex oligo is named ‘flush duplex LAG’. The 5’ tailed oligo is ‘50duplex LAG’. The leading strand template is either ‘Paired duplex LEAD + 3’ tail’ or ‘Paired duplex LEAD no 3’ tail’. ( B ) Control experiments to show the requirement for the 3’ dT 40 tail in CMG loading. At left are two helicase assays like those described in Figure 2 but using the substrate containing a 3’ dT 40 tail with the radiolabel on the 5’ tailed duplex. Lanes 1–4 show unwinding in the absence of the flush duplex oligo and lanes 5–8 in the presence of the flush duplex. The % of 5’ tailed oligo unwound is quantified in the graph below the gels, showing that the presence of the flush duplex oligo does not affect CMG loading or unwinding. At right is an identical pair of experiments but with a substrate that does not contain the 3’ dT 40 tail. Lanes 9–12 and the quantitation in the graph below show that unwinding is greatly reduced in the absence of the 3’ tail (compare lanes 9–12 with lanes 1–4), and in the presence of the flush duplex oligo (lanes 13–16) CMG does not load/unwind at all. These experiments support the conclusion of Figure 2 that CMG translocates over flush duplex without unwinding and requires a 3’ dT 40 tail for efficient loading. DOI: http://dx.doi.org/10.7554/eLife.23449.004
    Figure Legend Snippet: CMG requires a 3’ dT 40 /ssDNA tail for loading. . ( A ) Schematic of the substrates used in Figure 2 and in part ( B ) of this Figure. Further details on the oligos used are in Table 1 . The flush duplex oligo is named ‘flush duplex LAG’. The 5’ tailed oligo is ‘50duplex LAG’. The leading strand template is either ‘Paired duplex LEAD + 3’ tail’ or ‘Paired duplex LEAD no 3’ tail’. ( B ) Control experiments to show the requirement for the 3’ dT 40 tail in CMG loading. At left are two helicase assays like those described in Figure 2 but using the substrate containing a 3’ dT 40 tail with the radiolabel on the 5’ tailed duplex. Lanes 1–4 show unwinding in the absence of the flush duplex oligo and lanes 5–8 in the presence of the flush duplex. The % of 5’ tailed oligo unwound is quantified in the graph below the gels, showing that the presence of the flush duplex oligo does not affect CMG loading or unwinding. At right is an identical pair of experiments but with a substrate that does not contain the 3’ dT 40 tail. Lanes 9–12 and the quantitation in the graph below show that unwinding is greatly reduced in the absence of the 3’ tail (compare lanes 9–12 with lanes 1–4), and in the presence of the flush duplex oligo (lanes 13–16) CMG does not load/unwind at all. These experiments support the conclusion of Figure 2 that CMG translocates over flush duplex without unwinding and requires a 3’ dT 40 tail for efficient loading. DOI: http://dx.doi.org/10.7554/eLife.23449.004

    Techniques Used: Quantitation Assay

    Schematics of biotinylated DNA fork substrates. The fork substrates used in the experiments in Figures 3 – 6 are shown including the location of the biotinylated dT nucleotides in either the leading or lagging strand template. The oligos used to make the forked duplex substrates are indicated to the right of the schematics and the oligo sequences and modifications are in Table 1 . DOI: http://dx.doi.org/10.7554/eLife.23449.008
    Figure Legend Snippet: Schematics of biotinylated DNA fork substrates. The fork substrates used in the experiments in Figures 3 – 6 are shown including the location of the biotinylated dT nucleotides in either the leading or lagging strand template. The oligos used to make the forked duplex substrates are indicated to the right of the schematics and the oligo sequences and modifications are in Table 1 . DOI: http://dx.doi.org/10.7554/eLife.23449.008

    Techniques Used:

    4) Product Images from "High Glucose–Induced Hypomethylation Promotes Binding of Sp-1 to Myo-Inositol Oxygenase"

    Article Title: High Glucose–Induced Hypomethylation Promotes Binding of Sp-1 to Myo-Inositol Oxygenase

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2016.12.011

    Identification of transcription factor specificity protein (Sp)-1–binding site in the human MIOX promoter and effect of in vitro methylation on the binding with nucleoproteins. Eletrophoretic mobility shift assays using Sp-1 and differentially methylated segment (DMS) oligos (DMS1 includes CpG sites -784 and -787 and DMS2 includes -581). A: An increased binding of Sp-1 is observed under high-glucose ambience (30 mmol/L) when the Sp-1 oligo is differentially demethylated or unmethylated ( arrowhead ). No binding of methylated or demethylated oligos is observed under low-glucose (5 mmol/L) ambience. B and C: Likewise an increased binding of unmethylated DMS1 and DMS2 oligos is observed under high-glucose ambience ( arrowhead ). The binding is also seen under low-glucose ambience; nevertheless, binding with unmethylated oligos (Sp-1, DMS1, and DMS2) under high-glucose ambience is much stronger. The arrows and asterisks indicate the nonspecific bands in the autoradiograms.
    Figure Legend Snippet: Identification of transcription factor specificity protein (Sp)-1–binding site in the human MIOX promoter and effect of in vitro methylation on the binding with nucleoproteins. Eletrophoretic mobility shift assays using Sp-1 and differentially methylated segment (DMS) oligos (DMS1 includes CpG sites -784 and -787 and DMS2 includes -581). A: An increased binding of Sp-1 is observed under high-glucose ambience (30 mmol/L) when the Sp-1 oligo is differentially demethylated or unmethylated ( arrowhead ). No binding of methylated or demethylated oligos is observed under low-glucose (5 mmol/L) ambience. B and C: Likewise an increased binding of unmethylated DMS1 and DMS2 oligos is observed under high-glucose ambience ( arrowhead ). The binding is also seen under low-glucose ambience; nevertheless, binding with unmethylated oligos (Sp-1, DMS1, and DMS2) under high-glucose ambience is much stronger. The arrows and asterisks indicate the nonspecific bands in the autoradiograms.

    Techniques Used: Binding Assay, In Vitro, Methylation, Mobility Shift

    Related Articles

    Clone Assay:

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. The PCR product (about 0.9 kb) obtained after 35 cycles of PCR on a Mastercycler personal cycler (Eppendorf) with proofreading DNA Polymerase Pfu Turbo (Stratagene) was cloned into the pBluescript SK+ vector (Stratagene) and sequenced using automated DNA sequencer (ABI PRISM 3130xl) according to the manufacturer's protocols.

    Centrifugation:

    Article Title: Myc/Max dependent intronic long antisense noncoding RNA, EVA1A-AS, suppresses the expression of Myc/Max dependent anti-proliferating gene EVA1A in a U2 dependent manner
    Article Snippet: After centrifugation, 10 units of Shortcut RNAse III (NEB) which specifically digests double-stranded RNA were added and incubated at 37 °C for 30 minutes. .. RNAs were then isolated using the ReliaPrep miRNA Cell and Tissue Miniprep System according to the manufacturer’s protocol. cDNA synthesis was carried out using ProtoScript II First Strand cDNA Synthesis Kit (NEB) and Oligo d(T)/ random primers mix (NEB).

    Amplification:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.6 mM MgCl2 , 0.4 mM dNTPs, 0.04 units of Taq DNA polymerase (Gibco-BRL) and 0.4 mM primers was incubated at 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles with a final extension at 72°C for 7 min. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. Partial cDNA of the nitrilase gene was amplified using the degenerate forward primer NITR_NTERMFW01, 5'-AAY GCI GAR CCI GGI TGG TTY GA-3', derived from the N-terminal fragment sequence NAEPGWFD of Aspergillus fumigatus nitrilases [GenBank: EDP55254 , XP_756085 ] and degenerate reverse primer NITR_INT2RE01, 5'-CAT RTA RTG ICC ICC RAA RTC IGC-3', derived from the internal peptide fragment sequence ADFGGHYM from the same A. fumigatus nitrilases.

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. For amplification, a cDNA aliquot in a volume of 12.5 µL containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.6 mM MgCl2 , 0.4 mM dNTPs, 0.04 units of Taq DNA polymerase (Gibco-BRL, Carlsbad, CA, USA), and 0.4 mM primers was incubated at 94°C for 4 min, 94°C for 15–50 s, 55°C for 30–50 s, and 72°C for 30–35 s for 35 cycles.

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. VH/VL amplicons were then extracted from the emulsions, amplified using nested PCR, and sequenced by 2x300 Illumina MiSeq.

    DNA Synthesis:

    Article Title: Genetic Basis of Melanin Pigmentation in Butterfly Wings
    Article Snippet: Two biological replicates were sampled for RNA-seq library construction from each developmental stage, resulting in 12 RNA-seq samples. butterfly wing. (A) The five developmental stages and two color regions sampled in this study (see Table S1 in Poly(A) RNA was isolated with Oligo d(T)25 beads (New England Biolabs, Beverly, MA) from 1 μg total RNA of each sample and fragmented to size ∼350–450 bp. .. First- and second-strand cDNA (complementary DNA) synthesis, end repair, 3′dA tailing, and adaptor ligation were performed using a NEBNext Ultra RNA library Prep kit for Illumina (New England Biolabs).

    Synthesized:

    Article Title: Distinct roles of light-activated channels TRP and TRPL in photoreceptors of Periplaneta americana
    Article Snippet: RNAi dsRNA was synthesized and injected (4–5 µg in 1 µl Ringer solution) into the head tissue under CO2 anesthesia as described previously ( ; ). .. In brief, reverse transcription was performed using total RNA extracted from cockroach retinas and oligo d(T)23 VN primers with ProtoScript II reverse transcription (New England Biolabs, Inc.).

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK). .. The digested-cDNA was ligated to Illumina specific adapters 1 and 2.

    Cell Isolation:

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: VH/VL Sequencing Total B cells were isolated from PBMCs using the Human Memory B Cell Isolation Kit (Miltenyi Biotec) with an LD column according to the manufacturer’s instructions. .. B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ).

    Quantitative RT-PCR:

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: .. Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Paragraph title: Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (Real-Time RT-qPCR) ... Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C.

    Article Title: MicroRNA Dynamics and Functions During Arabidopsis Embryogenesis
    Article Snippet: Paragraph title: qRT-PCR Analysis ... Two-hundred nanograms of total RNA samples with RNA Quality Number values > 6.0 were used for cDNA synthesis together with the Oligo d(T)18 mRNA Primer (New England Biolabs) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific).

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. The magnetic beads were washed, resuspended in One step fast qRT-PCR solution (VWR) supplemented with an overlap extension VH and VL primer set as described , emulsified, and subjected to overlap-extension RT-PCR under the following conditions: 30 min at 55°C followed by 2 min at 94°C; 4 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 2 min; 4 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min; 32 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; 72°C for 7 min; hold at 4°C.

    Real-time Polymerase Chain Reaction:

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. .. RT-qPCR reactions were prepared with a Brilliant II SYBR Green qPCR Master Mix kit (Agilent Technologies, Santa Clara, CA, USA) in a final volume of 20 μL containing 2 μL cDNA and the following sets of primers (500 nM each): Cx26, sense 5′-TTG CTC AGG GAA GTC CAA AAG ACC-3′ and antisense 5′-TGG GCC TTT GTT TGG GAG CTT T-3′ (expected product of 231 bp); Cx30, sense 5′-GTG AAC AAG CAC TCG ACC AGC ATA-3′ and antisense 5′-GCG GAT AAA CTT TCG GGC AGT TTC-3′ (expected product of 288 bp); Cx43, sense 5′-TGG GTA CAA GCT GGT TAC TGG TGA-3′ and antisense 5′-TGG CTA ATG GCT GGA GTT CAT GTC-3′ (expected product of 221 bp); and cyclophilin, sense 5′-ATA ATG GCA CTG GTG GCA AGT C-3′ and antisense 5′-ATT CCT GGA CCC AAA ACG CTC C-3′ (expected product of 239 bp); Cx45, sense 5′-AAA GAG CAG AGC CAA CCA-3′ and antisense 5′-CCA AAC CCT AAG TGA AGC-3′ (expected product of 311 bp); Px1, sense 5′-TTC TTC CCC TAC ATC CTG CT-3′ and antisense 5′-GGT CCA TCT CTC AGG TCC AA-3′ (expected product of 185 bp), Px2, sense 5′-TGG ACA TCG TAT TGC TCT GC-3′ and antisense 5′-CCA CGT TGT CGT ACA TGA GG-3′ (expected product of 258 bp).

    Incubation:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: .. For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. ..

    Article Title: Pharmacologic reversion of epigenetic silencing of the PRKD1 promoter blocks breast tumor cell invasion and metastasis
    Article Snippet: .. For the transcription reaction, 1 μg of oligo d(T)18 primer (New England Biolabs, Beverly, MA, USA) and 1 μg of RNA were incubated in a total volume of 10 μl at 70°C for 10 min. Next, 5× buffer, 40 U of RNAsin Plus RNase Inhibitor (Promega), 200 μM deoxyribonucleotide triphosphate (New England Biolabs) and 1 μl of ImProm-II reverse transcriptase (Promega) were added to a total volume of 20 μl. ..

    Article Title: Myc/Max dependent intronic long antisense noncoding RNA, EVA1A-AS, suppresses the expression of Myc/Max dependent anti-proliferating gene EVA1A in a U2 dependent manner
    Article Snippet: After centrifugation, 10 units of Shortcut RNAse III (NEB) which specifically digests double-stranded RNA were added and incubated at 37 °C for 30 minutes. .. RNAs were then isolated using the ReliaPrep miRNA Cell and Tissue Miniprep System according to the manufacturer’s protocol. cDNA synthesis was carried out using ProtoScript II First Strand cDNA Synthesis Kit (NEB) and Oligo d(T)/ random primers mix (NEB).

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: .. For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. ..

    Immunocytochemistry:

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. Partial cDNA of the nitrilase gene was amplified using the degenerate forward primer NITR_NTERMFW01, 5'-AAY GCI GAR CCI GGI TGG TTY GA-3', derived from the N-terminal fragment sequence NAEPGWFD of Aspergillus fumigatus nitrilases [GenBank: EDP55254 , XP_756085 ] and degenerate reverse primer NITR_INT2RE01, 5'-CAT RTA RTG ICC ICC RAA RTC IGC-3', derived from the internal peptide fragment sequence ADFGGHYM from the same A. fumigatus nitrilases.

    Expressing:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. The following set of primers was used to analyze the expression of SVCT2: sense: 5′TGTTTCAGGCCAGTGCTTT 3′ and antisense: 5′GAAAGGATGGACGGCATACA 3′ (expected product of 457 bp).

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: QTT analysis and eQTL mapping Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Genome Wide:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: QTT analysis and eQTL mapping Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Western Blot:

    Article Title: Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns
    Article Snippet: .. RT-PCR and western blotting Total RNA was purified using Trizol and 0.5 μg RNA was used to synthesize single-stranded cDNA with oligo d(T) primers, using a ProtoScript M-MULV First-Strand Synthesis kit (New England Biolabs, Ipswich, MA, USA) as described by the manufacturer. .. The cDNA was used in standard PCR reactions using Taq Polymerase (Invitrogen), with primers specific for the exons flanking the alternative exon (see Table S9 in Additional file for a list of primers).

    Derivative Assay:

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. Partial cDNA of the nitrilase gene was amplified using the degenerate forward primer NITR_NTERMFW01, 5'-AAY GCI GAR CCI GGI TGG TTY GA-3', derived from the N-terminal fragment sequence NAEPGWFD of Aspergillus fumigatus nitrilases [GenBank: EDP55254 , XP_756085 ] and degenerate reverse primer NITR_INT2RE01, 5'-CAT RTA RTG ICC ICC RAA RTC IGC-3', derived from the internal peptide fragment sequence ADFGGHYM from the same A. fumigatus nitrilases.

    Countercurrent Chromatography:

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. .. RT-qPCR reactions were prepared with a Brilliant II SYBR Green qPCR Master Mix kit (Agilent Technologies, Santa Clara, CA, USA) in a final volume of 20 μL containing 2 μL cDNA and the following sets of primers (500 nM each): Cx26, sense 5′-TTG CTC AGG GAA GTC CAA AAG ACC-3′ and antisense 5′-TGG GCC TTT GTT TGG GAG CTT T-3′ (expected product of 231 bp); Cx30, sense 5′-GTG AAC AAG CAC TCG ACC AGC ATA-3′ and antisense 5′-GCG GAT AAA CTT TCG GGC AGT TTC-3′ (expected product of 288 bp); Cx43, sense 5′-TGG GTA CAA GCT GGT TAC TGG TGA-3′ and antisense 5′-TGG CTA ATG GCT GGA GTT CAT GTC-3′ (expected product of 221 bp); and cyclophilin, sense 5′-ATA ATG GCA CTG GTG GCA AGT C-3′ and antisense 5′-ATT CCT GGA CCC AAA ACG CTC C-3′ (expected product of 239 bp); Cx45, sense 5′-AAA GAG CAG AGC CAA CCA-3′ and antisense 5′-CCA AAC CCT AAG TGA AGC-3′ (expected product of 311 bp); Px1, sense 5′-TTC TTC CCC TAC ATC CTG CT-3′ and antisense 5′-GGT CCA TCT CTC AGG TCC AA-3′ (expected product of 185 bp), Px2, sense 5′-TGG ACA TCG TAT TGC TCT GC-3′ and antisense 5′-CCA CGT TGT CGT ACA TGA GG-3′ (expected product of 258 bp).

    Transfection:

    Article Title: Amplitude modulation of androgen signaling by c-MYC
    Article Snippet: After transfection with control or MYC siRNA for 48 h, MDA-MB-453 cells were exposed to 10 nM DHT or vehicle for 6 h and collected for RNA-seq assays. .. Total RNA was isolated using RNeasy mini kit (Qiagen), and oligo d(T)25 beads (New England Biolabs) were then used to purify the polyadenylated mRNA.

    Ligation:

    Article Title: Genetic Basis of Melanin Pigmentation in Butterfly Wings
    Article Snippet: Two biological replicates were sampled for RNA-seq library construction from each developmental stage, resulting in 12 RNA-seq samples. butterfly wing. (A) The five developmental stages and two color regions sampled in this study (see Table S1 in Poly(A) RNA was isolated with Oligo d(T)25 beads (New England Biolabs, Beverly, MA) from 1 μg total RNA of each sample and fragmented to size ∼350–450 bp. .. First- and second-strand cDNA (complementary DNA) synthesis, end repair, 3′dA tailing, and adaptor ligation were performed using a NEBNext Ultra RNA library Prep kit for Illumina (New England Biolabs).

    SDS Page:

    Article Title: Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns
    Article Snippet: RT-PCR and western blotting Total RNA was purified using Trizol and 0.5 μg RNA was used to synthesize single-stranded cDNA with oligo d(T) primers, using a ProtoScript M-MULV First-Strand Synthesis kit (New England Biolabs, Ipswich, MA, USA) as described by the manufacturer. .. For protein analysis, snap-frozen tissue was dissected and lysed in ice-cold RIPA buffer supplemented with proteinase inhibitors and separated by SDS-PAGE and subjected to western blotting.

    Polymerase Chain Reaction:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.6 mM MgCl2 , 0.4 mM dNTPs, 0.04 units of Taq DNA polymerase (Gibco-BRL) and 0.4 mM primers was incubated at 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles with a final extension at 72°C for 7 min. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. The PCR product (about 0.9 kb) obtained after 35 cycles of PCR on a Mastercycler personal cycler (Eppendorf) with proofreading DNA Polymerase Pfu Turbo (Stratagene) was cloned into the pBluescript SK+ vector (Stratagene) and sequenced using automated DNA sequencer (ABI PRISM 3130xl) according to the manufacturer's protocols.

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Article Title: Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns
    Article Snippet: RT-PCR and western blotting Total RNA was purified using Trizol and 0.5 μg RNA was used to synthesize single-stranded cDNA with oligo d(T) primers, using a ProtoScript M-MULV First-Strand Synthesis kit (New England Biolabs, Ipswich, MA, USA) as described by the manufacturer. .. The cDNA was used in standard PCR reactions using Taq Polymerase (Invitrogen), with primers specific for the exons flanking the alternative exon (see Table S9 in Additional file for a list of primers).

    Article Title: Pharmacologic reversion of epigenetic silencing of the PRKD1 promoter blocks breast tumor cell invasion and metastasis
    Article Snippet: For the transcription reaction, 1 μg of oligo d(T)18 primer (New England Biolabs, Beverly, MA, USA) and 1 μg of RNA were incubated in a total volume of 10 μl at 70°C for 10 min. Next, 5× buffer, 40 U of RNAsin Plus RNase Inhibitor (Promega), 200 μM deoxyribonucleotide triphosphate (New England Biolabs) and 1 μl of ImProm-II reverse transcriptase (Promega) were added to a total volume of 20 μl. .. The resulting cDNA pool was subjected to polymerase chain reaction (PCR) analysis using specific primer sets.

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Sequencing:

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. Partial cDNA of the nitrilase gene was amplified using the degenerate forward primer NITR_NTERMFW01, 5'-AAY GCI GAR CCI GGI TGG TTY GA-3', derived from the N-terminal fragment sequence NAEPGWFD of Aspergillus fumigatus nitrilases [GenBank: EDP55254 , XP_756085 ] and degenerate reverse primer NITR_INT2RE01, 5'-CAT RTA RTG ICC ICC RAA RTC IGC-3', derived from the internal peptide fragment sequence ADFGGHYM from the same A. fumigatus nitrilases.

    Article Title: Amplitude modulation of androgen signaling by c-MYC
    Article Snippet: Total RNA was isolated using RNeasy mini kit (Qiagen), and oligo d(T)25 beads (New England Biolabs) were then used to purify the polyadenylated mRNA. .. One nanogram of mRNA was used for library preparation using Encore Complete RNA-seq kit (NuGEN) according to the manufacturer's instructions, followed by sequencing on the Illumina HiSeq2000 platform.

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: Paragraph title: VH/VL Sequencing ... B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ).

    Affinity Purification:

    Article Title: Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns
    Article Snippet: RT-PCR and western blotting Total RNA was purified using Trizol and 0.5 μg RNA was used to synthesize single-stranded cDNA with oligo d(T) primers, using a ProtoScript M-MULV First-Strand Synthesis kit (New England Biolabs, Ipswich, MA, USA) as described by the manufacturer. .. Antibodies used: affinity-purified rabbit α-UPF2 (kind gift from Dr Jens Lykke-Andersen); rabbit α-mAb104 serum (pan-SR protein antibody; kind gift from Dr Javier Caceres); mouse α-β actin (ab6276, Abcam, Cambridge, UK).

    Recombinant:

    Article Title: Generation of Potent Anti-Vascular Endothelial Growth Factor Neutralizing Antibodies from Mouse Phage Display Library for Cancer Therapy
    Article Snippet: Immunization, RNA Extraction and cDNA Synthesis Six-to-eight-week-old BALB/c mouse was injected four times with recombinant human VEGF (R & D, Minneapolis, MN, USA). .. RNA from the spleen was reverse-transcribed with oligo d(T)18 primer (NEB, Ipswich, MA, USA).

    Cellular Antioxidant Activity Assay:

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. .. RT-qPCR reactions were prepared with a Brilliant II SYBR Green qPCR Master Mix kit (Agilent Technologies, Santa Clara, CA, USA) in a final volume of 20 μL containing 2 μL cDNA and the following sets of primers (500 nM each): Cx26, sense 5′-TTG CTC AGG GAA GTC CAA AAG ACC-3′ and antisense 5′-TGG GCC TTT GTT TGG GAG CTT T-3′ (expected product of 231 bp); Cx30, sense 5′-GTG AAC AAG CAC TCG ACC AGC ATA-3′ and antisense 5′-GCG GAT AAA CTT TCG GGC AGT TTC-3′ (expected product of 288 bp); Cx43, sense 5′-TGG GTA CAA GCT GGT TAC TGG TGA-3′ and antisense 5′-TGG CTA ATG GCT GGA GTT CAT GTC-3′ (expected product of 221 bp); and cyclophilin, sense 5′-ATA ATG GCA CTG GTG GCA AGT C-3′ and antisense 5′-ATT CCT GGA CCC AAA ACG CTC C-3′ (expected product of 239 bp); Cx45, sense 5′-AAA GAG CAG AGC CAA CCA-3′ and antisense 5′-CCA AAC CCT AAG TGA AGC-3′ (expected product of 311 bp); Px1, sense 5′-TTC TTC CCC TAC ATC CTG CT-3′ and antisense 5′-GGT CCA TCT CTC AGG TCC AA-3′ (expected product of 185 bp), Px2, sense 5′-TGG ACA TCG TAT TGC TCT GC-3′ and antisense 5′-CCA CGT TGT CGT ACA TGA GG-3′ (expected product of 258 bp).

    RNA Sequencing Assay:

    Article Title: Genetic Basis of Melanin Pigmentation in Butterfly Wings
    Article Snippet: .. Two biological replicates were sampled for RNA-seq library construction from each developmental stage, resulting in 12 RNA-seq samples. butterfly wing. (A) The five developmental stages and two color regions sampled in this study (see Table S1 in Poly(A) RNA was isolated with Oligo d(T)25 beads (New England Biolabs, Beverly, MA) from 1 μg total RNA of each sample and fragmented to size ∼350–450 bp. .. First- and second-strand cDNA (complementary DNA) synthesis, end repair, 3′dA tailing, and adaptor ligation were performed using a NEBNext Ultra RNA library Prep kit for Illumina (New England Biolabs).

    Article Title: Amplitude modulation of androgen signaling by c-MYC
    Article Snippet: Paragraph title: RNA-seq ... Total RNA was isolated using RNeasy mini kit (Qiagen), and oligo d(T)25 beads (New England Biolabs) were then used to purify the polyadenylated mRNA.

    Magnetic Beads:

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: .. B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. The magnetic beads were washed, resuspended in One step fast qRT-PCR solution (VWR) supplemented with an overlap extension VH and VL primer set as described , emulsified, and subjected to overlap-extension RT-PCR under the following conditions: 30 min at 55°C followed by 2 min at 94°C; 4 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 2 min; 4 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min; 32 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; 72°C for 7 min; hold at 4°C.

    Multiple Displacement Amplification:

    Article Title: Amplitude modulation of androgen signaling by c-MYC
    Article Snippet: After transfection with control or MYC siRNA for 48 h, MDA-MB-453 cells were exposed to 10 nM DHT or vehicle for 6 h and collected for RNA-seq assays. .. Total RNA was isolated using RNeasy mini kit (Qiagen), and oligo d(T)25 beads (New England Biolabs) were then used to purify the polyadenylated mRNA.

    Isolation:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: Reverse transcription-polymerase chain reaction Total RNA was isolated using Trizol (Invitrogen, Rockville, MD, USA). .. For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C.

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: .. DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. Partial cDNA of the nitrilase gene was amplified using the degenerate forward primer NITR_NTERMFW01, 5'-AAY GCI GAR CCI GGI TGG TTY GA-3', derived from the N-terminal fragment sequence NAEPGWFD of Aspergillus fumigatus nitrilases [GenBank: EDP55254 , XP_756085 ] and degenerate reverse primer NITR_INT2RE01, 5'-CAT RTA RTG ICC ICC RAA RTC IGC-3', derived from the internal peptide fragment sequence ADFGGHYM from the same A. fumigatus nitrilases.

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Total RNA from tanycyte primary cultures and hypothalamic samples was isolated using TRIZOL (Thermo Fisher Scientific, Waltham, MA, USA) and treated with DNase I (Fermentas International, Burlington, ON, Canada). .. Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C.

    Article Title: Pharmacologic reversion of epigenetic silencing of the PRKD1 promoter blocks breast tumor cell invasion and metastasis
    Article Snippet: RT-PCR Cellular RNA was isolated using RNA-Bee (Tel-Test, Friendswood, TX, USA) according to the manufacturer’s instructions and transcribed into cDNA using the ImProm-II Reverse Transcription System (Promega, Madison, WI, USA). .. For the transcription reaction, 1 μg of oligo d(T)18 primer (New England Biolabs, Beverly, MA, USA) and 1 μg of RNA were incubated in a total volume of 10 μl at 70°C for 10 min. Next, 5× buffer, 40 U of RNAsin Plus RNase Inhibitor (Promega), 200 μM deoxyribonucleotide triphosphate (New England Biolabs) and 1 μl of ImProm-II reverse transcriptase (Promega) were added to a total volume of 20 μl.

    Article Title: Genetic Basis of Melanin Pigmentation in Butterfly Wings
    Article Snippet: .. Two biological replicates were sampled for RNA-seq library construction from each developmental stage, resulting in 12 RNA-seq samples. butterfly wing. (A) The five developmental stages and two color regions sampled in this study (see Table S1 in Poly(A) RNA was isolated with Oligo d(T)25 beads (New England Biolabs, Beverly, MA) from 1 μg total RNA of each sample and fragmented to size ∼350–450 bp. .. First- and second-strand cDNA (complementary DNA) synthesis, end repair, 3′dA tailing, and adaptor ligation were performed using a NEBNext Ultra RNA library Prep kit for Illumina (New England Biolabs).

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Article Title: Myc/Max dependent intronic long antisense noncoding RNA, EVA1A-AS, suppresses the expression of Myc/Max dependent anti-proliferating gene EVA1A in a U2 dependent manner
    Article Snippet: .. RNAs were then isolated using the ReliaPrep miRNA Cell and Tissue Miniprep System according to the manufacturer’s protocol. cDNA synthesis was carried out using ProtoScript II First Strand cDNA Synthesis Kit (NEB) and Oligo d(T)/ random primers mix (NEB). ..

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: Reverse transcription-polymerase chain reaction Total RNA was isolated from the hypothalamic area, highly enriched primary tanycyte cultures, liver and pancreatic tissue using Trizol (Invitrogen). .. For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C.

    Article Title: Amplitude modulation of androgen signaling by c-MYC
    Article Snippet: .. Total RNA was isolated using RNeasy mini kit (Qiagen), and oligo d(T)25 beads (New England Biolabs) were then used to purify the polyadenylated mRNA. .. One nanogram of mRNA was used for library preparation using Encore Complete RNA-seq kit (NuGEN) according to the manufacturer's instructions, followed by sequencing on the Illumina HiSeq2000 platform.

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: VH/VL Sequencing Total B cells were isolated from PBMCs using the Human Memory B Cell Isolation Kit (Miltenyi Biotec) with an LD column according to the manufacturer’s instructions. .. B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ).

    Flow Cytometry:

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: .. B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. The magnetic beads were washed, resuspended in One step fast qRT-PCR solution (VWR) supplemented with an overlap extension VH and VL primer set as described , emulsified, and subjected to overlap-extension RT-PCR under the following conditions: 30 min at 55°C followed by 2 min at 94°C; 4 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 2 min; 4 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min; 32 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; 72°C for 7 min; hold at 4°C.

    Purification:

    Article Title: Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns
    Article Snippet: .. RT-PCR and western blotting Total RNA was purified using Trizol and 0.5 μg RNA was used to synthesize single-stranded cDNA with oligo d(T) primers, using a ProtoScript M-MULV First-Strand Synthesis kit (New England Biolabs, Ipswich, MA, USA) as described by the manufacturer. .. The cDNA was used in standard PCR reactions using Taq Polymerase (Invitrogen), with primers specific for the exons flanking the alternative exon (see Table S9 in Additional file for a list of primers).

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK). .. After purification and denaturation, the single chain molecules of each cDNA library were loaded onto the flowcell and sequenced on a GA II sequencer (Illumina, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: .. For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. ..

    Article Title: Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns
    Article Snippet: .. RT-PCR and western blotting Total RNA was purified using Trizol and 0.5 μg RNA was used to synthesize single-stranded cDNA with oligo d(T) primers, using a ProtoScript M-MULV First-Strand Synthesis kit (New England Biolabs, Ipswich, MA, USA) as described by the manufacturer. .. The cDNA was used in standard PCR reactions using Taq Polymerase (Invitrogen), with primers specific for the exons flanking the alternative exon (see Table S9 in Additional file for a list of primers).

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: .. Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. ..

    Article Title: Pharmacologic reversion of epigenetic silencing of the PRKD1 promoter blocks breast tumor cell invasion and metastasis
    Article Snippet: Paragraph title: RT-PCR ... For the transcription reaction, 1 μg of oligo d(T)18 primer (New England Biolabs, Beverly, MA, USA) and 1 μg of RNA were incubated in a total volume of 10 μl at 70°C for 10 min. Next, 5× buffer, 40 U of RNAsin Plus RNase Inhibitor (Promega), 200 μM deoxyribonucleotide triphosphate (New England Biolabs) and 1 μl of ImProm-II reverse transcriptase (Promega) were added to a total volume of 20 μl.

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: .. For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. ..

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. The magnetic beads were washed, resuspended in One step fast qRT-PCR solution (VWR) supplemented with an overlap extension VH and VL primer set as described , emulsified, and subjected to overlap-extension RT-PCR under the following conditions: 30 min at 55°C followed by 2 min at 94°C; 4 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 2 min; 4 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min; 32 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; 72°C for 7 min; hold at 4°C.

    Staining:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.6 mM MgCl2 , 0.4 mM dNTPs, 0.04 units of Taq DNA polymerase (Gibco-BRL) and 0.4 mM primers was incubated at 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles with a final extension at 72°C for 7 min. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Nested PCR:

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. VH/VL amplicons were then extracted from the emulsions, amplified using nested PCR, and sequenced by 2x300 Illumina MiSeq.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. .. RT-qPCR reactions were prepared with a Brilliant II SYBR Green qPCR Master Mix kit (Agilent Technologies, Santa Clara, CA, USA) in a final volume of 20 μL containing 2 μL cDNA and the following sets of primers (500 nM each): Cx26, sense 5′-TTG CTC AGG GAA GTC CAA AAG ACC-3′ and antisense 5′-TGG GCC TTT GTT TGG GAG CTT T-3′ (expected product of 231 bp); Cx30, sense 5′-GTG AAC AAG CAC TCG ACC AGC ATA-3′ and antisense 5′-GCG GAT AAA CTT TCG GGC AGT TTC-3′ (expected product of 288 bp); Cx43, sense 5′-TGG GTA CAA GCT GGT TAC TGG TGA-3′ and antisense 5′-TGG CTA ATG GCT GGA GTT CAT GTC-3′ (expected product of 221 bp); and cyclophilin, sense 5′-ATA ATG GCA CTG GTG GCA AGT C-3′ and antisense 5′-ATT CCT GGA CCC AAA ACG CTC C-3′ (expected product of 239 bp); Cx45, sense 5′-AAA GAG CAG AGC CAA CCA-3′ and antisense 5′-CCA AAC CCT AAG TGA AGC-3′ (expected product of 311 bp); Px1, sense 5′-TTC TTC CCC TAC ATC CTG CT-3′ and antisense 5′-GGT CCA TCT CTC AGG TCC AA-3′ (expected product of 185 bp), Px2, sense 5′-TGG ACA TCG TAT TGC TCT GC-3′ and antisense 5′-CCA CGT TGT CGT ACA TGA GG-3′ (expected product of 258 bp).

    Injection:

    Article Title: Distinct roles of light-activated channels TRP and TRPL in photoreceptors of Periplaneta americana
    Article Snippet: RNAi dsRNA was synthesized and injected (4–5 µg in 1 µl Ringer solution) into the head tissue under CO2 anesthesia as described previously ( ; ). .. In brief, reverse transcription was performed using total RNA extracted from cockroach retinas and oligo d(T)23 VN primers with ProtoScript II reverse transcription (New England Biolabs, Inc.).

    Article Title: Generation of Potent Anti-Vascular Endothelial Growth Factor Neutralizing Antibodies from Mouse Phage Display Library for Cancer Therapy
    Article Snippet: Immunization, RNA Extraction and cDNA Synthesis Six-to-eight-week-old BALB/c mouse was injected four times with recombinant human VEGF (R & D, Minneapolis, MN, USA). .. RNA from the spleen was reverse-transcribed with oligo d(T)18 primer (NEB, Ipswich, MA, USA).

    Plasmid Preparation:

    Article Title: Heterologous expression, purification and characterization of nitrilase from Aspergillus niger K10
    Article Snippet: DNA manipulations Total RNA was isolated from A. niger K10 using RNeasy Plant Mini Kit (Qiagen) and used to synthesize cDNA using SuperScript II Reverse Transcriptase (Invitrogen) and anchored oligo d(T)23 VN primer (NEB). .. The PCR product (about 0.9 kb) obtained after 35 cycles of PCR on a Mastercycler personal cycler (Eppendorf) with proofreading DNA Polymerase Pfu Turbo (Stratagene) was cloned into the pBluescript SK+ vector (Stratagene) and sequenced using automated DNA sequencer (ABI PRISM 3130xl) according to the manufacturer's protocols.

    Software:

    Article Title: MicroRNA Dynamics and Functions During Arabidopsis Embryogenesis
    Article Snippet: Two-hundred nanograms of total RNA samples with RNA Quality Number values > 6.0 were used for cDNA synthesis together with the Oligo d(T)18 mRNA Primer (New England Biolabs) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). .. Cycle threshold values were obtained using LightCycler 96 software (Roche), and relative quantification of transcripts (ΔΔCycle threshold values) was performed with an in-house “R” script.

    SYBR Green Assay:

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. .. RT-qPCR reactions were prepared with a Brilliant II SYBR Green qPCR Master Mix kit (Agilent Technologies, Santa Clara, CA, USA) in a final volume of 20 μL containing 2 μL cDNA and the following sets of primers (500 nM each): Cx26, sense 5′-TTG CTC AGG GAA GTC CAA AAG ACC-3′ and antisense 5′-TGG GCC TTT GTT TGG GAG CTT T-3′ (expected product of 231 bp); Cx30, sense 5′-GTG AAC AAG CAC TCG ACC AGC ATA-3′ and antisense 5′-GCG GAT AAA CTT TCG GGC AGT TTC-3′ (expected product of 288 bp); Cx43, sense 5′-TGG GTA CAA GCT GGT TAC TGG TGA-3′ and antisense 5′-TGG CTA ATG GCT GGA GTT CAT GTC-3′ (expected product of 221 bp); and cyclophilin, sense 5′-ATA ATG GCA CTG GTG GCA AGT C-3′ and antisense 5′-ATT CCT GGA CCC AAA ACG CTC C-3′ (expected product of 239 bp); Cx45, sense 5′-AAA GAG CAG AGC CAA CCA-3′ and antisense 5′-CCA AAC CCT AAG TGA AGC-3′ (expected product of 311 bp); Px1, sense 5′-TTC TTC CCC TAC ATC CTG CT-3′ and antisense 5′-GGT CCA TCT CTC AGG TCC AA-3′ (expected product of 185 bp), Px2, sense 5′-TGG ACA TCG TAT TGC TCT GC-3′ and antisense 5′-CCA CGT TGT CGT ACA TGA GG-3′ (expected product of 258 bp).

    Article Title: MicroRNA Dynamics and Functions During Arabidopsis Embryogenesis
    Article Snippet: Two-hundred nanograms of total RNA samples with RNA Quality Number values > 6.0 were used for cDNA synthesis together with the Oligo d(T)18 mRNA Primer (New England Biolabs) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). .. The cDNA was diluted 10× with nuclease-free water, and 2 μL was used as a template for the qRT-PCR. qRT-PCR was performed on a LightCycler 96 Instrument (Roche) using gene-specific and control elF4A ), and Fast SYBR Green Master Mix (Roche).

    RNA Extraction:

    Article Title: Generation of Potent Anti-Vascular Endothelial Growth Factor Neutralizing Antibodies from Mouse Phage Display Library for Cancer Therapy
    Article Snippet: Paragraph title: 4.1. Immunization, RNA Extraction and cDNA Synthesis ... RNA from the spleen was reverse-transcribed with oligo d(T)18 primer (NEB, Ipswich, MA, USA).

    Agarose Gel Electrophoresis:

    Article Title: SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche
    Article Snippet: For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.6 mM MgCl2 , 0.4 mM dNTPs, 0.04 units of Taq DNA polymerase (Gibco-BRL) and 0.4 mM primers was incubated at 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles with a final extension at 72°C for 7 min. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: .. Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Article Title: Dynamic Localization of Glucokinase and Its Regulatory Protein in Hypothalamic Tanycytes
    Article Snippet: For RT-PCR, 1 µg of RNA was incubated in 10 µL reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 µM oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. .. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide.

    Transgenic Assay:

    Article Title: MicroRNA Dynamics and Functions During Arabidopsis Embryogenesis
    Article Snippet: Two-hundred nanograms of total RNA samples with RNA Quality Number values > 6.0 were used for cDNA synthesis together with the Oligo d(T)18 mRNA Primer (New England Biolabs) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). .. For each genotype, 6 to 17 individual first-generation transgenic (T1 ) lines were analyzed in technical duplicates.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Generation of Potent Anti-Vascular Endothelial Growth Factor Neutralizing Antibodies from Mouse Phage Display Library for Cancer Therapy
    Article Snippet: Blood samples were collected 10–14 days after each boost to monitor the immune response against VEGF using ELISA. .. RNA from the spleen was reverse-transcribed with oligo d(T)18 primer (NEB, Ipswich, MA, USA).

    Spectrophotometry:

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: .. Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    Migration:

    Article Title: Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
    Article Snippet: .. Real-time RT-PCR experiments 0.5 μg of total RNA (checked for quality and quantity using a spectrophotometer NanoDrop™ 1000 (Thermo Scientific), followed by a migration in an agarose gel) of each sample was retrotranscribed using 1 pmol of Oligo d(T)23VN (New England Biolabs, Beverly, USA) and 10 U M-MulV RNase H for 1 h at 42°C (Finnzymes, Helsinki, Finland) following the application protocol of the manufacturers. .. After RNA digestion with 1 U RNase A (USB, Cleveland, USA) for 1 h at 37°C, gene expression analyses were performed by adding 0.16 μl of the cDNA to the realtime PCR complete mix, FluoCycleTM sybr green (20 μl final volume; Euroclone, Pero, Italy), in a DNA Engine Opticon Real-Time PCR Detection (Biorad, Hercules, USA).

    CTG Assay:

    Article Title: Connexin-43 Gap Junctions Are Responsible for the Hypothalamic Tanycyte-Coupled Network
    Article Snippet: Reverse transcription polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s protocol (Fermentas International) using 2 μg of RNA and 20 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2 , 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 60 min at 42°C followed by 10 min at 70°C. .. RT-qPCR reactions were prepared with a Brilliant II SYBR Green qPCR Master Mix kit (Agilent Technologies, Santa Clara, CA, USA) in a final volume of 20 μL containing 2 μL cDNA and the following sets of primers (500 nM each): Cx26, sense 5′-TTG CTC AGG GAA GTC CAA AAG ACC-3′ and antisense 5′-TGG GCC TTT GTT TGG GAG CTT T-3′ (expected product of 231 bp); Cx30, sense 5′-GTG AAC AAG CAC TCG ACC AGC ATA-3′ and antisense 5′-GCG GAT AAA CTT TCG GGC AGT TTC-3′ (expected product of 288 bp); Cx43, sense 5′-TGG GTA CAA GCT GGT TAC TGG TGA-3′ and antisense 5′-TGG CTA ATG GCT GGA GTT CAT GTC-3′ (expected product of 221 bp); and cyclophilin, sense 5′-ATA ATG GCA CTG GTG GCA AGT C-3′ and antisense 5′-ATT CCT GGA CCC AAA ACG CTC C-3′ (expected product of 239 bp); Cx45, sense 5′-AAA GAG CAG AGC CAA CCA-3′ and antisense 5′-CCA AAC CCT AAG TGA AGC-3′ (expected product of 311 bp); Px1, sense 5′-TTC TTC CCC TAC ATC CTG CT-3′ and antisense 5′-GGT CCA TCT CTC AGG TCC AA-3′ (expected product of 185 bp), Px2, sense 5′-TGG ACA TCG TAT TGC TCT GC-3′ and antisense 5′-CCA CGT TGT CGT ACA TGA GG-3′ (expected product of 258 bp).

    Lysis:

    Article Title: Sera Antibody Repertoire Analyses Reveal Mechanisms of Broad and Pandemic Strain Neutralizing Responses after Human Norovirus Vaccination
    Article Snippet: .. B cells were then coemulsified with oligo d(T )25 magnetic beads (New England Biolabs) and lysis buffer (100 mM Tris pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% lithium dodecyl sulfate, and 5 mM dithiothreitol) using a custom-designed flow focusing device as described ( ). .. The magnetic beads were washed, resuspended in One step fast qRT-PCR solution (VWR) supplemented with an overlap extension VH and VL primer set as described , emulsified, and subjected to overlap-extension RT-PCR under the following conditions: 30 min at 55°C followed by 2 min at 94°C; 4 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 2 min; 4 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min; 32 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; 72°C for 7 min; hold at 4°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    UDIs address the “index hopping issue on the patterned flow cells of some Illumina instruments NovaSeq HiSeq 3000 4000 HiSeq X The kit includes 96 pre mixed unique pairs of
      Buy from Supplier

    76
    New England Biolabs oligonucleotide 22fork3
    Activated and poly(ADP-ribosyl)ated PARP-1 does not inhibit WRN catalytic activities. ( A ) PARP-1 (500 ng) and NAD + (100 μM) as indicated were incubated with an unlabeled forked duplex for 10 min at room temperature. Western blot analysis was performed using anti-PARP-1 (left panel) or anti-PAR (right panel) antibodies. ( B ) WRN (7.5 nM, lanes 2 to 4) and a radiolabeled 34 bp forked duplex (10 fmol, 34ForkA/34ForkB) were incubated with aliquots from the reactions performed in (A) containing PARP-1 (lane 2), PARP-1 and NAD + (lane 3), or NAD + (lane 4) for 15 min at 37°C. Lane 1, no enzyme. Products were heat-denatured for 5 min at 95°C, run on a 14% denaturing polyacrylamide gel, and visualized using a PhosphorImager. ( C ) Aliquots from the reactions performed in (A) containing PARP-1 (lanes 3 and 6), PARP-1 and NAD + (lanes 4 and 7), or NAD + (lanes 5 and 8) were incubated with a radiolabeled 22 bp forked duplex (20 fmol, <t>22Fork3/22Fork4)</t> in the absence (lanes 3 to 5) or presence (lanes 6 to 8) of WRN (1 nM) for 15 min at 37°C. Lane 1, heat-denatured substrate. Lane 2, no enzyme. Products were run on a 12% native polyacrylamide gel and visualized using a PhosphorImager.
    Oligonucleotide 22fork3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide 22fork3/product/New England Biolabs
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide 22fork3 - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    77
    New England Biolabs 15 nt rna oligos
    LASV NP exoribonuclease activity preferentially degrades dsRNA substrates. Various concentrations of purified full-length NP, C-terminal domain of NP ( NP-C ), and a catalytic mutant ( NP-D389A ) were incubated at 37 °C for 60 min with a 5′ 32 P-labeled <t>15-nt</t> <t>RNA</t> oligo of either ss or ds forms (“Experimental Procedures”). The products were separated in a 17% urea-polyacrylamide gel and exposed to films. A representative gel of at least three independent experiments was shown.
    15 Nt Rna Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/15 nt rna oligos/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    15 nt rna oligos - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    77
    New England Biolabs single stranded 5 ohu containing oligo
    NEIL1’s CID is required for efficient repair of oxidized DNA lesions. (A) Repair of the <t>5-OHU-containing</t> plasmid was monitored by the incorporation of 32 P-dTMP and analysis of a 32 nt Nt.BstNB1 restriction repaired fragment after denaturing gel electrophoresis [ 18 , 38 ]. (B) In vitro reconstitution of NEIL1-intitiated SN-BER with purified proteins (10 and 50 fmol WT NEIL1 [lanes 2 and 3] or N311mutant [lanes 4 and 5] and 50 fmol each of PNKP, Polβ, LigIIIα and XRCC1). 5'- 32 P-labeled 32 and 20-mer oligos were used as size markers (lane 6). The histogram shows quantitation of repair. (C-E) FLAG-N311 IP, with reduced DNA glycosylase activity compared to FLAG-WT NEIL1 IP (D), was extremely deficient in overall repair (E). The DNA glycosylase activity was measured with 5-OHU-duplex <t>oligo</t> and complete repair with the plasmid substrate. FLAG levels in stably expressing cells were compared by Western analysis (C).
    Single Stranded 5 Ohu Containing Oligo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded 5 ohu containing oligo/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    single stranded 5 ohu containing oligo - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    Image Search Results


    Activated and poly(ADP-ribosyl)ated PARP-1 does not inhibit WRN catalytic activities. ( A ) PARP-1 (500 ng) and NAD + (100 μM) as indicated were incubated with an unlabeled forked duplex for 10 min at room temperature. Western blot analysis was performed using anti-PARP-1 (left panel) or anti-PAR (right panel) antibodies. ( B ) WRN (7.5 nM, lanes 2 to 4) and a radiolabeled 34 bp forked duplex (10 fmol, 34ForkA/34ForkB) were incubated with aliquots from the reactions performed in (A) containing PARP-1 (lane 2), PARP-1 and NAD + (lane 3), or NAD + (lane 4) for 15 min at 37°C. Lane 1, no enzyme. Products were heat-denatured for 5 min at 95°C, run on a 14% denaturing polyacrylamide gel, and visualized using a PhosphorImager. ( C ) Aliquots from the reactions performed in (A) containing PARP-1 (lanes 3 and 6), PARP-1 and NAD + (lanes 4 and 7), or NAD + (lanes 5 and 8) were incubated with a radiolabeled 22 bp forked duplex (20 fmol, 22Fork3/22Fork4) in the absence (lanes 3 to 5) or presence (lanes 6 to 8) of WRN (1 nM) for 15 min at 37°C. Lane 1, heat-denatured substrate. Lane 2, no enzyme. Products were run on a 12% native polyacrylamide gel and visualized using a PhosphorImager.

    Journal: Nucleic Acids Research

    Article Title: Poly(ADP-ribose) polymerase 1 regulates both the exonuclease and helicase activities of the Werner syndrome protein

    doi: 10.1093/nar/gkh721

    Figure Lengend Snippet: Activated and poly(ADP-ribosyl)ated PARP-1 does not inhibit WRN catalytic activities. ( A ) PARP-1 (500 ng) and NAD + (100 μM) as indicated were incubated with an unlabeled forked duplex for 10 min at room temperature. Western blot analysis was performed using anti-PARP-1 (left panel) or anti-PAR (right panel) antibodies. ( B ) WRN (7.5 nM, lanes 2 to 4) and a radiolabeled 34 bp forked duplex (10 fmol, 34ForkA/34ForkB) were incubated with aliquots from the reactions performed in (A) containing PARP-1 (lane 2), PARP-1 and NAD + (lane 3), or NAD + (lane 4) for 15 min at 37°C. Lane 1, no enzyme. Products were heat-denatured for 5 min at 95°C, run on a 14% denaturing polyacrylamide gel, and visualized using a PhosphorImager. ( C ) Aliquots from the reactions performed in (A) containing PARP-1 (lanes 3 and 6), PARP-1 and NAD + (lanes 4 and 7), or NAD + (lanes 5 and 8) were incubated with a radiolabeled 22 bp forked duplex (20 fmol, 22Fork3/22Fork4) in the absence (lanes 3 to 5) or presence (lanes 6 to 8) of WRN (1 nM) for 15 min at 37°C. Lane 1, heat-denatured substrate. Lane 2, no enzyme. Products were run on a 12% native polyacrylamide gel and visualized using a PhosphorImager.

    Article Snippet: Briefly, oligonucleotide 22Fork3 (Table ) was 5′ end-labeled with [γ-32 P]ATP and T4 polynucleotide kinase (New England Biolabs) and annealed to its unlabeled complementary oligonucleotide 22Fork4.

    Techniques: Incubation, Western Blot

    The effect of PARP-1 and PARP-2 on WRN helicase activity. ( A ) Reactions containing WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) in the absence or presence of PARP-1 were incubated with a 22 bp forked substrate (0.5 nM, 22Fork3/22Fork4) for 15 min at 37°C. The concentrations of PARP-1 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reaction products were run on a 12% native gel and visualized using a PhosphorImager. %D, percentage of single-stranded product displaced. ( B ) WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) was incubated in the absence or presence of PARP-2 for 15 min at 37°C with a 22 bp forked duplex substrate (0.5 nM, 22Fork3/22Fork4). Concentrations of PARP-2 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reactions were analyzed as above.

    Journal: Nucleic Acids Research

    Article Title: Poly(ADP-ribose) polymerase 1 regulates both the exonuclease and helicase activities of the Werner syndrome protein

    doi: 10.1093/nar/gkh721

    Figure Lengend Snippet: The effect of PARP-1 and PARP-2 on WRN helicase activity. ( A ) Reactions containing WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) in the absence or presence of PARP-1 were incubated with a 22 bp forked substrate (0.5 nM, 22Fork3/22Fork4) for 15 min at 37°C. The concentrations of PARP-1 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reaction products were run on a 12% native gel and visualized using a PhosphorImager. %D, percentage of single-stranded product displaced. ( B ) WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) was incubated in the absence or presence of PARP-2 for 15 min at 37°C with a 22 bp forked duplex substrate (0.5 nM, 22Fork3/22Fork4). Concentrations of PARP-2 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reactions were analyzed as above.

    Article Snippet: Briefly, oligonucleotide 22Fork3 (Table ) was 5′ end-labeled with [γ-32 P]ATP and T4 polynucleotide kinase (New England Biolabs) and annealed to its unlabeled complementary oligonucleotide 22Fork4.

    Techniques: Activity Assay, Incubation

    LASV NP exoribonuclease activity preferentially degrades dsRNA substrates. Various concentrations of purified full-length NP, C-terminal domain of NP ( NP-C ), and a catalytic mutant ( NP-D389A ) were incubated at 37 °C for 60 min with a 5′ 32 P-labeled 15-nt RNA oligo of either ss or ds forms (“Experimental Procedures”). The products were separated in a 17% urea-polyacrylamide gel and exposed to films. A representative gel of at least three independent experiments was shown.

    Journal: The Journal of Biological Chemistry

    Article Title: Structures of Arenaviral Nucleoproteins with Triphosphate dsRNA Reveal a Unique Mechanism of Immune Suppression *

    doi: 10.1074/jbc.M112.420521

    Figure Lengend Snippet: LASV NP exoribonuclease activity preferentially degrades dsRNA substrates. Various concentrations of purified full-length NP, C-terminal domain of NP ( NP-C ), and a catalytic mutant ( NP-D389A ) were incubated at 37 °C for 60 min with a 5′ 32 P-labeled 15-nt RNA oligo of either ss or ds forms (“Experimental Procedures”). The products were separated in a 17% urea-polyacrylamide gel and exposed to films. A representative gel of at least three independent experiments was shown.

    Article Snippet: The 15-nt RNA oligos used in the in vitro RNase assay, 5′-AGUAGAAACAAGGCC-3′, were chemically synthesized, and 5′ labeled with [γ-32 P]ATP using a T4 polynucleotide kinase (New England Biolabs).

    Techniques: Activity Assay, Purification, Mutagenesis, Incubation, Labeling

    NEIL1’s CID is required for efficient repair of oxidized DNA lesions. (A) Repair of the 5-OHU-containing plasmid was monitored by the incorporation of 32 P-dTMP and analysis of a 32 nt Nt.BstNB1 restriction repaired fragment after denaturing gel electrophoresis [ 18 , 38 ]. (B) In vitro reconstitution of NEIL1-intitiated SN-BER with purified proteins (10 and 50 fmol WT NEIL1 [lanes 2 and 3] or N311mutant [lanes 4 and 5] and 50 fmol each of PNKP, Polβ, LigIIIα and XRCC1). 5'- 32 P-labeled 32 and 20-mer oligos were used as size markers (lane 6). The histogram shows quantitation of repair. (C-E) FLAG-N311 IP, with reduced DNA glycosylase activity compared to FLAG-WT NEIL1 IP (D), was extremely deficient in overall repair (E). The DNA glycosylase activity was measured with 5-OHU-duplex oligo and complete repair with the plasmid substrate. FLAG levels in stably expressing cells were compared by Western analysis (C).

    Journal: Biomolecules

    Article Title: Human DNA Glycosylase NEIL1's Interactions with Downstream Repair Proteins Is Critical for Efficient Repair of Oxidized DNA Base Damage and Enhanced Cell Survival

    doi: 10.3390/biom2040564

    Figure Lengend Snippet: NEIL1’s CID is required for efficient repair of oxidized DNA lesions. (A) Repair of the 5-OHU-containing plasmid was monitored by the incorporation of 32 P-dTMP and analysis of a 32 nt Nt.BstNB1 restriction repaired fragment after denaturing gel electrophoresis [ 18 , 38 ]. (B) In vitro reconstitution of NEIL1-intitiated SN-BER with purified proteins (10 and 50 fmol WT NEIL1 [lanes 2 and 3] or N311mutant [lanes 4 and 5] and 50 fmol each of PNKP, Polβ, LigIIIα and XRCC1). 5'- 32 P-labeled 32 and 20-mer oligos were used as size markers (lane 6). The histogram shows quantitation of repair. (C-E) FLAG-N311 IP, with reduced DNA glycosylase activity compared to FLAG-WT NEIL1 IP (D), was extremely deficient in overall repair (E). The DNA glycosylase activity was measured with 5-OHU-duplex oligo and complete repair with the plasmid substrate. FLAG levels in stably expressing cells were compared by Western analysis (C).

    Article Snippet: To produce radio-labeled substrates, the single-stranded 5-OHU-containing oligo was labeled at the 5′-termini with [γ-32 P]-ATP using T4 -PNK (New England Biolabs) before annealing.

    Techniques: Plasmid Preparation, Nucleic Acid Electrophoresis, In Vitro, Purification, Labeling, Quantitation Assay, Activity Assay, Stable Transfection, Expressing, Western Blot

    NEIL1’s common interaction domain (CID)-containing C-terminus is dispensable for DNA glycosylase activity in vitro. Recombinant wild-type (WT) and truncated (N311) mutant of NEIL1 (A; Coomassie-stained gel in B) show similar DNA glycosylase/AP lyase activity with a 5-OHU-containing 5'- 32 P-labeled 51-mer oligonucleotide duplex substrate to produce 25 nt oligo (C). Lanes 2 and 3: 10 and 50 fmol WT NEIL1; lanes 4 and 5: 10 and 50 fmol N311 mutant.

    Journal: Biomolecules

    Article Title: Human DNA Glycosylase NEIL1's Interactions with Downstream Repair Proteins Is Critical for Efficient Repair of Oxidized DNA Base Damage and Enhanced Cell Survival

    doi: 10.3390/biom2040564

    Figure Lengend Snippet: NEIL1’s common interaction domain (CID)-containing C-terminus is dispensable for DNA glycosylase activity in vitro. Recombinant wild-type (WT) and truncated (N311) mutant of NEIL1 (A; Coomassie-stained gel in B) show similar DNA glycosylase/AP lyase activity with a 5-OHU-containing 5'- 32 P-labeled 51-mer oligonucleotide duplex substrate to produce 25 nt oligo (C). Lanes 2 and 3: 10 and 50 fmol WT NEIL1; lanes 4 and 5: 10 and 50 fmol N311 mutant.

    Article Snippet: To produce radio-labeled substrates, the single-stranded 5-OHU-containing oligo was labeled at the 5′-termini with [γ-32 P]-ATP using T4 -PNK (New England Biolabs) before annealing.

    Techniques: Activity Assay, In Vitro, Recombinant, Mutagenesis, Staining, Labeling