oligos  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Oligo d T 18 no 5 Phosphate
    Description:
    Oligo d T 18 no 5 Phosphate 5 0 A260 units
    Catalog Number:
    s1316s
    Price:
    93
    Size:
    5 0 A260 units
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs oligos
    Oligo d T 18 no 5 Phosphate
    Oligo d T 18 no 5 Phosphate 5 0 A260 units
    https://www.bioz.com/result/oligos/product/New England Biolabs
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-10
    99/100 stars

    Images

    1) Product Images from "Molecular Factors Affecting the Accumulation of Recombinant Proteins in the Chlamydomonas reinhardtii Chloroplast"

    Article Title: Molecular Factors Affecting the Accumulation of Recombinant Proteins in the Chlamydomonas reinhardtii Chloroplast

    Journal: Molecular Biotechnology

    doi: 10.1007/s12033-010-9348-4

    Toeprint analyses of translation initiation complexes on atpA and atpA – gfp RNAs. In vitro transcribed atpA – atpA ( left panels ) and atpA – gfp ( right panels ) RNAs (20 nM) were extended from [γ- 32 P] ATP-labeled oligos that anneal 120-nt downstream of the initiator AUGs, either alone or in the presence of tRNA Met , 30S subunit or both. Sequencing reactions were run alongside. The treatments are indicated at the top of each panel. The positions of the toeprints respective to the initiator AUG (+1) are indicated with lines on the side. a Toeprint reactions using 100-nM 30S subunit, b Inset showing the toeprint area of experiments similar to ( a ) with 200-nM 30S subunit. The figure shows representative autoradiographs obtained from three independent experiments
    Figure Legend Snippet: Toeprint analyses of translation initiation complexes on atpA and atpA – gfp RNAs. In vitro transcribed atpA – atpA ( left panels ) and atpA – gfp ( right panels ) RNAs (20 nM) were extended from [γ- 32 P] ATP-labeled oligos that anneal 120-nt downstream of the initiator AUGs, either alone or in the presence of tRNA Met , 30S subunit or both. Sequencing reactions were run alongside. The treatments are indicated at the top of each panel. The positions of the toeprints respective to the initiator AUG (+1) are indicated with lines on the side. a Toeprint reactions using 100-nM 30S subunit, b Inset showing the toeprint area of experiments similar to ( a ) with 200-nM 30S subunit. The figure shows representative autoradiographs obtained from three independent experiments

    Techniques Used: In Vitro, Labeling, Sequencing

    2) Product Images from "Multimerization Domains are Associated with Apparent Strand Exchange Activity in BLM and WRN DNA helicases"

    Article Title: Multimerization Domains are Associated with Apparent Strand Exchange Activity in BLM and WRN DNA helicases

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2014.07.015

    Characterization of apparent DNA strand exchange activity in SA proteins. (A) The reaction illustrated at the top of the panel was performed using a 32 bp radiolabeled dsDNA with flush ends as donor (oligos #4*/#5) and an unlabeled 57 nt oligo (#6) as recipient. Reactions containing 5 nM donor and 20 nM recipient were initiated by addition of the indicated concentrations of Rad52N, Sgs1 103–322 , or Rad59. Following incubation at 37°C for 30 min, the reactions were terminated and the products analyzed by 10% native PAGE and phosphorimaging. ( B ) SE reactions were carried out as in (A) except that aliquots of the reactions were removed at the indicated times and treated as above. ( C ) SE reactions were performed with Rad52 mutants. ( D ) SE assays were performed with sub-domains of WRN 235–526 .
    Figure Legend Snippet: Characterization of apparent DNA strand exchange activity in SA proteins. (A) The reaction illustrated at the top of the panel was performed using a 32 bp radiolabeled dsDNA with flush ends as donor (oligos #4*/#5) and an unlabeled 57 nt oligo (#6) as recipient. Reactions containing 5 nM donor and 20 nM recipient were initiated by addition of the indicated concentrations of Rad52N, Sgs1 103–322 , or Rad59. Following incubation at 37°C for 30 min, the reactions were terminated and the products analyzed by 10% native PAGE and phosphorimaging. ( B ) SE reactions were carried out as in (A) except that aliquots of the reactions were removed at the indicated times and treated as above. ( C ) SE reactions were performed with Rad52 mutants. ( D ) SE assays were performed with sub-domains of WRN 235–526 .

    Techniques Used: Activity Assay, Incubation, Clear Native PAGE

    3) Product Images from "Action of CMG with strand-specific DNA blocks supports an internal unwinding mode for the eukaryotic replicative helicase"

    Article Title: Action of CMG with strand-specific DNA blocks supports an internal unwinding mode for the eukaryotic replicative helicase

    Journal: eLife

    doi: 10.7554/eLife.23449

    Substrate single strands do not spontaneously reanneal at 30˚C. To determine whether unwound substrate oligos spontaneously reanneal under our reaction conditions, we mixed 0.5 nM final concentration of radiolabeled 50duplex LAG oligo ( Table 1 ) with 0.5 nM unlabeled 50 duplex LEAD oligo under reaction conditions identical to those of Figure 3 in a total reaction volume of 55 μl. Complete reactions were mixed on ice and started by incubating at 30°C. At the indicated time points, 10 μl aliquots were removed and flash frozen in liquid nitrogen. Lack of re-annealing of the unwound strands allowed us to perform unwinding reactions in Figure 3 and subsequent Figures in the absence of a trap, eliminating potential side interactions between CMG and the unlabeled trap DNA. DOI: http://dx.doi.org/10.7554/eLife.23449.010
    Figure Legend Snippet: Substrate single strands do not spontaneously reanneal at 30˚C. To determine whether unwound substrate oligos spontaneously reanneal under our reaction conditions, we mixed 0.5 nM final concentration of radiolabeled 50duplex LAG oligo ( Table 1 ) with 0.5 nM unlabeled 50 duplex LEAD oligo under reaction conditions identical to those of Figure 3 in a total reaction volume of 55 μl. Complete reactions were mixed on ice and started by incubating at 30°C. At the indicated time points, 10 μl aliquots were removed and flash frozen in liquid nitrogen. Lack of re-annealing of the unwound strands allowed us to perform unwinding reactions in Figure 3 and subsequent Figures in the absence of a trap, eliminating potential side interactions between CMG and the unlabeled trap DNA. DOI: http://dx.doi.org/10.7554/eLife.23449.010

    Techniques Used: Concentration Assay

    CMG requires a 3’ dT 40 /ssDNA tail for loading. . ( A ) Schematic of the substrates used in Figure 2 and in part ( B ) of this Figure. Further details on the oligos used are in Table 1 . The flush duplex oligo is named ‘flush duplex LAG’. The 5’ tailed oligo is ‘50duplex LAG’. The leading strand template is either ‘Paired duplex LEAD + 3’ tail’ or ‘Paired duplex LEAD no 3’ tail’. ( B ) Control experiments to show the requirement for the 3’ dT 40 tail in CMG loading. At left are two helicase assays like those described in Figure 2 but using the substrate containing a 3’ dT 40 tail with the radiolabel on the 5’ tailed duplex. Lanes 1–4 show unwinding in the absence of the flush duplex oligo and lanes 5–8 in the presence of the flush duplex. The % of 5’ tailed oligo unwound is quantified in the graph below the gels, showing that the presence of the flush duplex oligo does not affect CMG loading or unwinding. At right is an identical pair of experiments but with a substrate that does not contain the 3’ dT 40 tail. Lanes 9–12 and the quantitation in the graph below show that unwinding is greatly reduced in the absence of the 3’ tail (compare lanes 9–12 with lanes 1–4), and in the presence of the flush duplex oligo (lanes 13–16) CMG does not load/unwind at all. These experiments support the conclusion of Figure 2 that CMG translocates over flush duplex without unwinding and requires a 3’ dT 40 tail for efficient loading. DOI: http://dx.doi.org/10.7554/eLife.23449.004
    Figure Legend Snippet: CMG requires a 3’ dT 40 /ssDNA tail for loading. . ( A ) Schematic of the substrates used in Figure 2 and in part ( B ) of this Figure. Further details on the oligos used are in Table 1 . The flush duplex oligo is named ‘flush duplex LAG’. The 5’ tailed oligo is ‘50duplex LAG’. The leading strand template is either ‘Paired duplex LEAD + 3’ tail’ or ‘Paired duplex LEAD no 3’ tail’. ( B ) Control experiments to show the requirement for the 3’ dT 40 tail in CMG loading. At left are two helicase assays like those described in Figure 2 but using the substrate containing a 3’ dT 40 tail with the radiolabel on the 5’ tailed duplex. Lanes 1–4 show unwinding in the absence of the flush duplex oligo and lanes 5–8 in the presence of the flush duplex. The % of 5’ tailed oligo unwound is quantified in the graph below the gels, showing that the presence of the flush duplex oligo does not affect CMG loading or unwinding. At right is an identical pair of experiments but with a substrate that does not contain the 3’ dT 40 tail. Lanes 9–12 and the quantitation in the graph below show that unwinding is greatly reduced in the absence of the 3’ tail (compare lanes 9–12 with lanes 1–4), and in the presence of the flush duplex oligo (lanes 13–16) CMG does not load/unwind at all. These experiments support the conclusion of Figure 2 that CMG translocates over flush duplex without unwinding and requires a 3’ dT 40 tail for efficient loading. DOI: http://dx.doi.org/10.7554/eLife.23449.004

    Techniques Used: Quantitation Assay

    Schematics of biotinylated DNA fork substrates. The fork substrates used in the experiments in Figures 3 – 6 are shown including the location of the biotinylated dT nucleotides in either the leading or lagging strand template. The oligos used to make the forked duplex substrates are indicated to the right of the schematics and the oligo sequences and modifications are in Table 1 . DOI: http://dx.doi.org/10.7554/eLife.23449.008
    Figure Legend Snippet: Schematics of biotinylated DNA fork substrates. The fork substrates used in the experiments in Figures 3 – 6 are shown including the location of the biotinylated dT nucleotides in either the leading or lagging strand template. The oligos used to make the forked duplex substrates are indicated to the right of the schematics and the oligo sequences and modifications are in Table 1 . DOI: http://dx.doi.org/10.7554/eLife.23449.008

    Techniques Used:

    4) Product Images from "Depletion of erythropoietic miR-486-5p and miR-451a improves detectability of rare microRNAs in peripheral blood-derived small RNA sequencing libraries"

    Article Title: Depletion of erythropoietic miR-486-5p and miR-451a improves detectability of rare microRNAs in peripheral blood-derived small RNA sequencing libraries

    Journal: bioRxiv

    doi: 10.1101/789891

    Blocking oligonucleotides efficiently suppress miR-486-5p and miR-451a, and increase detectability of other miRNA species in small RNA libraries. ( A ) A bar chart represents quantitative estimates of miR-486-5p and miR-451a in blocked (red) and unblocked (blue) libraries prepared by NEXTflex and TruSeq protocols. The y-axis depicts counts per million (CPM) and it is scaled by square root. The error bars indicate min and max values obtained from replicates. The graph illustrates a high degree suppression of miR-451a and miR-486-5p sequences in blocked NEXTflex and TruSeq libraries; ( B ) A dot plot represents blocking efficiencies (y-axis) of miR-486-5p and miR-451a in NEXTflex and TruSeq libraries. The data points depict mean values, whereas the error bars indicate min and max values obtained from replicates. The overall blocking efficiency is observed to be slightly better in the NEXTflex than in the TruSeq small RNA libraries (Wilcoxon P-value = 0.012); ( C ) A bar chart shows number of detected miRNA species (y-axis) in blocked (red) and unblocked (blue) libraries prepared by NEXTflex and TruSeq protocols. The detectability of miRNAs is increased in both blocked NEXTflex and TruSeq libraries; ( D ) An upset plot representing intersection of uniquely detected miRNA species amongst the set of the four protocols. The highest numbers of uniquely detected miRNAs are found in blocked libraries; ( E ) A line chart illustrates number of detected miRNAs (y-axis) in subsamples (x-axis; scaled by square root) of down-sampled libraries prepared by different protocols. The data points represent mean values, whereas the error bars depict standard errors of the mean. The graph displays a steady increase of detected miRNAs over the increasing size of subsampled miRNA counts.
    Figure Legend Snippet: Blocking oligonucleotides efficiently suppress miR-486-5p and miR-451a, and increase detectability of other miRNA species in small RNA libraries. ( A ) A bar chart represents quantitative estimates of miR-486-5p and miR-451a in blocked (red) and unblocked (blue) libraries prepared by NEXTflex and TruSeq protocols. The y-axis depicts counts per million (CPM) and it is scaled by square root. The error bars indicate min and max values obtained from replicates. The graph illustrates a high degree suppression of miR-451a and miR-486-5p sequences in blocked NEXTflex and TruSeq libraries; ( B ) A dot plot represents blocking efficiencies (y-axis) of miR-486-5p and miR-451a in NEXTflex and TruSeq libraries. The data points depict mean values, whereas the error bars indicate min and max values obtained from replicates. The overall blocking efficiency is observed to be slightly better in the NEXTflex than in the TruSeq small RNA libraries (Wilcoxon P-value = 0.012); ( C ) A bar chart shows number of detected miRNA species (y-axis) in blocked (red) and unblocked (blue) libraries prepared by NEXTflex and TruSeq protocols. The detectability of miRNAs is increased in both blocked NEXTflex and TruSeq libraries; ( D ) An upset plot representing intersection of uniquely detected miRNA species amongst the set of the four protocols. The highest numbers of uniquely detected miRNAs are found in blocked libraries; ( E ) A line chart illustrates number of detected miRNAs (y-axis) in subsamples (x-axis; scaled by square root) of down-sampled libraries prepared by different protocols. The data points represent mean values, whereas the error bars depict standard errors of the mean. The graph displays a steady increase of detected miRNAs over the increasing size of subsampled miRNA counts.

    Techniques Used: Blocking Assay

    Blocking oligonucleotides for miR-486-5p and miR-451a have positive and some negative effects on measured expression of non-targeted miRNAs. ( A ) A density chart shows distributions of averaged log2-transformed CPM values of blocked (red) and unblocked (blue) libraries prepared by NEXTflex and TruSeq protocols. The expression values of each miRNA were averaged per protocol (x-axis). The graph illustrates a proportional global shift of log2-transformed CPM values towards higher expression estimates in both blocked NEXTflex and TruSeq libraries; ( B ) A scatter plot represents correlation of log2-transformed CPM values of paired blocked (y-axis) and unblocked (x-axis) exemplary libraries generated by NEXTflex and TruSeq protocols. The red dashed line divides panel in two equal parts, whereas the grey dashed line displays a linear regression curve. The chart illustrates a high concordance of miRNA expression values between blocked and unblocked paired libraries; ( C ) An MA plot shows paired-differential expression analysis results of blocked versus unblocked libraries, where log2 fold changes are presented on the y-axis and averaged normalized counts on the x-axis. The red colored dots indicate significantly differentially expressed miRNAs (corrected P-value
    Figure Legend Snippet: Blocking oligonucleotides for miR-486-5p and miR-451a have positive and some negative effects on measured expression of non-targeted miRNAs. ( A ) A density chart shows distributions of averaged log2-transformed CPM values of blocked (red) and unblocked (blue) libraries prepared by NEXTflex and TruSeq protocols. The expression values of each miRNA were averaged per protocol (x-axis). The graph illustrates a proportional global shift of log2-transformed CPM values towards higher expression estimates in both blocked NEXTflex and TruSeq libraries; ( B ) A scatter plot represents correlation of log2-transformed CPM values of paired blocked (y-axis) and unblocked (x-axis) exemplary libraries generated by NEXTflex and TruSeq protocols. The red dashed line divides panel in two equal parts, whereas the grey dashed line displays a linear regression curve. The chart illustrates a high concordance of miRNA expression values between blocked and unblocked paired libraries; ( C ) An MA plot shows paired-differential expression analysis results of blocked versus unblocked libraries, where log2 fold changes are presented on the y-axis and averaged normalized counts on the x-axis. The red colored dots indicate significantly differentially expressed miRNAs (corrected P-value

    Techniques Used: Blocking Assay, Expressing, Transformation Assay, Generated

    Blocking oligo design and application workflows using modified TruSeq and NEXTflex small RNA library preparation protocols. ( A ) Design principle of miR-486-5p and miR-451a blocking oligonucleotides. Briefly, unique pooled-sample sequences which mapped to precursors of miR-486-5p and miR-451a were used to retrieve the most frequent nucleotide found at each position in a sequence alignment. The most stable consensus sequences were used to generate reverse complement DNA oligonucleotides of targeted miRNAs. The C3 spacer (propyl group) modification was added to the 3’ ends of the synthetic oligonucleotides to avoid self-ligation. Whole blood smRNA-seq data used for oligo design was obtained from GSE100467; ( B ) A schematic representation of modified Illumina’s TruSeq small RNA library preparation protocol. The modified protocol involves an additional step, where synthetic blocking oligonucleotides are introduced right before the 5’ adapter ligation reaction. In this step, the blocking oligonucleotides are annealed to target miRNAs, which results in double-stranded RNA:DNA hybrid formation. These blunt-ended or slight 3’ DNA overhang-having double-stranded hybrids are not suitable substrates for T4 RNA ligase-mediated addition of adapter oligonucleotide to the 5’ end of RNA strand in the hybrid. As a consequence, blocked RNA:DNA hybrids without 5’ adapter sequences cannot be amplified and therefore are depleted from final small RNA library; ( C ) A schematic workflow of modified Perkin Elmer’s NEXTflex small RNA library preparation protocol. In comparison to TruSeq, the standard NEXTflex protocol includes an extra step called 3’ adapter inactivation, where end-filling is performed to fill the gaps of random nucleotides bearing 5’ overhang portions of 3’ adapter duplexes. Because of this step, in order to avoid denaturation of the 3’ adapter duplexes, blocking oligos for miR-486-5p and miR-451a were introduced directly to total RNA sample.
    Figure Legend Snippet: Blocking oligo design and application workflows using modified TruSeq and NEXTflex small RNA library preparation protocols. ( A ) Design principle of miR-486-5p and miR-451a blocking oligonucleotides. Briefly, unique pooled-sample sequences which mapped to precursors of miR-486-5p and miR-451a were used to retrieve the most frequent nucleotide found at each position in a sequence alignment. The most stable consensus sequences were used to generate reverse complement DNA oligonucleotides of targeted miRNAs. The C3 spacer (propyl group) modification was added to the 3’ ends of the synthetic oligonucleotides to avoid self-ligation. Whole blood smRNA-seq data used for oligo design was obtained from GSE100467; ( B ) A schematic representation of modified Illumina’s TruSeq small RNA library preparation protocol. The modified protocol involves an additional step, where synthetic blocking oligonucleotides are introduced right before the 5’ adapter ligation reaction. In this step, the blocking oligonucleotides are annealed to target miRNAs, which results in double-stranded RNA:DNA hybrid formation. These blunt-ended or slight 3’ DNA overhang-having double-stranded hybrids are not suitable substrates for T4 RNA ligase-mediated addition of adapter oligonucleotide to the 5’ end of RNA strand in the hybrid. As a consequence, blocked RNA:DNA hybrids without 5’ adapter sequences cannot be amplified and therefore are depleted from final small RNA library; ( C ) A schematic workflow of modified Perkin Elmer’s NEXTflex small RNA library preparation protocol. In comparison to TruSeq, the standard NEXTflex protocol includes an extra step called 3’ adapter inactivation, where end-filling is performed to fill the gaps of random nucleotides bearing 5’ overhang portions of 3’ adapter duplexes. Because of this step, in order to avoid denaturation of the 3’ adapter duplexes, blocking oligos for miR-486-5p and miR-451a were introduced directly to total RNA sample.

    Techniques Used: Blocking Assay, Modification, Sequencing, Ligation, Amplification

    5) Product Images from "High Glucose–Induced Hypomethylation Promotes Binding of Sp-1 to Myo-Inositol Oxygenase"

    Article Title: High Glucose–Induced Hypomethylation Promotes Binding of Sp-1 to Myo-Inositol Oxygenase

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2016.12.011

    Identification of transcription factor specificity protein (Sp)-1–binding site in the human MIOX promoter and effect of in vitro methylation on the binding with nucleoproteins. Eletrophoretic mobility shift assays using Sp-1 and differentially methylated segment (DMS) oligos (DMS1 includes CpG sites -784 and -787 and DMS2 includes -581). A: An increased binding of Sp-1 is observed under high-glucose ambience (30 mmol/L) when the Sp-1 oligo is differentially demethylated or unmethylated ( arrowhead ). No binding of methylated or demethylated oligos is observed under low-glucose (5 mmol/L) ambience. B and C: Likewise an increased binding of unmethylated DMS1 and DMS2 oligos is observed under high-glucose ambience ( arrowhead ). The binding is also seen under low-glucose ambience; nevertheless, binding with unmethylated oligos (Sp-1, DMS1, and DMS2) under high-glucose ambience is much stronger. The arrows and asterisks indicate the nonspecific bands in the autoradiograms.
    Figure Legend Snippet: Identification of transcription factor specificity protein (Sp)-1–binding site in the human MIOX promoter and effect of in vitro methylation on the binding with nucleoproteins. Eletrophoretic mobility shift assays using Sp-1 and differentially methylated segment (DMS) oligos (DMS1 includes CpG sites -784 and -787 and DMS2 includes -581). A: An increased binding of Sp-1 is observed under high-glucose ambience (30 mmol/L) when the Sp-1 oligo is differentially demethylated or unmethylated ( arrowhead ). No binding of methylated or demethylated oligos is observed under low-glucose (5 mmol/L) ambience. B and C: Likewise an increased binding of unmethylated DMS1 and DMS2 oligos is observed under high-glucose ambience ( arrowhead ). The binding is also seen under low-glucose ambience; nevertheless, binding with unmethylated oligos (Sp-1, DMS1, and DMS2) under high-glucose ambience is much stronger. The arrows and asterisks indicate the nonspecific bands in the autoradiograms.

    Techniques Used: Binding Assay, In Vitro, Methylation, Mobility Shift

    6) Product Images from "Rapid and dynamic nucleic acid hybridization enables enzymatic oligonucleotide synthesis by cyclic reversible termination: A novel mechanism for enzymatic DNA synthesis"

    Article Title: Rapid and dynamic nucleic acid hybridization enables enzymatic oligonucleotide synthesis by cyclic reversible termination: A novel mechanism for enzymatic DNA synthesis

    Journal: bioRxiv

    doi: 10.1101/561092

    Dynamic hybridization of DNA enables EOS. (a) Extension of single-stranded DNA by DNA polymerases and reverse transcriptases. Denaturing PAGE analysis of a 20 base single-stranded sequence, self-priming oligo-1 aka SPO-1, using different enzymes and dGTP. Despite a maximum of two bases of hybridization, some enzymes are able to extend this solid-phase oligonucleotide. None of these enzymes have previously been reported to have nucleotidyl transferase activity on single-stranded DNA. (b) Sequence-specific extension of single-stranded DNA. Duplase extension of four different 20 base oligos proceeds in a sequence-specific manner, and only two bases of hybridization are required for extension. * indicates unextended control. Extension with non-templated bases can be explained by misincorporation that occurs at long reaction times . (c) Extension of solid-phase oligos through intermolecular reactions. Magnetic beads were conjugated with either a 20 base poly-T oligo as illustrated in i, or with that oligo plus a 30 base poly-T oligo with an internal 5’-CAA-3’ sequence as illustrated in ii . Beads were extended using Duplase-3 and Cy5-ddGTP (* indicates unextended control during this step), after which, all samples were labeled with TdT and fluorescein-12-ddUTP. Oligos appear blue if extended with Duplase-3 and green if extended wtih TdT.
    Figure Legend Snippet: Dynamic hybridization of DNA enables EOS. (a) Extension of single-stranded DNA by DNA polymerases and reverse transcriptases. Denaturing PAGE analysis of a 20 base single-stranded sequence, self-priming oligo-1 aka SPO-1, using different enzymes and dGTP. Despite a maximum of two bases of hybridization, some enzymes are able to extend this solid-phase oligonucleotide. None of these enzymes have previously been reported to have nucleotidyl transferase activity on single-stranded DNA. (b) Sequence-specific extension of single-stranded DNA. Duplase extension of four different 20 base oligos proceeds in a sequence-specific manner, and only two bases of hybridization are required for extension. * indicates unextended control. Extension with non-templated bases can be explained by misincorporation that occurs at long reaction times . (c) Extension of solid-phase oligos through intermolecular reactions. Magnetic beads were conjugated with either a 20 base poly-T oligo as illustrated in i, or with that oligo plus a 30 base poly-T oligo with an internal 5’-CAA-3’ sequence as illustrated in ii . Beads were extended using Duplase-3 and Cy5-ddGTP (* indicates unextended control during this step), after which, all samples were labeled with TdT and fluorescein-12-ddUTP. Oligos appear blue if extended with Duplase-3 and green if extended wtih TdT.

    Techniques Used: Hybridization, Polyacrylamide Gel Electrophoresis, Sequencing, Activity Assay, Magnetic Beads, Labeling

    Related Articles

    Staining:

    Article Title: Rapid and dynamic nucleic acid hybridization enables enzymatic oligonucleotide synthesis by cyclic reversible termination: A novel mechanism for enzymatic DNA synthesis
    Article Snippet: .. Fluorescent labeling of oligos with terminal deoxynucleotidyl transferase (TdT) Labeling of poly-T sequences, which do not stain well with SYBR Gold, was accomplished by end-labeling oligos with TdT (New England Biolabs, Ipswich, MA) and fluorescein-12-ddUTP (Perkin Elmer, San Jose, CA) by incubating 0.1mg of beads with 5μM nucleotide and 20U of enzyme in 20mM Tris-HCl pH7.5, 10mM ammonium sulfate, 10mM KCl, 0.1% Triton X-100, and 0.5mM MnCl2. ..

    Magnetic Beads:

    Article Title: An mRNA-binding channel in the ES6S region of the translation 48S-PIC promotes RNA unwinding and scanning
    Article Snippet: .. After 30 min crosslinking at 254 nm, WRFs were resuspended in buffer D (Tris-HCl 30 mM [pH 7.5], 0.5 M LiCl, 0.5% LiDS, 0.5 mM EDTA and 1 mM DTT) and poly(A)+ mRNA was captured with oligo(dT) magnetic beads (NEB) under denaturing conditions as described above. ..

    Article Title: Local regulation of gene expression by lncRNA promoters, transcription, and splicing
    Article Snippet: .. We enriched for poly(A)+ RNA using oligo d(T)25 magnetic beads (NEB) and eluted in 18 μl H2 O. .. We fragmented RNA to an average of ~150-nt by adding 2 μl Ambion Fragmentation Buffer and incubating at 70°C for exactly 2.5 minutes.

    Article Title: An mRNA-binding channel in the ES6S region of the translation 48S-PIC promotes RNA unwinding and scanning
    Article Snippet: .. After UV crosslinking at 360 nm, the WRF was denatured in 500 μl buffer D (Tris-HCl 30 mM [pH 7.5], 0.5 M LiCl, 0.5% LiDS, 0.5 mM EDTA and 1 mM DTT) and poly(A)+ mRNA was captured with oligo(dT) magnetic beads (NEB) under denaturing conditions. .. After extensive washing, RNA was eluted with 100 μl H2 O and concentrated by ethanol precipitation in the presence of glycogen.

    Article Title: An RNA trapping mechanism in Alphavirus mRNA promotes ribosome stalling and translation initiation
    Article Snippet: .. The complexes were crosslinked, centrifuged at high speed and ribosomal pellets were resuspended in cracking buffer (25 mM Tris-HCl pH 7.5, 0.5 M LiCl, 0.5% LiDS, 1 mM EDTA and 5 mM DTT). mRNA poly(A)+ was bound to oligo (dT)25 magnetic beads (NEB) at RT for 20 min. Beads were extensively washed according to the manufacturer's recommendations and eluted in TE buffer by heating the samples at 60°C for 10 min. RNA was extracted with phenol, precipitated with ethanol and resuspended in 15 μl of TE buffer. ..

    Labeling:

    Article Title: Rapid and dynamic nucleic acid hybridization enables enzymatic oligonucleotide synthesis by cyclic reversible termination: A novel mechanism for enzymatic DNA synthesis
    Article Snippet: .. Fluorescent labeling of oligos with terminal deoxynucleotidyl transferase (TdT) Labeling of poly-T sequences, which do not stain well with SYBR Gold, was accomplished by end-labeling oligos with TdT (New England Biolabs, Ipswich, MA) and fluorescein-12-ddUTP (Perkin Elmer, San Jose, CA) by incubating 0.1mg of beads with 5μM nucleotide and 20U of enzyme in 20mM Tris-HCl pH7.5, 10mM ammonium sulfate, 10mM KCl, 0.1% Triton X-100, and 0.5mM MnCl2. ..

    Article Title: Molecular Factors Affecting the Accumulation of Recombinant Proteins in the Chlamydomonas reinhardtii Chloroplast
    Article Snippet: .. Twenty picomoles of the following oligos: 5′-gcaataccgtcacctacttgg-3′ (for atpA ) and 5′-ccataagttgcgtcacc-3′ (for gfp ) were labeled with T4 polynucleotide kinase (20 U, New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions. .. Labeled oligos were purified from unincorporated radioactive isotope using Quick Spin Sephadex G-25 columns (Roche).

    End Labeling:

    Article Title: Rapid and dynamic nucleic acid hybridization enables enzymatic oligonucleotide synthesis by cyclic reversible termination: A novel mechanism for enzymatic DNA synthesis
    Article Snippet: .. Fluorescent labeling of oligos with terminal deoxynucleotidyl transferase (TdT) Labeling of poly-T sequences, which do not stain well with SYBR Gold, was accomplished by end-labeling oligos with TdT (New England Biolabs, Ipswich, MA) and fluorescein-12-ddUTP (Perkin Elmer, San Jose, CA) by incubating 0.1mg of beads with 5μM nucleotide and 20U of enzyme in 20mM Tris-HCl pH7.5, 10mM ammonium sulfate, 10mM KCl, 0.1% Triton X-100, and 0.5mM MnCl2. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs pri mir 150 primers
    MiR-122 blocks the primary miR-21 processing by in vitro <t>pri-miRNA</t> processing assay. ( A ) Schematic illustration of pri-miR-21 in vitro processing assay strategy. ( B ) For immunoprecipitation (IP) assays, Huh-7 cell lysates were incubated with anti-Drosha antibody and IgG control antibody, The IP-product was then detected by western blotting (WB) using anti-Drosha and anti-DGCR8 antibody. ( C ) Northern blotting analysis of the miR-122 blocking in vitro processing of the pri-miR-21-WT and pri-miR-21-MUT. The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by Drosha-complex in vitro . The in vitro processing products were analyzed by northern blot. ( D ) RT-qPCR validation of pre-miR-21 level in processing products. ( E ) The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. ( F ) An unrelated <t>pri-miR-150</t> was incubation of synthetic mature single strand miR-122 and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. The results are presented as the mean ± SD ( N = 3) of three independent experiments. ** P
    Pri Mir 150 Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pri mir 150 primers/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pri mir 150 primers - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    89
    New England Biolabs primers f1
    —Circularization and polishing of the w AlbB genome assembly and determination of oriC . De novo assembly of PacBio data produced a single contig representing the w AlbB genome, with terminal regions marked A1 and A2 in ( A ), showing high sequence identity over a 27 kb region, suggesting overlapping ends of a circular chromosome. They were therefore collapsed into a single consensus region “A” to represent the circular the chromosome, with the junction of circularization between regions A and B indicated by a blue arrow ( B ). This draft circular genome was polished using the PacBio ReSequencing.1 pipeline, and the junction of circularization was validated by Sanger sequencing of a 1.5 kb amplicon ( C ) produced by <t>primers</t> F1 and R1. The origin of the circular chromosome was reset to the beginning of the oriC locus. The permuted chromosome sequence was again polished using ReSequencing.1 pipeline in SMRT analysis software. The oriC sequence and the new junction of circularization at oriC was verified by primers F2 and R2 ( A and B ) that successfully produced an amplicon of correct size 1.5 kb ( C ) and correct sequence as confirmed by Sanger sequencing. The oriC locus in w AlbB has all the hallmarks observed in other Wolbachia oriC sequences, such as flanking genes tlyC and hemE , three DnaA binding sites, four IHF binding sites and one CtrA binding site ( D ). All PCR were performed on four independent DNA samples.
    Primers F1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers f1/product/New England Biolabs
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    primers f1 - by Bioz Stars, 2020-10
    89/100 stars
      Buy from Supplier

    85
    New England Biolabs oligonucleotide 22fork3
    Activated and poly(ADP-ribosyl)ated PARP-1 does not inhibit WRN catalytic activities. ( A ) PARP-1 (500 ng) and NAD + (100 μM) as indicated were incubated with an unlabeled forked duplex for 10 min at room temperature. Western blot analysis was performed using anti-PARP-1 (left panel) or anti-PAR (right panel) antibodies. ( B ) WRN (7.5 nM, lanes 2 to 4) and a radiolabeled 34 bp forked duplex (10 fmol, 34ForkA/34ForkB) were incubated with aliquots from the reactions performed in (A) containing PARP-1 (lane 2), PARP-1 and NAD + (lane 3), or NAD + (lane 4) for 15 min at 37°C. Lane 1, no enzyme. Products were heat-denatured for 5 min at 95°C, run on a 14% denaturing polyacrylamide gel, and visualized using a PhosphorImager. ( C ) Aliquots from the reactions performed in (A) containing PARP-1 (lanes 3 and 6), PARP-1 and NAD + (lanes 4 and 7), or NAD + (lanes 5 and 8) were incubated with a radiolabeled 22 bp forked duplex (20 fmol, <t>22Fork3/22Fork4)</t> in the absence (lanes 3 to 5) or presence (lanes 6 to 8) of WRN (1 nM) for 15 min at 37°C. Lane 1, heat-denatured substrate. Lane 2, no enzyme. Products were run on a 12% native polyacrylamide gel and visualized using a PhosphorImager.
    Oligonucleotide 22fork3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide 22fork3/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide 22fork3 - by Bioz Stars, 2020-10
    85/100 stars
      Buy from Supplier

    85
    New England Biolabs 15 nt rna oligos
    LASV NP exoribonuclease activity preferentially degrades dsRNA substrates. Various concentrations of purified full-length NP, C-terminal domain of NP ( NP-C ), and a catalytic mutant ( NP-D389A ) were incubated at 37 °C for 60 min with a 5′ 32 P-labeled <t>15-nt</t> <t>RNA</t> oligo of either ss or ds forms (“Experimental Procedures”). The products were separated in a 17% urea-polyacrylamide gel and exposed to films. A representative gel of at least three independent experiments was shown.
    15 Nt Rna Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/15 nt rna oligos/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    15 nt rna oligos - by Bioz Stars, 2020-10
    85/100 stars
      Buy from Supplier

    Image Search Results


    MiR-122 blocks the primary miR-21 processing by in vitro pri-miRNA processing assay. ( A ) Schematic illustration of pri-miR-21 in vitro processing assay strategy. ( B ) For immunoprecipitation (IP) assays, Huh-7 cell lysates were incubated with anti-Drosha antibody and IgG control antibody, The IP-product was then detected by western blotting (WB) using anti-Drosha and anti-DGCR8 antibody. ( C ) Northern blotting analysis of the miR-122 blocking in vitro processing of the pri-miR-21-WT and pri-miR-21-MUT. The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by Drosha-complex in vitro . The in vitro processing products were analyzed by northern blot. ( D ) RT-qPCR validation of pre-miR-21 level in processing products. ( E ) The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. ( F ) An unrelated pri-miR-150 was incubation of synthetic mature single strand miR-122 and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. The results are presented as the mean ± SD ( N = 3) of three independent experiments. ** P

    Journal: Nucleic Acids Research

    Article Title: Nuclear miR-122 directly regulates the biogenesis of cell survival oncomiR miR-21 at the posttranscriptional level

    doi: 10.1093/nar/gkx1254

    Figure Lengend Snippet: MiR-122 blocks the primary miR-21 processing by in vitro pri-miRNA processing assay. ( A ) Schematic illustration of pri-miR-21 in vitro processing assay strategy. ( B ) For immunoprecipitation (IP) assays, Huh-7 cell lysates were incubated with anti-Drosha antibody and IgG control antibody, The IP-product was then detected by western blotting (WB) using anti-Drosha and anti-DGCR8 antibody. ( C ) Northern blotting analysis of the miR-122 blocking in vitro processing of the pri-miR-21-WT and pri-miR-21-MUT. The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by Drosha-complex in vitro . The in vitro processing products were analyzed by northern blot. ( D ) RT-qPCR validation of pre-miR-21 level in processing products. ( E ) The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. ( F ) An unrelated pri-miR-150 was incubation of synthetic mature single strand miR-122 and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. The results are presented as the mean ± SD ( N = 3) of three independent experiments. ** P

    Article Snippet: The pri-miRNA substrates were then amplified by pri-miR-21 and pri-miR-150 primers using Q5 High-Fidelity 2X Master Mix (New England BioLabs, M0492S) according to the manufacturer's protocol.

    Techniques: In Vitro, Immunoprecipitation, Incubation, Western Blot, Northern Blot, Blocking Assay, Quantitative RT-PCR

    —Circularization and polishing of the w AlbB genome assembly and determination of oriC . De novo assembly of PacBio data produced a single contig representing the w AlbB genome, with terminal regions marked A1 and A2 in ( A ), showing high sequence identity over a 27 kb region, suggesting overlapping ends of a circular chromosome. They were therefore collapsed into a single consensus region “A” to represent the circular the chromosome, with the junction of circularization between regions A and B indicated by a blue arrow ( B ). This draft circular genome was polished using the PacBio ReSequencing.1 pipeline, and the junction of circularization was validated by Sanger sequencing of a 1.5 kb amplicon ( C ) produced by primers F1 and R1. The origin of the circular chromosome was reset to the beginning of the oriC locus. The permuted chromosome sequence was again polished using ReSequencing.1 pipeline in SMRT analysis software. The oriC sequence and the new junction of circularization at oriC was verified by primers F2 and R2 ( A and B ) that successfully produced an amplicon of correct size 1.5 kb ( C ) and correct sequence as confirmed by Sanger sequencing. The oriC locus in w AlbB has all the hallmarks observed in other Wolbachia oriC sequences, such as flanking genes tlyC and hemE , three DnaA binding sites, four IHF binding sites and one CtrA binding site ( D ). All PCR were performed on four independent DNA samples.

    Journal: Genome Biology and Evolution

    Article Title: Complete Genome Sequence of the Wolbachia wAlbB Endosymbiont of Aedes albopictus

    doi: 10.1093/gbe/evz025

    Figure Lengend Snippet: —Circularization and polishing of the w AlbB genome assembly and determination of oriC . De novo assembly of PacBio data produced a single contig representing the w AlbB genome, with terminal regions marked A1 and A2 in ( A ), showing high sequence identity over a 27 kb region, suggesting overlapping ends of a circular chromosome. They were therefore collapsed into a single consensus region “A” to represent the circular the chromosome, with the junction of circularization between regions A and B indicated by a blue arrow ( B ). This draft circular genome was polished using the PacBio ReSequencing.1 pipeline, and the junction of circularization was validated by Sanger sequencing of a 1.5 kb amplicon ( C ) produced by primers F1 and R1. The origin of the circular chromosome was reset to the beginning of the oriC locus. The permuted chromosome sequence was again polished using ReSequencing.1 pipeline in SMRT analysis software. The oriC sequence and the new junction of circularization at oriC was verified by primers F2 and R2 ( A and B ) that successfully produced an amplicon of correct size 1.5 kb ( C ) and correct sequence as confirmed by Sanger sequencing. The oriC locus in w AlbB has all the hallmarks observed in other Wolbachia oriC sequences, such as flanking genes tlyC and hemE , three DnaA binding sites, four IHF binding sites and one CtrA binding site ( D ). All PCR were performed on four independent DNA samples.

    Article Snippet: Primers F1 (5′TCCCCTGCCCTACCTGAGTA3′) and R1 (5′GTCATCATCCTGCGCGAGAG3′) were used to amplify a 1,599 bp fragment that spans the junction of circularization; primers F2 (5′TGTTGCTTTCATTGAGGCTGGT3′) and R2 (5′TATTGGACCCACACCGCGAA3′) were used to amplify a 1,081 bp fragment to verify the oriC sequence, using the Q5 HiFi PCR master mix (NEB M0543) following manufacturer’s instructions.

    Techniques: Produced, Sequencing, Amplification, Software, Binding Assay, Immunohistofluorescence, Polymerase Chain Reaction

    Activated and poly(ADP-ribosyl)ated PARP-1 does not inhibit WRN catalytic activities. ( A ) PARP-1 (500 ng) and NAD + (100 μM) as indicated were incubated with an unlabeled forked duplex for 10 min at room temperature. Western blot analysis was performed using anti-PARP-1 (left panel) or anti-PAR (right panel) antibodies. ( B ) WRN (7.5 nM, lanes 2 to 4) and a radiolabeled 34 bp forked duplex (10 fmol, 34ForkA/34ForkB) were incubated with aliquots from the reactions performed in (A) containing PARP-1 (lane 2), PARP-1 and NAD + (lane 3), or NAD + (lane 4) for 15 min at 37°C. Lane 1, no enzyme. Products were heat-denatured for 5 min at 95°C, run on a 14% denaturing polyacrylamide gel, and visualized using a PhosphorImager. ( C ) Aliquots from the reactions performed in (A) containing PARP-1 (lanes 3 and 6), PARP-1 and NAD + (lanes 4 and 7), or NAD + (lanes 5 and 8) were incubated with a radiolabeled 22 bp forked duplex (20 fmol, 22Fork3/22Fork4) in the absence (lanes 3 to 5) or presence (lanes 6 to 8) of WRN (1 nM) for 15 min at 37°C. Lane 1, heat-denatured substrate. Lane 2, no enzyme. Products were run on a 12% native polyacrylamide gel and visualized using a PhosphorImager.

    Journal: Nucleic Acids Research

    Article Title: Poly(ADP-ribose) polymerase 1 regulates both the exonuclease and helicase activities of the Werner syndrome protein

    doi: 10.1093/nar/gkh721

    Figure Lengend Snippet: Activated and poly(ADP-ribosyl)ated PARP-1 does not inhibit WRN catalytic activities. ( A ) PARP-1 (500 ng) and NAD + (100 μM) as indicated were incubated with an unlabeled forked duplex for 10 min at room temperature. Western blot analysis was performed using anti-PARP-1 (left panel) or anti-PAR (right panel) antibodies. ( B ) WRN (7.5 nM, lanes 2 to 4) and a radiolabeled 34 bp forked duplex (10 fmol, 34ForkA/34ForkB) were incubated with aliquots from the reactions performed in (A) containing PARP-1 (lane 2), PARP-1 and NAD + (lane 3), or NAD + (lane 4) for 15 min at 37°C. Lane 1, no enzyme. Products were heat-denatured for 5 min at 95°C, run on a 14% denaturing polyacrylamide gel, and visualized using a PhosphorImager. ( C ) Aliquots from the reactions performed in (A) containing PARP-1 (lanes 3 and 6), PARP-1 and NAD + (lanes 4 and 7), or NAD + (lanes 5 and 8) were incubated with a radiolabeled 22 bp forked duplex (20 fmol, 22Fork3/22Fork4) in the absence (lanes 3 to 5) or presence (lanes 6 to 8) of WRN (1 nM) for 15 min at 37°C. Lane 1, heat-denatured substrate. Lane 2, no enzyme. Products were run on a 12% native polyacrylamide gel and visualized using a PhosphorImager.

    Article Snippet: Briefly, oligonucleotide 22Fork3 (Table ) was 5′ end-labeled with [γ-32 P]ATP and T4 polynucleotide kinase (New England Biolabs) and annealed to its unlabeled complementary oligonucleotide 22Fork4.

    Techniques: Incubation, Western Blot

    The effect of PARP-1 and PARP-2 on WRN helicase activity. ( A ) Reactions containing WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) in the absence or presence of PARP-1 were incubated with a 22 bp forked substrate (0.5 nM, 22Fork3/22Fork4) for 15 min at 37°C. The concentrations of PARP-1 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reaction products were run on a 12% native gel and visualized using a PhosphorImager. %D, percentage of single-stranded product displaced. ( B ) WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) was incubated in the absence or presence of PARP-2 for 15 min at 37°C with a 22 bp forked duplex substrate (0.5 nM, 22Fork3/22Fork4). Concentrations of PARP-2 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reactions were analyzed as above.

    Journal: Nucleic Acids Research

    Article Title: Poly(ADP-ribose) polymerase 1 regulates both the exonuclease and helicase activities of the Werner syndrome protein

    doi: 10.1093/nar/gkh721

    Figure Lengend Snippet: The effect of PARP-1 and PARP-2 on WRN helicase activity. ( A ) Reactions containing WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) in the absence or presence of PARP-1 were incubated with a 22 bp forked substrate (0.5 nM, 22Fork3/22Fork4) for 15 min at 37°C. The concentrations of PARP-1 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reaction products were run on a 12% native gel and visualized using a PhosphorImager. %D, percentage of single-stranded product displaced. ( B ) WRN (0.25 nM, lanes 3 to 7; or 0.5 nM, lanes 8 to 12) was incubated in the absence or presence of PARP-2 for 15 min at 37°C with a 22 bp forked duplex substrate (0.5 nM, 22Fork3/22Fork4). Concentrations of PARP-2 were 4 nM (lane 2), 0.25, 0.5, 1 and 2 nM (lanes 4 to 7, respectively), and 0.5, 1, 2 and 4 nM (lanes 9 to 12, respectively). Lane 1, substrate only. Lane 13, heat-denatured substrate. Reactions were analyzed as above.

    Article Snippet: Briefly, oligonucleotide 22Fork3 (Table ) was 5′ end-labeled with [γ-32 P]ATP and T4 polynucleotide kinase (New England Biolabs) and annealed to its unlabeled complementary oligonucleotide 22Fork4.

    Techniques: Activity Assay, Incubation

    LASV NP exoribonuclease activity preferentially degrades dsRNA substrates. Various concentrations of purified full-length NP, C-terminal domain of NP ( NP-C ), and a catalytic mutant ( NP-D389A ) were incubated at 37 °C for 60 min with a 5′ 32 P-labeled 15-nt RNA oligo of either ss or ds forms (“Experimental Procedures”). The products were separated in a 17% urea-polyacrylamide gel and exposed to films. A representative gel of at least three independent experiments was shown.

    Journal: The Journal of Biological Chemistry

    Article Title: Structures of Arenaviral Nucleoproteins with Triphosphate dsRNA Reveal a Unique Mechanism of Immune Suppression *

    doi: 10.1074/jbc.M112.420521

    Figure Lengend Snippet: LASV NP exoribonuclease activity preferentially degrades dsRNA substrates. Various concentrations of purified full-length NP, C-terminal domain of NP ( NP-C ), and a catalytic mutant ( NP-D389A ) were incubated at 37 °C for 60 min with a 5′ 32 P-labeled 15-nt RNA oligo of either ss or ds forms (“Experimental Procedures”). The products were separated in a 17% urea-polyacrylamide gel and exposed to films. A representative gel of at least three independent experiments was shown.

    Article Snippet: The 15-nt RNA oligos used in the in vitro RNase assay, 5′-AGUAGAAACAAGGCC-3′, were chemically synthesized, and 5′ labeled with [γ-32 P]ATP using a T4 polynucleotide kinase (New England Biolabs).

    Techniques: Activity Assay, Purification, Mutagenesis, Incubation, Labeling