Structured Review

Millipore oligos
Oligos, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligos/product/Millipore
Average 95 stars, based on 1 article reviews
Price from $9.99 to $1999.99
oligos - by Bioz Stars, 2020-04
95/100 stars

Images

Related Articles

Clone Assay:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: .. To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen). .. The coding sequences of hASF and dASF were inserted in frame upstream of a histidine tag sequence into pVL1393 transfer vector (Invitrogen), and recombinant proteins were produced and purified from baculovirus-infected Sf9 cells as described previously ( , ).

Amplification:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: .. To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen). .. The coding sequences of hASF and dASF were inserted in frame upstream of a histidine tag sequence into pVL1393 transfer vector (Invitrogen), and recombinant proteins were produced and purified from baculovirus-infected Sf9 cells as described previously ( , ).

Synthesized:

Article Title: Use of a bioengineered antioxidant in mouse models of metabolic syndrome.
Article Snippet: .. < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic. ..

Real-time Polymerase Chain Reaction:

Article Title: Use of a bioengineered antioxidant in mouse models of metabolic syndrome.
Article Snippet: < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic. .. < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic.

Microarray:

Article Title: Systematic reconstruction of RNA functional motifs with high throughput microfluidics
Article Snippet: Paragraph title: Microarray preparation ... After annealing, the oligos were diluted 1000-fold and re-suspended in a final concentration of 10 mg/mL BSA (Sigma, 100 mg/mL stock) for array spotting.

Incubation:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA). ..

Transformation Assay:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: .. To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen). .. The coding sequences of hASF and dASF were inserted in frame upstream of a histidine tag sequence into pVL1393 transfer vector (Invitrogen), and recombinant proteins were produced and purified from baculovirus-infected Sf9 cells as described previously ( , ).

Activated Clotting Time Assay:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Murine ARRE-2: 5′ CAA AGA GGA AAA TTT GTT TCA TAC AG; human ARRE-2: 5′ CAA AGA GGA AAA ACT GTT TCA TAC AG; AP-1: 5′ CGC TTG ATG ACT CAG CCG GAA; κ3: 5′ GAG CTC ATG GGT TTC TCC ACC and GM-330: 5′ CCC CCA TCG GAG CCC CTG AGT CAG CAT GGC G. Fifty nanograms of oligonucleotides were labeled for 1 h at 37C with T4 polynucleotide kinase (10 U; New England Biolabs) and 50 μCi [γ32 ] dATP (Perkin-Elmer). .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Countercurrent Chromatography:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Murine ARRE-2: 5′ CAA AGA GGA AAA TTT GTT TCA TAC AG; human ARRE-2: 5′ CAA AGA GGA AAA ACT GTT TCA TAC AG; AP-1: 5′ CGC TTG ATG ACT CAG CCG GAA; κ3: 5′ GAG CTC ATG GGT TTC TCC ACC and GM-330: 5′ CCC CCA TCG GAG CCC CTG AGT CAG CAT GGC G. Fifty nanograms of oligonucleotides were labeled for 1 h at 37C with T4 polynucleotide kinase (10 U; New England Biolabs) and 50 μCi [γ32 ] dATP (Perkin-Elmer). .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Generated:

Article Title: Use of a bioengineered antioxidant in mouse models of metabolic syndrome.
Article Snippet: < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic. .. < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic.

Polymerase Chain Reaction:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: .. To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen). .. The coding sequences of hASF and dASF were inserted in frame upstream of a histidine tag sequence into pVL1393 transfer vector (Invitrogen), and recombinant proteins were produced and purified from baculovirus-infected Sf9 cells as described previously ( , ).

Binding Assay:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA). ..

Cellular Antioxidant Activity Assay:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Murine ARRE-2: 5′ CAA AGA GGA AAA TTT GTT TCA TAC AG; human ARRE-2: 5′ CAA AGA GGA AAA ACT GTT TCA TAC AG; AP-1: 5′ CGC TTG ATG ACT CAG CCG GAA; κ3: 5′ GAG CTC ATG GGT TTC TCC ACC and GM-330: 5′ CCC CCA TCG GAG CCC CTG AGT CAG CAT GGC G. Fifty nanograms of oligonucleotides were labeled for 1 h at 37C with T4 polynucleotide kinase (10 U; New England Biolabs) and 50 μCi [γ32 ] dATP (Perkin-Elmer). .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Mutagenesis:

Article Title: Systematic reconstruction of RNA functional motifs with high throughput microfluidics
Article Snippet: Each RNA mutant was encoded on a DNA oligo, which were ordered in antisense orientation relative to the mutant sequence in . .. After annealing, the oligos were diluted 1000-fold and re-suspended in a final concentration of 10 mg/mL BSA (Sigma, 100 mg/mL stock) for array spotting.

Isolation:

Article Title: Use of a bioengineered antioxidant in mouse models of metabolic syndrome.
Article Snippet: < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic. .. < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic.

Labeling:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA). ..

Purification:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: Paragraph title: Recombinant proteins; plasmids and purification. ... To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen).

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Probes were then purified with MicroSpin G-25 columns (GE). .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Sequencing:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen). .. The coding sequences of hASF and dASF were inserted in frame upstream of a histidine tag sequence into pVL1393 transfer vector (Invitrogen), and recombinant proteins were produced and purified from baculovirus-infected Sf9 cells as described previously ( , ).

Article Title: Systematic reconstruction of RNA functional motifs with high throughput microfluidics
Article Snippet: Each RNA mutant was encoded on a DNA oligo, which were ordered in antisense orientation relative to the mutant sequence in . .. After annealing, the oligos were diluted 1000-fold and re-suspended in a final concentration of 10 mg/mL BSA (Sigma, 100 mg/mL stock) for array spotting.

Electrophoretic Mobility Shift Assay:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Paragraph title: Gel-shift assays. ... 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Chloramphenicol Acetyltransferase Assay:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Murine ARRE-2: 5′ CAA AGA GGA AAA TTT GTT TCA TAC AG; human ARRE-2: 5′ CAA AGA GGA AAA ACT GTT TCA TAC AG; AP-1: 5′ CGC TTG ATG ACT CAG CCG GAA; κ3: 5′ GAG CTC ATG GGT TTC TCC ACC and GM-330: 5′ CCC CCA TCG GAG CCC CTG AGT CAG CAT GGC G. Fifty nanograms of oligonucleotides were labeled for 1 h at 37C with T4 polynucleotide kinase (10 U; New England Biolabs) and 50 μCi [γ32 ] dATP (Perkin-Elmer). .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Plasmid Preparation:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: .. To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen). .. The coding sequences of hASF and dASF were inserted in frame upstream of a histidine tag sequence into pVL1393 transfer vector (Invitrogen), and recombinant proteins were produced and purified from baculovirus-infected Sf9 cells as described previously ( , ).

Software:

Article Title: Use of a bioengineered antioxidant in mouse models of metabolic syndrome.
Article Snippet: < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic. .. < b > Background < /b > : Oxidative stress has been implicated in metabolic syndrome (MetS); however, antioxidants such as vitamin E have had limited success in the clinic.

Electrophoresis:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA). .. DNA–protein complexes were separated by electrophoresis under nondenaturating conditions on a 4% polyacrylamide gel in 1× TBE buffer.

Recombinant:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: Paragraph title: Recombinant proteins; plasmids and purification. ... To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen).

Produced:

Article Title: Distinctive Features of Drosophila Alternative Splicing Factor RS Domain: Implication for Specific Phosphorylation, Shuttling, and Splicing Activation
Article Snippet: Hexahistidine-tagged ASF proteins, wild type (ehASF) or truncated versions (ehASF ΔRS and RS domain of hASF), were produced and purified from Escherichia coli as described previously ( ). .. To obtain a hexahistidine-tagged dASF protein (edASF), a 1.2-kb fragment corresponding to dASF cDNA was cloned in pTrcHis vector (Invitrogen) by PCR amplification of the coding region, using 5′ and 3′ oligonucleotides containing Bam HI (Bam5′, cDNA positions 82 to 97) and Eco RI (EcoR3′, cDNA positions 824 to 849) restriction sites, and transformed into the E. coli strain BL21(DE3) (Novagen).

Concentration Assay:

Article Title: Systematic reconstruction of RNA functional motifs with high throughput microfluidics
Article Snippet: .. After annealing, the oligos were diluted 1000-fold and re-suspended in a final concentration of 10 mg/mL BSA (Sigma, 100 mg/mL stock) for array spotting. .. The annealed oligos were arrayed in a 384 well plate and loaded into a custom microarry spotter with 36-pin printhead (Parallel Synthesis 32 pin microarray print head) and 3 pins (Parallel Synthesis silicon pins with 75x75μm tips).

CTG Assay:

Article Title: Targeting the NFAT:AP-1 transcriptional complex on DNA with a small-molecule inhibitor
Article Snippet: Murine ARRE-2: 5′ CAA AGA GGA AAA TTT GTT TCA TAC AG; human ARRE-2: 5′ CAA AGA GGA AAA ACT GTT TCA TAC AG; AP-1: 5′ CGC TTG ATG ACT CAG CCG GAA; κ3: 5′ GAG CTC ATG GGT TTC TCC ACC and GM-330: 5′ CCC CCA TCG GAG CCC CTG AGT CAG CAT GGC G. Fifty nanograms of oligonucleotides were labeled for 1 h at 37C with T4 polynucleotide kinase (10 U; New England Biolabs) and 50 μCi [γ32 ] dATP (Perkin-Elmer). .. 500 nM of Fos and 500 nM of Jun were incubated with the indicated labeled oligonucleotides (15,000–20,000 counts per minute) and 0.5 μg per reaction of poly(dI:dC) (Sigma) in binding buffer (10 mM Hepes pH 7.0, 125 mM NaCl, 10% glycerol, 0.25 mM DTT, 0.8 mg/mL BSA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore sirna oligonucleotide against lamin a c
    (A) Western blots for Bcl-2 expression following <t>siRNA</t> infection. Note that Bcl-2 protein expression is inhibited following infection with Bcl-2 siRNA at baseline and after treatment with 400 J/m 2 . (B) Results of UV-B irradiation and Bcl-2 siRNA on apoptosis as determined by Annexin V staining; siRNA against lamin A/C served as a control. Note that inhibition of Bcl-2 causes a small, but statistically significant increase in apoptosis in response to low dose UV-B irradiation. The bar graphs depict the mean + SEM of at least 3 individual experiments. ( , p
    Sirna Oligonucleotide Against Lamin A C, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna oligonucleotide against lamin a c/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sirna oligonucleotide against lamin a c - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    85
    Millipore anti tau oligomer antibody t22
    Tau oligomer accumulation after TBI. A , ELISA analysis of TBI and sham brains (PBS extracts) using <t>T22</t> shows significant increase in Tau oligomers. B , ELISA analysis using Tau-1 antibody shows no differences in total Tau between sham and TBI (PBS extracts). C , representative Western blots of fractions from TBI and sham samples: lane 1 , sham after 4 h; lane 2 , TBI after 4 h; lane 3 , sham after 24 h; lane 4 , TBI after 24 h. Shown is a Western blot using T22; high molecular weight bands corresponding to Tau oligomers are detected in TBI brains. Western blots using AT180 show the formation of phosphorylated Tau dimer and large aggregates in TBI samples. Phosphorylated Tau monomers were decreased in sham as compared with TBI; Western blot using AT8 showed results similar to those for AT180, confirming the significant increase in SDS-stable phosphorylated Tau oligomers after TBI. Western blot using Tau-1 showed that non-phosphorylated monomeric Tau levels are unchanged in TBI compared with sham brains. D , quantifications of the oligomeric Tau species ( boxed area ) as detected by Western blots ( n = 6). ****, p
    Anti Tau Oligomer Antibody T22, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti tau oligomer antibody t22/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti tau oligomer antibody t22 - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    88
    Millipore chip qrt pcr primers
    HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for <t>qRT-PCR</t> analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p
    Chip Qrt Pcr Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chip qrt pcr primers/product/Millipore
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    chip qrt pcr primers - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    94
    Millipore sirna oligonucleotide duplexes
    Dual silencing of <t>ASCT2</t> and PDK1 is synthetically lethal to HNSCC cells. HN5 cells were transfected with control <t>siRNA,</t> ASCT2 siRNA, PDK1 siRNA, or ASCT2 siRNA plus PDK1 siRNA for 72 hours. ( A ) HN5 cells were subjected to LIVE/DEAD cell viability assay as described in Methods and then observed under a fluorescence microscope. Scale bars: 200 μm. ( B ) The cell lysates were subjected to Western blotting with the indicated antibodies. ( C ) The cell lysates were subjected to quantitative apoptosis ELISA as described in Methods. Error bars indicate ± SD. *** P
    Sirna Oligonucleotide Duplexes, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna oligonucleotide duplexes/product/Millipore
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    sirna oligonucleotide duplexes - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    (A) Western blots for Bcl-2 expression following siRNA infection. Note that Bcl-2 protein expression is inhibited following infection with Bcl-2 siRNA at baseline and after treatment with 400 J/m 2 . (B) Results of UV-B irradiation and Bcl-2 siRNA on apoptosis as determined by Annexin V staining; siRNA against lamin A/C served as a control. Note that inhibition of Bcl-2 causes a small, but statistically significant increase in apoptosis in response to low dose UV-B irradiation. The bar graphs depict the mean + SEM of at least 3 individual experiments. ( , p

    Journal: Cancer research

    Article Title: Unlike Esophageal Squamous Cells, Barrett's Epithelial Cells Resist Apoptosis by Activating the Nuclear Factor-?B Pathway

    doi: 10.1158/0008-5472.CAN-08-3703

    Figure Lengend Snippet: (A) Western blots for Bcl-2 expression following siRNA infection. Note that Bcl-2 protein expression is inhibited following infection with Bcl-2 siRNA at baseline and after treatment with 400 J/m 2 . (B) Results of UV-B irradiation and Bcl-2 siRNA on apoptosis as determined by Annexin V staining; siRNA against lamin A/C served as a control. Note that inhibition of Bcl-2 causes a small, but statistically significant increase in apoptosis in response to low dose UV-B irradiation. The bar graphs depict the mean + SEM of at least 3 individual experiments. ( , p

    Article Snippet: As a control, cells were transfected with an siRNA oligonucleotide against lamin A/C (Millipore, St. Charles, MO).

    Techniques: Western Blot, Expressing, Infection, Irradiation, Staining, Inhibition

    Tau oligomer accumulation after TBI. A , ELISA analysis of TBI and sham brains (PBS extracts) using T22 shows significant increase in Tau oligomers. B , ELISA analysis using Tau-1 antibody shows no differences in total Tau between sham and TBI (PBS extracts). C , representative Western blots of fractions from TBI and sham samples: lane 1 , sham after 4 h; lane 2 , TBI after 4 h; lane 3 , sham after 24 h; lane 4 , TBI after 24 h. Shown is a Western blot using T22; high molecular weight bands corresponding to Tau oligomers are detected in TBI brains. Western blots using AT180 show the formation of phosphorylated Tau dimer and large aggregates in TBI samples. Phosphorylated Tau monomers were decreased in sham as compared with TBI; Western blot using AT8 showed results similar to those for AT180, confirming the significant increase in SDS-stable phosphorylated Tau oligomers after TBI. Western blot using Tau-1 showed that non-phosphorylated monomeric Tau levels are unchanged in TBI compared with sham brains. D , quantifications of the oligomeric Tau species ( boxed area ) as detected by Western blots ( n = 6). ****, p

    Journal: The Journal of Biological Chemistry

    Article Title: Rapid Accumulation of Endogenous Tau Oligomers in a Rat Model of Traumatic Brain Injury

    doi: 10.1074/jbc.M113.472746

    Figure Lengend Snippet: Tau oligomer accumulation after TBI. A , ELISA analysis of TBI and sham brains (PBS extracts) using T22 shows significant increase in Tau oligomers. B , ELISA analysis using Tau-1 antibody shows no differences in total Tau between sham and TBI (PBS extracts). C , representative Western blots of fractions from TBI and sham samples: lane 1 , sham after 4 h; lane 2 , TBI after 4 h; lane 3 , sham after 24 h; lane 4 , TBI after 24 h. Shown is a Western blot using T22; high molecular weight bands corresponding to Tau oligomers are detected in TBI brains. Western blots using AT180 show the formation of phosphorylated Tau dimer and large aggregates in TBI samples. Phosphorylated Tau monomers were decreased in sham as compared with TBI; Western blot using AT8 showed results similar to those for AT180, confirming the significant increase in SDS-stable phosphorylated Tau oligomers after TBI. Western blot using Tau-1 showed that non-phosphorylated monomeric Tau levels are unchanged in TBI compared with sham brains. D , quantifications of the oligomeric Tau species ( boxed area ) as detected by Western blots ( n = 6). ****, p

    Article Snippet: Antibodies used include anti-Tau oligomer antibody T22 (1:500), Tau1 (clone PC1C6/MAB3420 1:1000; Millipore, Billerica, MA), GAPDH (1:1000; Abcam, Cambridge, MA) AT8, and AT180 (1:1000; Thermo Scientific, Waltham, MA).

    Techniques: Enzyme-linked Immunosorbent Assay, Western Blot, Molecular Weight

    Detection of Tau oligomers 2 weeks after TBI. Tau oligomers (T22) and phosphorylated Tau (AT8) were detected in TBI brains (2-week ( 2 wk ) survival) using peroxidase immunohistochemistry in the cortex (contralateral ( Contra ) and ipsilateral ( Ipsi ) to the injury site) and in the dentate gyrus ( DG ) and CA1/2 ( CA2 ) regions of the hippocampus ( HC ). Control sham-injured brains were stained with AT8. Scale bars , 200 μm ( A–H ) and 50 μm ( I–P ). Q , Tau oligomers and phosphorylated Tau were quantified by direct ELISA (PBS extracts) using T22 and AT8, respectively. Samples measured in triplicates ( n = 2); ***, p

    Journal: The Journal of Biological Chemistry

    Article Title: Rapid Accumulation of Endogenous Tau Oligomers in a Rat Model of Traumatic Brain Injury

    doi: 10.1074/jbc.M113.472746

    Figure Lengend Snippet: Detection of Tau oligomers 2 weeks after TBI. Tau oligomers (T22) and phosphorylated Tau (AT8) were detected in TBI brains (2-week ( 2 wk ) survival) using peroxidase immunohistochemistry in the cortex (contralateral ( Contra ) and ipsilateral ( Ipsi ) to the injury site) and in the dentate gyrus ( DG ) and CA1/2 ( CA2 ) regions of the hippocampus ( HC ). Control sham-injured brains were stained with AT8. Scale bars , 200 μm ( A–H ) and 50 μm ( I–P ). Q , Tau oligomers and phosphorylated Tau were quantified by direct ELISA (PBS extracts) using T22 and AT8, respectively. Samples measured in triplicates ( n = 2); ***, p

    Article Snippet: Antibodies used include anti-Tau oligomer antibody T22 (1:500), Tau1 (clone PC1C6/MAB3420 1:1000; Millipore, Billerica, MA), GAPDH (1:1000; Abcam, Cambridge, MA) AT8, and AT180 (1:1000; Thermo Scientific, Waltham, MA).

    Techniques: Immunohistochemistry, Staining, Direct ELISA

    Isolation and characterization of Tau oligomers from TBI brains. Tau oligomers were isolated by immunoprecipitation ( IP ) using anti-Tau oligomer antibody T22 from rat brains extracted 24 h after TBI. A , size exclusion chromatogram of Tau oligomers showing two main peaks, one at 75–150 kDa, which may include Tau dimer/trimers, and a second peak at 300 kDa. B , AFM image of the TBI brain-derived Tau oligomers. C , AFM image of the material isolated from sham brains.

    Journal: The Journal of Biological Chemistry

    Article Title: Rapid Accumulation of Endogenous Tau Oligomers in a Rat Model of Traumatic Brain Injury

    doi: 10.1074/jbc.M113.472746

    Figure Lengend Snippet: Isolation and characterization of Tau oligomers from TBI brains. Tau oligomers were isolated by immunoprecipitation ( IP ) using anti-Tau oligomer antibody T22 from rat brains extracted 24 h after TBI. A , size exclusion chromatogram of Tau oligomers showing two main peaks, one at 75–150 kDa, which may include Tau dimer/trimers, and a second peak at 300 kDa. B , AFM image of the TBI brain-derived Tau oligomers. C , AFM image of the material isolated from sham brains.

    Article Snippet: Antibodies used include anti-Tau oligomer antibody T22 (1:500), Tau1 (clone PC1C6/MAB3420 1:1000; Millipore, Billerica, MA), GAPDH (1:1000; Abcam, Cambridge, MA) AT8, and AT180 (1:1000; Thermo Scientific, Waltham, MA).

    Techniques: Isolation, Immunoprecipitation, Derivative Assay

    Tau oligomer accumulation in hippocampus and cortex in TBI. A–C , representative immunofluorescent images of hippocampus 24 h post-TBI showing Tau-1 ( A , green ), T22 ( B , red ), and merged signals ( C , also including DAPI ( blue )), confirming the presence of Tau oligomers in situ. D–F , representative immunofluorescent images of sham (24 h) hippocampal sections. G–I , representative immunofluorescent photomicrographs of cortex sections post TBI (24 h) showing Tau 1 ( G , green ) and T22 ( H , red arrows indicate representative positive pyramidal neurons), and merged images ( I , also including DAPI ( blue )). J–L , representative immunofluorescent images of sham (24 h) cortical sections. Scale bar , 25 μm.

    Journal: The Journal of Biological Chemistry

    Article Title: Rapid Accumulation of Endogenous Tau Oligomers in a Rat Model of Traumatic Brain Injury

    doi: 10.1074/jbc.M113.472746

    Figure Lengend Snippet: Tau oligomer accumulation in hippocampus and cortex in TBI. A–C , representative immunofluorescent images of hippocampus 24 h post-TBI showing Tau-1 ( A , green ), T22 ( B , red ), and merged signals ( C , also including DAPI ( blue )), confirming the presence of Tau oligomers in situ. D–F , representative immunofluorescent images of sham (24 h) hippocampal sections. G–I , representative immunofluorescent photomicrographs of cortex sections post TBI (24 h) showing Tau 1 ( G , green ) and T22 ( H , red arrows indicate representative positive pyramidal neurons), and merged images ( I , also including DAPI ( blue )). J–L , representative immunofluorescent images of sham (24 h) cortical sections. Scale bar , 25 μm.

    Article Snippet: Antibodies used include anti-Tau oligomer antibody T22 (1:500), Tau1 (clone PC1C6/MAB3420 1:1000; Millipore, Billerica, MA), GAPDH (1:1000; Abcam, Cambridge, MA) AT8, and AT180 (1:1000; Thermo Scientific, Waltham, MA).

    Techniques: In Situ

    HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for qRT-PCR analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p

    Journal: Scientific Reports

    Article Title: REST mediates resolution of HIF-dependent gene expression in prolonged hypoxia

    doi: 10.1038/srep17851

    Figure Lengend Snippet: HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for qRT-PCR analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p

    Article Snippet: The following ChIP qRT-PCR primers were used: HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG The following antibodies were used: Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.

    Techniques: Multiple Displacement Amplification, Quantitative RT-PCR, Expressing, Chromatin Immunoprecipitation, Sequencing

    REST negatively regulates Hif-1α. (A) Schematic representation of the HIF1A genomic locus, grey rectangles indicate approximate Exon position, the white rectangle with diagonal black lines indicates the genomic sequence -491 bp/ATG of the human HIF1A gene. Highlighting is the REST binding site (RE1) in red, and the previously reported NFκB binding site in blue, on the -491 bp/ATG genomic sequence. Blue arrows indicate the primers used to detect REST, COREST, mSin3A and IgG binding to the RE1 site in the ChIP assays. (B) ChIP assays on the RE1 site in the HIF1A gene promoter using the indicated antibodies in HEK293 cells exposed to the indicated time points to hypoxia (1% oxygen). Precipitated chromatin was quantified by qRT-PCR. (C–G) Cells were exposed to hypoxia (1% O 2 ) for the indicated time points. REST knockdown was performed using REST specific (REST-RNAi) or control RNAi ( C–G ). Whole cell extracts from HEK293 ( C,D ) and MCF7 ( E,F ) were collected and analysed for the expression of the indicated protein by immunoblotting ( C,E ) and densitometry analysis ( D,F ). HEK293 mRNA was collected and analysed for HIF mRNA expression by qRT-PCR ( G ). F.C. = fold change to 21% O 2 for ( G ) and control RNAi, 8 hours hypoxia for ( C–F ). Data are represented as mean ± SEM, N = 3–5 throughout. *p

    Journal: Scientific Reports

    Article Title: REST mediates resolution of HIF-dependent gene expression in prolonged hypoxia

    doi: 10.1038/srep17851

    Figure Lengend Snippet: REST negatively regulates Hif-1α. (A) Schematic representation of the HIF1A genomic locus, grey rectangles indicate approximate Exon position, the white rectangle with diagonal black lines indicates the genomic sequence -491 bp/ATG of the human HIF1A gene. Highlighting is the REST binding site (RE1) in red, and the previously reported NFκB binding site in blue, on the -491 bp/ATG genomic sequence. Blue arrows indicate the primers used to detect REST, COREST, mSin3A and IgG binding to the RE1 site in the ChIP assays. (B) ChIP assays on the RE1 site in the HIF1A gene promoter using the indicated antibodies in HEK293 cells exposed to the indicated time points to hypoxia (1% oxygen). Precipitated chromatin was quantified by qRT-PCR. (C–G) Cells were exposed to hypoxia (1% O 2 ) for the indicated time points. REST knockdown was performed using REST specific (REST-RNAi) or control RNAi ( C–G ). Whole cell extracts from HEK293 ( C,D ) and MCF7 ( E,F ) were collected and analysed for the expression of the indicated protein by immunoblotting ( C,E ) and densitometry analysis ( D,F ). HEK293 mRNA was collected and analysed for HIF mRNA expression by qRT-PCR ( G ). F.C. = fold change to 21% O 2 for ( G ) and control RNAi, 8 hours hypoxia for ( C–F ). Data are represented as mean ± SEM, N = 3–5 throughout. *p

    Article Snippet: The following ChIP qRT-PCR primers were used: HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG The following antibodies were used: Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.

    Techniques: Sequencing, Binding Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Expressing

    Dual silencing of ASCT2 and PDK1 is synthetically lethal to HNSCC cells. HN5 cells were transfected with control siRNA, ASCT2 siRNA, PDK1 siRNA, or ASCT2 siRNA plus PDK1 siRNA for 72 hours. ( A ) HN5 cells were subjected to LIVE/DEAD cell viability assay as described in Methods and then observed under a fluorescence microscope. Scale bars: 200 μm. ( B ) The cell lysates were subjected to Western blotting with the indicated antibodies. ( C ) The cell lysates were subjected to quantitative apoptosis ELISA as described in Methods. Error bars indicate ± SD. *** P

    Journal: JCI Insight

    Article Title: Rational combination with PDK1 inhibition overcomes cetuximab resistance in head and neck squamous cell carcinoma

    doi: 10.1172/jci.insight.131106

    Figure Lengend Snippet: Dual silencing of ASCT2 and PDK1 is synthetically lethal to HNSCC cells. HN5 cells were transfected with control siRNA, ASCT2 siRNA, PDK1 siRNA, or ASCT2 siRNA plus PDK1 siRNA for 72 hours. ( A ) HN5 cells were subjected to LIVE/DEAD cell viability assay as described in Methods and then observed under a fluorescence microscope. Scale bars: 200 μm. ( B ) The cell lysates were subjected to Western blotting with the indicated antibodies. ( C ) The cell lysates were subjected to quantitative apoptosis ELISA as described in Methods. Error bars indicate ± SD. *** P

    Article Snippet: siRNA oligonucleotide duplexes for ASCT2 and PDK1 were purchased from MilliporeSigma.

    Techniques: Transfection, Viability Assay, Fluorescence, Microscopy, Western Blot, Enzyme-linked Immunosorbent Assay

    Cetuximab sensitizes HNSCC cells to PDK1-silencing–induced apoptosis, ROS overproduction, and mitochondria depolarization. ( A ) HN5, FaDu, and NOM9-TK cells were transfected with control siRNA or each of 3 different PDK1 siRNAs for 72 hours. Cetuximab (20 nM) was added or not added during the last 24 hours of siRNA transfection as indicated. Cell lysates were then prepared and subjected to Western blotting with the indicated antibodies. ( B and C ) HN5 cells were transfected with control siRNA or PDK1 siRNA #1 for 72 hours. Cetuximab (20 nM) was added or not added during the last 24 hours of siRNA transfection as in A . In B , the cells were stained with Enzo Life Sciences’ ROS detection kit and then observed under a fluorescence microscope (left) or subjected to FACS analysis after staining (right). Scale bars: 100 μm. In C , the cells were stained with mitochondrial membrane potential–sensitive dye tetramethyl rhodamine methyl ester (TMRM) and then observed under a fluorescence microscope (left) or analyzed with a fluorescence plate reader (right). Scale bars: 100 μm. Error bars ± SD. *** P

    Journal: JCI Insight

    Article Title: Rational combination with PDK1 inhibition overcomes cetuximab resistance in head and neck squamous cell carcinoma

    doi: 10.1172/jci.insight.131106

    Figure Lengend Snippet: Cetuximab sensitizes HNSCC cells to PDK1-silencing–induced apoptosis, ROS overproduction, and mitochondria depolarization. ( A ) HN5, FaDu, and NOM9-TK cells were transfected with control siRNA or each of 3 different PDK1 siRNAs for 72 hours. Cetuximab (20 nM) was added or not added during the last 24 hours of siRNA transfection as indicated. Cell lysates were then prepared and subjected to Western blotting with the indicated antibodies. ( B and C ) HN5 cells were transfected with control siRNA or PDK1 siRNA #1 for 72 hours. Cetuximab (20 nM) was added or not added during the last 24 hours of siRNA transfection as in A . In B , the cells were stained with Enzo Life Sciences’ ROS detection kit and then observed under a fluorescence microscope (left) or subjected to FACS analysis after staining (right). Scale bars: 100 μm. In C , the cells were stained with mitochondrial membrane potential–sensitive dye tetramethyl rhodamine methyl ester (TMRM) and then observed under a fluorescence microscope (left) or analyzed with a fluorescence plate reader (right). Scale bars: 100 μm. Error bars ± SD. *** P

    Article Snippet: siRNA oligonucleotide duplexes for ASCT2 and PDK1 were purchased from MilliporeSigma.

    Techniques: Transfection, Western Blot, Staining, Fluorescence, Microscopy, FACS

    Cetuximab plus PDK1 knockdown or inhibition decreases clonogenic survival of cetuximab-sensitive HNSCC cells and HNSCC cells with acquired resistance to cetuximab. ( A and B ) Parental cetuximab-sensitive HN5 and FaDu cells ( A ), and their cetuximab-resistant sublines HN5-R and FaDu-R cells ( B ), were transfected with a control siRNA or each of 3 different PDK1 siRNAs for 72 hours; then, the siRNA-treated cells were seeded at low density and cultured with or without 2 nM cetuximab for 13 days for HN5 and HN5-R and 22 days for FaDu and FaDu-R cells. Upper panels, photographs of culture dishes. Lower panels, mean colony numbers ± SDs of triplicate wells. ( C and D ) HN5-R and FaDu-R cells were transfected with a control siRNA or each of 3 different PDK1 siRNAs for 72 hours ( C ) or were treated with DCA for 24 hours ( D ). Cetuximab (20 nM) was added or not during the last 24 hours of siRNA transfection or DCA treatment as indicated. Cell lysates were then prepared and subjected to Western blotting with the indicated antibodies (upper panels) and to quantitative apoptosis ELISA (bottom panels). All error bars indicate ± SD. *** P

    Journal: JCI Insight

    Article Title: Rational combination with PDK1 inhibition overcomes cetuximab resistance in head and neck squamous cell carcinoma

    doi: 10.1172/jci.insight.131106

    Figure Lengend Snippet: Cetuximab plus PDK1 knockdown or inhibition decreases clonogenic survival of cetuximab-sensitive HNSCC cells and HNSCC cells with acquired resistance to cetuximab. ( A and B ) Parental cetuximab-sensitive HN5 and FaDu cells ( A ), and their cetuximab-resistant sublines HN5-R and FaDu-R cells ( B ), were transfected with a control siRNA or each of 3 different PDK1 siRNAs for 72 hours; then, the siRNA-treated cells were seeded at low density and cultured with or without 2 nM cetuximab for 13 days for HN5 and HN5-R and 22 days for FaDu and FaDu-R cells. Upper panels, photographs of culture dishes. Lower panels, mean colony numbers ± SDs of triplicate wells. ( C and D ) HN5-R and FaDu-R cells were transfected with a control siRNA or each of 3 different PDK1 siRNAs for 72 hours ( C ) or were treated with DCA for 24 hours ( D ). Cetuximab (20 nM) was added or not during the last 24 hours of siRNA transfection or DCA treatment as indicated. Cell lysates were then prepared and subjected to Western blotting with the indicated antibodies (upper panels) and to quantitative apoptosis ELISA (bottom panels). All error bars indicate ± SD. *** P

    Article Snippet: siRNA oligonucleotide duplexes for ASCT2 and PDK1 were purchased from MilliporeSigma.

    Techniques: Inhibition, Transfection, Cell Culture, Western Blot, Enzyme-linked Immunosorbent Assay