oligo dt beads  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Oligotex mRNA Mini Kit
    Description:
    For mRNA purification from total RNA and for in vitro transcript cleanup. Kit contents: Qiagen Oligotex mRNA Mini Kit, 12 preps, <250g Sample, 20 to 100L Elution Volume, Total RNA Sample, Poly A+ mRNA Purification, Polystyrene-latex Particles Technology, Spin Column Format, Manual Processing, >90% Recovery Yield, Ideal for PCR, Real-time PCR, cDNA Synthesis, In vitro Translation, Microarray, Transfection, Includes 200L Oligotex Suspension, Small Spin Columns, 1.5mL Collection Tubes, RNase-free Reagents and Buffers. Benefits: High recovery of pure mRNA in as little as 30 minutes. No oligo-dT cellulose or ethanol precipitation. Flexibility for use with widely varying amounts of star
    Catalog Number:
    70022
    Price:
    None
    Category:
    Oligotex mRNA Mini Kit
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen oligo dt beads
    Oligotex mRNA Mini Kit
    For mRNA purification from total RNA and for in vitro transcript cleanup. Kit contents: Qiagen Oligotex mRNA Mini Kit, 12 preps, <250g Sample, 20 to 100L Elution Volume, Total RNA Sample, Poly A+ mRNA Purification, Polystyrene-latex Particles Technology, Spin Column Format, Manual Processing, >90% Recovery Yield, Ideal for PCR, Real-time PCR, cDNA Synthesis, In vitro Translation, Microarray, Transfection, Includes 200L Oligotex Suspension, Small Spin Columns, 1.5mL Collection Tubes, RNase-free Reagents and Buffers. Benefits: High recovery of pure mRNA in as little as 30 minutes. No oligo-dT cellulose or ethanol precipitation. Flexibility for use with widely varying amounts of star
    https://www.bioz.com/result/oligo dt beads/product/Qiagen
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    oligo dt beads - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: Second, total RNA obtained under various physiological conditions (Table ) was extracted as described [ ], using the 'RNeasy Maxi Kit' (Qiagen, Germantown, MD, USA). .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA). .. The genome of P. anserina was sequenced using a 'whole genome shotgun and assembly' strategy.

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH). .. Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH).

    Amplification:

    Article Title: A Transgenic Transcription Factor (TaDREB3) in Barley Affects the Expression of MicroRNAs and Other Small Non-Coding RNAs
    Article Snippet: The degradome library was constructed as described before . .. Briefly, poly(A) RNA, extracted from total RNA from Golden Promise barley with the Oligotex kit (Qiagen), was ligated with a 5′ RNA adaptor containing a Mme I restriction site using T4 RNA ligase (Invitrogen), followed by reverse transcription, second-strand synthesis, Mme I digestion, ligation of a 3′ dsDNA adaptor, gel-purification, and PCR amplification. .. Amplified PCR products were sequenced with the Illumina HiSeq platform.

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. These double-stranded cDNA fragments underwent process of end repair, addition of a single ‘A’ base and ligation of adapters.

    Article Title: Digital NFATc2 Activation per Cell Transforms Graded T Cell Receptor Activation into an All-or-None IL-2 Expression
    Article Snippet: mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany). .. mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany).

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Total RNA from each sample was extracted using TRIzol reagent (Gibco/BRL Life Technologies, Inc., Gaithersburg, MD) and used to prepare biotinylated target cRNA, according to the Affymetrix recommendations [ ]. .. Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA. .. The target cRNA generated from each sample was processed as recommended by the manufacturer and using an Affymetrix GeneChip Instrument System.

    Article Title: Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses
    Article Snippet: After cell lysis, mRNA was extracted (Oligotex Kit; QIAGEN) and subjected to a nonnested, template-switch anchored RT-PCR using a 3′ TCRB constant region primer (5′-GCTTCTGATGGCTCAAACACAGCGACCTC-3′) as described previously ( ). .. Amplified products were ligated into pGEM-T Easy vector (Promega) and cloned by transformation of competent DH5α E. coli .

    Article Title: Regulation of the MAD1 promoter by G-CSF
    Article Snippet: Paragraph title: 5′-RACE (rapid amplification of cDNA-ends) ... U937 cells were grown to a density of 5 × 106 cells/ml and stimulated with 10 ng/ml human G-CSF for 2 h. mRNA was purified using the Oligotex mRNA-Kit (Qiagen) according to the manufacturer's instruction.

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA. .. Multiplex Real Time Quantitative mRNA analyses were performed in an ABI Prism 7700 Sequence Detection System using FAM-labeled MCP-1 and VIC-labeled GAPDH probes and appropriate primers (PE Applied Biosystems).

    Synthesized:

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen).

    Article Title: Digital NFATc2 Activation per Cell Transforms Graded T Cell Receptor Activation into an All-or-None IL-2 Expression
    Article Snippet: mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany). .. mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany).

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: The CFA/KLH injection site (50–100 mg) and draining PLNs were flash frozen in liquid N2. .. Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA. .. Multiplex Real Time Quantitative mRNA analyses were performed in an ABI Prism 7700 Sequence Detection System using FAM-labeled MCP-1 and VIC-labeled GAPDH probes and appropriate primers (PE Applied Biosystems).

    Article Title: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis
    Article Snippet: Purification of mRNA was carried out using Oligotex mRNA kit (Qiagen, USA), and cDNA synthesis using the SMART™ cDNA library construction kit (Clontech, USA). .. The clones contain SfiI-A and SfiI-B restriction sites, which allowed directional cloning.

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Given this developmental sequence, L4 larvae parasiting in the brain within 21 days appeared to be a representative stage to use for learning about the basic biology and life cycle of this parasitic nematode in mice. .. Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH). .. We combined the following reagents in a sterile 0.5-ml microcentrifuge tube (1-3 ul RNA sample, 1 ul SMART IV Oligonucleotide, 1 ul CDS III/3' PCR Primer) and incubate the tube at 72°C for 2 min and then cool the tube on ice for 2 min. We then add the following to each reaction tube to10.0 ul total volume (2.0 ul 5× First-Strand Buffer, 1.0 ul DTT (20 mM), 1.0 ul dNTP Mix (10 mM),1.0 ul PowerScript Reverse Transcriptase).

    Construct:

    Article Title: A Transgenic Transcription Factor (TaDREB3) in Barley Affects the Expression of MicroRNAs and Other Small Non-Coding RNAs
    Article Snippet: The degradome library was constructed as described before . .. Briefly, poly(A) RNA, extracted from total RNA from Golden Promise barley with the Oligotex kit (Qiagen), was ligated with a 5′ RNA adaptor containing a Mme I restriction site using T4 RNA ligase (Invitrogen), followed by reverse transcription, second-strand synthesis, Mme I digestion, ligation of a 3′ dsDNA adaptor, gel-purification, and PCR amplification.

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: Four normalized cDNA libraries were constructed and sequenced on a Roche 454 GS-FLX at the W.M. .. Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA).

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: First, a mycelium library was constructed in the yeast expression vector pFL61 [ ]. .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA).

    SYBR Green Assay:

    Article Title: Identification of a human TFPI-2 splice variant that is upregulated in human tumor tissues
    Article Snippet: RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA). .. RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA).

    Article Title: Digital NFATc2 Activation per Cell Transforms Graded T Cell Receptor Activation into an All-or-None IL-2 Expression
    Article Snippet: mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany). .. mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany).

    Microarray:

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Paragraph title: Microarray hybridization procedure ... Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA.

    Incubation:

    Article Title: Regulation of the MAD1 promoter by G-CSF
    Article Snippet: U937 cells were grown to a density of 5 × 106 cells/ml and stimulated with 10 ng/ml human G-CSF for 2 h. mRNA was purified using the Oligotex mRNA-Kit (Qiagen) according to the manufacturer's instruction. .. U937 cells were grown to a density of 5 × 106 cells/ml and stimulated with 10 ng/ml human G-CSF for 2 h. mRNA was purified using the Oligotex mRNA-Kit (Qiagen) according to the manufacturer's instruction.

    Expressing:

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: First, a mycelium library was constructed in the yeast expression vector pFL61 [ ]. .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Hematopoietic Expression of Hoxb4 Is Regulated in Normal and Leukemic Stem Cells through Transcriptional Activation of the Hoxb4 Promoter by Upstream Stimulating Factor (Usf)-1 and Usf-2
    Article Snippet: PolyA+ RNA was isolated with Trizol (GIBCO BRL) followed by affinity purification using an Oligotex mRNA kit (QIAGEN). .. 2.5 μg of PolyA+ RNA was electrophoresed on a formaldehyde-formamide agarose gel and transferred onto nylon membrane.

    Modification:

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. These double-stranded cDNA fragments underwent process of end repair, addition of a single ‘A’ base and ligation of adapters.

    Article Title: De Novo Sequencing, Assembly, and Analysis of the Root Transcriptome of Persea americana (Mill.) in Response to Phytophthora cinnamomi and Flooding
    Article Snippet: RNA was extracted from ground root tissue using the CTAB extraction method described by , with slight modification. .. RNA concentration and integrity was estimated using the NanoDrop® ND-1000 (Nanodrop Technologies, Inc., Montchanin, USA) spectrophotometer and non-denaturing 2% TAE agarose gels. mRNA isolation was performed using the Oligotex™ mRNA kit (Qiagen Inc., Hilden, Germany).

    Article Title: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis
    Article Snippet: Specifically, total RNA was extracted from snail ganglia using the modified Trizol method (Invitrogen, USA). .. Purification of mRNA was carried out using Oligotex mRNA kit (Qiagen, USA), and cDNA synthesis using the SMART™ cDNA library construction kit (Clontech, USA).

    Hybridization:

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Paragraph title: Microarray hybridization procedure ... Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA.

    Article Title: Hematopoietic Expression of Hoxb4 Is Regulated in Normal and Leukemic Stem Cells through Transcriptional Activation of the Hoxb4 Promoter by Upstream Stimulating Factor (Usf)-1 and Usf-2
    Article Snippet: PolyA+ RNA was isolated with Trizol (GIBCO BRL) followed by affinity purification using an Oligotex mRNA kit (QIAGEN). .. 2.5 μg of PolyA+ RNA was electrophoresed on a formaldehyde-formamide agarose gel and transferred onto nylon membrane.

    Article Title: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis
    Article Snippet: Purification of mRNA was carried out using Oligotex mRNA kit (Qiagen, USA), and cDNA synthesis using the SMART™ cDNA library construction kit (Clontech, USA). .. Full-length cDNA was synthesized with two set of primers for driver and tester cDNA.

    Sequencing:

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: Paragraph title: Development of Reference Transcriptome Sequence Assemblies ... Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA).

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Paragraph title: cDNA library construction, sequencing and bioinformatic analysis ... Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH).

    Ligation:

    Article Title: A Transgenic Transcription Factor (TaDREB3) in Barley Affects the Expression of MicroRNAs and Other Small Non-Coding RNAs
    Article Snippet: The degradome library was constructed as described before . .. Briefly, poly(A) RNA, extracted from total RNA from Golden Promise barley with the Oligotex kit (Qiagen), was ligated with a 5′ RNA adaptor containing a Mme I restriction site using T4 RNA ligase (Invitrogen), followed by reverse transcription, second-strand synthesis, Mme I digestion, ligation of a 3′ dsDNA adaptor, gel-purification, and PCR amplification. .. Amplified PCR products were sequenced with the Illumina HiSeq platform.

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. Second-stranded cDNA was synthesized using RNase H and DNA polymerase I.

    Northern Blot:

    Article Title: Aberrant over-expression of a forkhead family member, FOXO1A, in a brain tumor cell line
    Article Snippet: Paragraph title: Northern blot analysis ... PolyA+ mRNA was isolated using a Qiagen Oligotext mRNA Mini Kit. mRNA (2 ug) was prepared with deionized glyoxal, electrophoresed on a 1.2% agarose gel and transferred in 20×SSC to Magna Neutral Membrane (Osmonics Inc.).

    Article Title: Hematopoietic Expression of Hoxb4 Is Regulated in Normal and Leukemic Stem Cells through Transcriptional Activation of the Hoxb4 Promoter by Upstream Stimulating Factor (Usf)-1 and Usf-2
    Article Snippet: Paragraph title: Northern Analysis. ... PolyA+ RNA was isolated with Trizol (GIBCO BRL) followed by affinity purification using an Oligotex mRNA kit (QIAGEN).

    Generated:

    Article Title: Digital NFATc2 Activation per Cell Transforms Graded T Cell Receptor Activation into an All-or-None IL-2 Expression
    Article Snippet: mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany). .. mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany).

    DNA Sequencing:

    Article Title: A comparative sequence analysis reveals a common GBD/FH3-FH1-FH2-DAD architecture in formins from Dictyostelium, fungi and metazoa
    Article Snippet: For RT-PCR, first strand cDNA synthesis was performed with M-MLV reverse transcriptase (Promega Corporation, Madison, WI) on poly A+ mRNA purified with the Oligotex system (Qiagen GmbH, Hilden, Germany) from total RNA. .. PCR fragments were cloned into the pGEM-T Easy vector system (Promega Corporation, Madison, WI) and sequenced.

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH). .. After that, cDNA was purified using Chroma Spin-400 columns (CLONTECH). cDNA libraries were prepared by directional cloning of purified cDNA into the pBluescript II SK vector (Addgene), according to the manufacturer's instructions, and screened on LB medium (Apr -IPTG/x-gal).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A comparative sequence analysis reveals a common GBD/FH3-FH1-FH2-DAD architecture in formins from Dictyostelium, fungi and metazoa
    Article Snippet: Each sample had 2 replicates containing 1-, 4-, or 16-fold diluted cDNA. .. For RT-PCR, first strand cDNA synthesis was performed with M-MLV reverse transcriptase (Promega Corporation, Madison, WI) on poly A+ mRNA purified with the Oligotex system (Qiagen GmbH, Hilden, Germany) from total RNA. .. PCR fragments were cloned into the pGEM-T Easy vector system (Promega Corporation, Madison, WI) and sequenced.

    Article Title: Identification of a human TFPI-2 splice variant that is upregulated in human tumor tissues
    Article Snippet: RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA). .. RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA).

    Article Title: Digital NFATc2 Activation per Cell Transforms Graded T Cell Receptor Activation into an All-or-None IL-2 Expression
    Article Snippet: Paragraph title: RT-PCR analysis ... mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany).

    Article Title: Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses
    Article Snippet: At least 5,000 cells were collected for each experimental condition. .. After cell lysis, mRNA was extracted (Oligotex Kit; QIAGEN) and subjected to a nonnested, template-switch anchored RT-PCR using a 3′ TCRB constant region primer (5′-GCTTCTGATGGCTCAAACACAGCGACCTC-3′) as described previously ( ). .. Amplified products were ligated into pGEM-T Easy vector (Promega) and cloned by transformation of competent DH5α E. coli .

    Injection:

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: The CFA/KLH injection site (50–100 mg) and draining PLNs were flash frozen in liquid N2. .. Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA.

    Gel Purification:

    Article Title: A Transgenic Transcription Factor (TaDREB3) in Barley Affects the Expression of MicroRNAs and Other Small Non-Coding RNAs
    Article Snippet: The degradome library was constructed as described before . .. Briefly, poly(A) RNA, extracted from total RNA from Golden Promise barley with the Oligotex kit (Qiagen), was ligated with a 5′ RNA adaptor containing a Mme I restriction site using T4 RNA ligase (Invitrogen), followed by reverse transcription, second-strand synthesis, Mme I digestion, ligation of a 3′ dsDNA adaptor, gel-purification, and PCR amplification. .. Amplified PCR products were sequenced with the Illumina HiSeq platform.

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. These double-stranded cDNA fragments underwent process of end repair, addition of a single ‘A’ base and ligation of adapters.

    Molecular Weight:

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: Three cDNA libraries, corresponding to three ranges of molecular weight cDNA (0.2-1 kb, 1-2.5 kb, > 2.5 kb) were cloned using BstX1 adaptators in the pFL61 vector between the 5' (promoter) and 3' (terminator) sequences of the S. cerevisiae pgk1 gene as described previously [ ]. .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA).

    In Vivo:

    Article Title: Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)
    Article Snippet: Poly A+ RNA was isolated using an Oligotex mRNA Mini Kit (Qiagen, Los Angeles, CA). cDNA was prepared from polyA+ enriched, pooled samples of equivalent amounts of total RNA from each time point. .. The cDNA was directionally ligated into the Uni-Zap XR vector (Stratagene, Los Angeles, CA) and packaged using Gigapack III Gold packaging extracts.

    Magnetic Beads:

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Total RNA was isolated with Trizol Reagent (Invitrogen), after which the concentration, quality and integrity were determined with a NanoDrop spectrophotometer and an Agilent 2100 Bioanalyzer. .. Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. The mRNA was fragmented and used as template to synthesize first-stranded cDNA with reverse transcriptase and random hexamer-primers.

    Isolation:

    Article Title: Long-read sequencing uncovers a complex transcriptome topology in varicella zoster virus
    Article Snippet: Thirty-five μg of total RNA was pipetted in separate DNA LoBind Eppendorf tubes (Merck). .. The poly(A)+ RNA fraction was isolated from the samples using the Oligotex mRNA Mini Kit (Qiagen). .. RNA samples were stored at − 80 °C until use.

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: Carver Biotechnology Center, UIUC. .. Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA). .. The mRNA-enriched fraction was converted to 454 barcoded cDNA libraries and normalized [ ].

    Article Title: Molecular Characterisation of Colour Formation in the Prawn Fenneropenaeus merguiensis
    Article Snippet: F. merguiensis samples (n = 75) of varying body colouration, gender and size (1–45 g) were randomly collected from eight different grow-out ponds, the cuticle and muscle tissue excised and stored in RNA Later TM (Ambion, Austin, TX). .. Total RNA from the muscle and cuticle of the samples was extracted with the RNeasy Plus Mini kit (Qiagen), RNA quality and quantity assessed (1.2% ethidium bromide stained RNA gel and testing the A260 /A280 ratio) and the RNA pooled into one composite sample, from which mRNA was isolated with the Oligotex mRNA kit (Qiagen) as per manufacturer's instructions. .. The mRNA was concentrated with the RNeasy Mini Elute TM Cleanup kit (Qiagen) and the prepared sample sent to AGRF for Roche 454 next generation sequencing.

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Paragraph title: RNA isolation and cDNA library construction ... Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen).

    Article Title: De Novo Sequencing, Assembly, and Analysis of the Root Transcriptome of Persea americana (Mill.) in Response to Phytophthora cinnamomi and Flooding
    Article Snippet: The chloroform: isoamyl alcohol step was repeated 3–5 times, depending on the stability of the interphase and colour of the sample. .. RNA concentration and integrity was estimated using the NanoDrop® ND-1000 (Nanodrop Technologies, Inc., Montchanin, USA) spectrophotometer and non-denaturing 2% TAE agarose gels. mRNA isolation was performed using the Oligotex™ mRNA kit (Qiagen Inc., Hilden, Germany). .. See supplementary materials for additional information.

    Article Title: Aberrant over-expression of a forkhead family member, FOXO1A, in a brain tumor cell line
    Article Snippet: All qRT-PCR experiments were carried out in duplicate and expression levels were normalized to ACTB levels. .. PolyA+ mRNA was isolated using a Qiagen Oligotext mRNA Mini Kit. mRNA (2 ug) was prepared with deionized glyoxal, electrophoresed on a 1.2% agarose gel and transferred in 20×SSC to Magna Neutral Membrane (Osmonics Inc.). .. The membrane was probed with a gel purified 32 P labelled FOXO1A PCR product and autoradiographed.

    Article Title: Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)
    Article Snippet: Total RNA was extracted from 200–500 mg of ground tissue from the six different seed stages collected from 10 plants using TRI Reagent (Molecular Research Center, Inc. Cincinnati, OH) following the manufacturer's recommendations. .. Poly A+ RNA was isolated using an Oligotex mRNA Mini Kit (Qiagen, Los Angeles, CA). cDNA was prepared from polyA+ enriched, pooled samples of equivalent amounts of total RNA from each time point. .. Two cDNA libraries were generated: an "early" seed library (15, 20, and 25 DAF, library I), and a "late" seed library (30, 35, and 40 DAF, library II).

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: The CFA/KLH injection site (50–100 mg) and draining PLNs were flash frozen in liquid N2. .. Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA. .. Multiplex Real Time Quantitative mRNA analyses were performed in an ABI Prism 7700 Sequence Detection System using FAM-labeled MCP-1 and VIC-labeled GAPDH probes and appropriate primers (PE Applied Biosystems).

    Article Title: Hematopoietic Expression of Hoxb4 Is Regulated in Normal and Leukemic Stem Cells through Transcriptional Activation of the Hoxb4 Promoter by Upstream Stimulating Factor (Usf)-1 and Usf-2
    Article Snippet: K562 cell cultures were supplemented with 10−7 M PMA (Sigma-Aldrich). .. PolyA+ RNA was isolated with Trizol (GIBCO BRL) followed by affinity purification using an Oligotex mRNA kit (QIAGEN). .. 2.5 μg of PolyA+ RNA was electrophoresed on a formaldehyde-formamide agarose gel and transferred onto nylon membrane.

    Functional Assay:

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: Keck Center for Comparative and Functional Genomics, Roy J. .. Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA).

    Article Title: Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses
    Article Snippet: For the purposes of this study, clonotype analysis was performed only on cells labeled physically with cognate pMHCI tetramers; capture assays based on biological readouts potentially misrepresent the repertoire due to functional impairment of CD8+ T cells during persistent viral infections. .. After cell lysis, mRNA was extracted (Oligotex Kit; QIAGEN) and subjected to a nonnested, template-switch anchored RT-PCR using a 3′ TCRB constant region primer (5′-GCTTCTGATGGCTCAAACACAGCGACCTC-3′) as described previously ( ).

    Labeling:

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Total RNA from each sample was extracted using TRIzol reagent (Gibco/BRL Life Technologies, Inc., Gaithersburg, MD) and used to prepare biotinylated target cRNA, according to the Affymetrix recommendations [ ]. .. Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA. .. The target cRNA generated from each sample was processed as recommended by the manufacturer and using an Affymetrix GeneChip Instrument System.

    Article Title: Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses
    Article Snippet: For the purposes of this study, clonotype analysis was performed only on cells labeled physically with cognate pMHCI tetramers; capture assays based on biological readouts potentially misrepresent the repertoire due to functional impairment of CD8+ T cells during persistent viral infections. .. After cell lysis, mRNA was extracted (Oligotex Kit; QIAGEN) and subjected to a nonnested, template-switch anchored RT-PCR using a 3′ TCRB constant region primer (5′-GCTTCTGATGGCTCAAACACAGCGACCTC-3′) as described previously ( ).

    Purification:

    Article Title: A comparative sequence analysis reveals a common GBD/FH3-FH1-FH2-DAD architecture in formins from Dictyostelium, fungi and metazoa
    Article Snippet: Each sample had 2 replicates containing 1-, 4-, or 16-fold diluted cDNA. .. For RT-PCR, first strand cDNA synthesis was performed with M-MLV reverse transcriptase (Promega Corporation, Madison, WI) on poly A+ mRNA purified with the Oligotex system (Qiagen GmbH, Hilden, Germany) from total RNA. .. PCR fragments were cloned into the pGEM-T Easy vector system (Promega Corporation, Madison, WI) and sequenced.

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Total RNA was isolated with Trizol Reagent (Invitrogen), after which the concentration, quality and integrity were determined with a NanoDrop spectrophotometer and an Agilent 2100 Bioanalyzer. .. Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. The mRNA was fragmented and used as template to synthesize first-stranded cDNA with reverse transcriptase and random hexamer-primers.

    Article Title: Profiling Gene Expression in Germinating Brassica Roots
    Article Snippet: Seeds of Brassica rapa were germinated at 25 °C for 48 h in the dark. .. Total RNA was extracted from roots and primary root of germinated seeds of Brassica using the innuPREP RNA mini kit (Analytik Jena, Germany) and mRNA was purified from total RNA using Oligotex mRNA Mini Kit (Qiagen, USA). .. All procedures for RNA extraction were according to manufacturer's protocols.

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: Total RNA was extracted from the s wild-type strain (mat-) and polyA+ RNA was purified twice on oligo (dT)-cellulose columns (mRNA purification kit, Amersham Pharmacia Biotech, GE Healthcare Bio-Sciences AB, Uppsala, Sweden). .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Total RNA from each sample was extracted using TRIzol reagent (Gibco/BRL Life Technologies, Inc., Gaithersburg, MD) and used to prepare biotinylated target cRNA, according to the Affymetrix recommendations [ ]. .. Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA. .. The target cRNA generated from each sample was processed as recommended by the manufacturer and using an Affymetrix GeneChip Instrument System.

    Article Title: Regulation of the MAD1 promoter by G-CSF
    Article Snippet: MAD1 probe 6-Fam-TGGACAGCATCGGCTCCACC-Tamra MAD1 -f 5′-GAGAAGCTGGGCATTGAGAG-3′ MAD1 -r 5′-ACGTCGATTTCTTCCCTGTC-3′ β-GLUCURONIDASE probe 6-Fam-TGAACAGTCACCGACGAGAGTGCTGG-Tamra β-GLUCURONIDASE -f 5′-CTCATTTGGAATTTTGCCGATT-3′ β-GLUCURONIDASE -r 5′-CCGAGTGAAGATCCCCTTTTTA-3′ .. U937 cells were grown to a density of 5 × 106 cells/ml and stimulated with 10 ng/ml human G-CSF for 2 h. mRNA was purified using the Oligotex mRNA-Kit (Qiagen) according to the manufacturer's instruction. .. For 5′-RACE we used the 5′/3′-RACE-Kit (Roche) following the manufacturer's protocol.

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: The CFA/KLH injection site (50–100 mg) and draining PLNs were flash frozen in liquid N2. .. Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA. .. Multiplex Real Time Quantitative mRNA analyses were performed in an ABI Prism 7700 Sequence Detection System using FAM-labeled MCP-1 and VIC-labeled GAPDH probes and appropriate primers (PE Applied Biosystems).

    Article Title: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis
    Article Snippet: Specifically, total RNA was extracted from snail ganglia using the modified Trizol method (Invitrogen, USA). .. Purification of mRNA was carried out using Oligotex mRNA kit (Qiagen, USA), and cDNA synthesis using the SMART™ cDNA library construction kit (Clontech, USA). .. The clones contain SfiI-A and SfiI-B restriction sites, which allowed directional cloning.

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH). .. Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH).

    Polymerase Chain Reaction:

    Article Title: A Transgenic Transcription Factor (TaDREB3) in Barley Affects the Expression of MicroRNAs and Other Small Non-Coding RNAs
    Article Snippet: The degradome library was constructed as described before . .. Briefly, poly(A) RNA, extracted from total RNA from Golden Promise barley with the Oligotex kit (Qiagen), was ligated with a 5′ RNA adaptor containing a Mme I restriction site using T4 RNA ligase (Invitrogen), followed by reverse transcription, second-strand synthesis, Mme I digestion, ligation of a 3′ dsDNA adaptor, gel-purification, and PCR amplification. .. Amplified PCR products were sequenced with the Illumina HiSeq platform.

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen). .. These double-stranded cDNA fragments underwent process of end repair, addition of a single ‘A’ base and ligation of adapters.

    Article Title: Identification of a human TFPI-2 splice variant that is upregulated in human tumor tissues
    Article Snippet: RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA). .. RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA).

    Article Title: Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses
    Article Snippet: After cell lysis, mRNA was extracted (Oligotex Kit; QIAGEN) and subjected to a nonnested, template-switch anchored RT-PCR using a 3′ TCRB constant region primer (5′-GCTTCTGATGGCTCAAACACAGCGACCTC-3′) as described previously ( ). .. Amplified products were ligated into pGEM-T Easy vector (Promega) and cloned by transformation of competent DH5α E. coli .

    Article Title: Regulation of the MAD1 promoter by G-CSF
    Article Snippet: U937 cells were grown to a density of 5 × 106 cells/ml and stimulated with 10 ng/ml human G-CSF for 2 h. mRNA was purified using the Oligotex mRNA-Kit (Qiagen) according to the manufacturer's instruction. .. The 2 µg of purified mRNA were incubated with AMV-Reverse-Transcriptase and specific primer Sp1 (5′-CGGAGTCGGAGCGCTCCG) to yield MAD1 cDNA.

    Selection:

    Article Title: Long-read sequencing uncovers a complex transcriptome topology in varicella zoster virus
    Article Snippet: Paragraph title: Poly(a) selection ... The poly(A)+ RNA fraction was isolated from the samples using the Oligotex mRNA Mini Kit (Qiagen).

    Staining:

    Article Title: Molecular Characterisation of Colour Formation in the Prawn Fenneropenaeus merguiensis
    Article Snippet: F. merguiensis samples (n = 75) of varying body colouration, gender and size (1–45 g) were randomly collected from eight different grow-out ponds, the cuticle and muscle tissue excised and stored in RNA Later TM (Ambion, Austin, TX). .. Total RNA from the muscle and cuticle of the samples was extracted with the RNeasy Plus Mini kit (Qiagen), RNA quality and quantity assessed (1.2% ethidium bromide stained RNA gel and testing the A260 /A280 ratio) and the RNA pooled into one composite sample, from which mRNA was isolated with the Oligotex mRNA kit (Qiagen) as per manufacturer's instructions. .. The mRNA was concentrated with the RNeasy Mini Elute TM Cleanup kit (Qiagen) and the prepared sample sent to AGRF for Roche 454 next generation sequencing.

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA. .. Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA.

    cDNA Library Assay:

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Paragraph title: RNA isolation and cDNA library construction ... Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen).

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: Second, total RNA obtained under various physiological conditions (Table ) was extracted as described [ ], using the 'RNeasy Maxi Kit' (Qiagen, Germantown, MD, USA). .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA). .. The genome of P. anserina was sequenced using a 'whole genome shotgun and assembly' strategy.

    Article Title: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis
    Article Snippet: Specifically, total RNA was extracted from snail ganglia using the modified Trizol method (Invitrogen, USA). .. Purification of mRNA was carried out using Oligotex mRNA kit (Qiagen, USA), and cDNA synthesis using the SMART™ cDNA library construction kit (Clontech, USA). .. The clones contain SfiI-A and SfiI-B restriction sites, which allowed directional cloning.

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Given this developmental sequence, L4 larvae parasiting in the brain within 21 days appeared to be a representative stage to use for learning about the basic biology and life cycle of this parasitic nematode in mice. .. Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH). .. We combined the following reagents in a sterile 0.5-ml microcentrifuge tube (1-3 ul RNA sample, 1 ul SMART IV Oligonucleotide, 1 ul CDS III/3' PCR Primer) and incubate the tube at 72°C for 2 min and then cool the tube on ice for 2 min. We then add the following to each reaction tube to10.0 ul total volume (2.0 ul 5× First-Strand Buffer, 1.0 ul DTT (20 mM), 1.0 ul dNTP Mix (10 mM),1.0 ul PowerScript Reverse Transcriptase).

    Sample Prep:

    Article Title: Molecular Characterisation of Colour Formation in the Prawn Fenneropenaeus merguiensis
    Article Snippet: Paragraph title: Sample preparation ... Total RNA from the muscle and cuticle of the samples was extracted with the RNeasy Plus Mini kit (Qiagen), RNA quality and quantity assessed (1.2% ethidium bromide stained RNA gel and testing the A260 /A280 ratio) and the RNA pooled into one composite sample, from which mRNA was isolated with the Oligotex mRNA kit (Qiagen) as per manufacturer's instructions.

    Mouse Assay:

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA. .. Multiplex Real Time Quantitative mRNA analyses were performed in an ABI Prism 7700 Sequence Detection System using FAM-labeled MCP-1 and VIC-labeled GAPDH probes and appropriate primers (PE Applied Biosystems).

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Given this developmental sequence, L4 larvae parasiting in the brain within 21 days appeared to be a representative stage to use for learning about the basic biology and life cycle of this parasitic nematode in mice. .. Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH).

    Chromatin Immunoprecipitation:

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA). .. Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA).

    Affinity Purification:

    Article Title: Hematopoietic Expression of Hoxb4 Is Regulated in Normal and Leukemic Stem Cells through Transcriptional Activation of the Hoxb4 Promoter by Upstream Stimulating Factor (Usf)-1 and Usf-2
    Article Snippet: K562 cell cultures were supplemented with 10−7 M PMA (Sigma-Aldrich). .. PolyA+ RNA was isolated with Trizol (GIBCO BRL) followed by affinity purification using an Oligotex mRNA kit (QIAGEN). .. 2.5 μg of PolyA+ RNA was electrophoresed on a formaldehyde-formamide agarose gel and transferred onto nylon membrane.

    Plasmid Preparation:

    Article Title: The genome sequence of the model ascomycete fungus Podospora anserina
    Article Snippet: Second, total RNA obtained under various physiological conditions (Table ) was extracted as described [ ], using the 'RNeasy Maxi Kit' (Qiagen, Germantown, MD, USA). .. PolyA+ mRNAs were extracted with the 'Oligotex mRNA Maxi Kit' (Qiagen), reverse transcribed and cloned with the 'cloneMiner cDNA library construction Kit' into plasmid pDONR222 (Invitrogen, Carlsbad, CA, USA). .. The genome of P. anserina was sequenced using a 'whole genome shotgun and assembly' strategy.

    Article Title: Identification of a human TFPI-2 splice variant that is upregulated in human tumor tissues
    Article Snippet: Fetal bovine serum was purchased from Hyclone (Ogden, UT). .. RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA). .. Normal human lung, liver and colon RNAs, as well as their corresponding tumor RNAs, were purchased from Chemicon Inc. (Temecula, CA).

    Article Title: Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)
    Article Snippet: Poly A+ RNA was isolated using an Oligotex mRNA Mini Kit (Qiagen, Los Angeles, CA). cDNA was prepared from polyA+ enriched, pooled samples of equivalent amounts of total RNA from each time point. .. Two cDNA libraries were generated: an "early" seed library (15, 20, and 25 DAF, library I), and a "late" seed library (30, 35, and 40 DAF, library II).

    Article Title: Preliminary molecular characterization of the human pathogen Angiostrongylus cantonensis
    Article Snippet: Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH). .. Then, about 200 L4 larvae of A. cantonensis were collected from the brains of a mouse, immersed in TRIzol Reagent (Gibco BRL) and frozen immediately. mRNAs were collected using Oligotex mRNA Kits (QIAGEN) from total RNAs of L4 larval tissue. cDNA was synthesized from total RNA by reverse transcription using SMARTTM cDNA Library Construction Kit (CLONTECH).

    Software:

    Article Title: Digital NFATc2 Activation per Cell Transforms Graded T Cell Receptor Activation into an All-or-None IL-2 Expression
    Article Snippet: mRNA and cDNA preparation were performed with human Th cells (5×106 /ml) 2 h after stimulation using RNeasy- and Oligotex-Kit (Qiagen, Hilden, Germany). .. Primers for IL-2 cDNA amplification by Light Cycler were designed for an intron-exon junction (synthesized by TIB-MOLBIOL, Berlin, Germany): hIL-2 cDNA: forward, CACAGCTACAACTGGAGCATTTA, reverse AGAAATTCTACAATGGTTGCTGTC; h β2-Microglobulin cDNA forward TGGAGAGAGAATTGAAAAAGTGGAGC, reverse TTAAAAAGCAAGCAAGCAGAATTTGG. cDNA was amplified in duplicates using the Light Cycler FastStart DNA Master SYBR Green I Master Mix (Roche) and subjected to following conditions: 95°C for 10 min for one cycle; 95°C for 10 s, 58°C (IL-2 cDNA), 56°C (h β2-Microglobulin) for 10 s, and 1/25 bp amplicon for 72°C for 45 cycles.

    Real-time Polymerase Chain Reaction:

    Article Title: Inflammatory Chemokine Transport and Presentation in HEV
    Article Snippet: Paragraph title: Analysis of Murine MCP-1 mRNA Using Real-Time PCR (TaqMan® ) ... Total RNA was extracted with the ULTRASPEC-II RNA Isolation System (BioTecx Laboratories) and mRNA from 100 μg total RNA was purified using a QIAGEN Oligotex mRNA kit (QIAGEN). cDNA was synthesized using mRNA equivalent to ∼30 μg total RNA.

    RNA Extraction:

    Article Title: De Novo Sequencing, Assembly, and Analysis of the Root Transcriptome of Persea americana (Mill.) in Response to Phytophthora cinnamomi and Flooding
    Article Snippet: Paragraph title: RNA extraction ... RNA concentration and integrity was estimated using the NanoDrop® ND-1000 (Nanodrop Technologies, Inc., Montchanin, USA) spectrophotometer and non-denaturing 2% TAE agarose gels. mRNA isolation was performed using the Oligotex™ mRNA kit (Qiagen Inc., Hilden, Germany).

    Article Title: Identification of a human TFPI-2 splice variant that is upregulated in human tumor tissues
    Article Snippet: Fetal bovine serum was purchased from Hyclone (Ogden, UT). .. RNEasy® RNA extraction kit, Oligotex mRNA mini kit, and Plasmid Spin Miniprep kit were purchased from Qiagen (Valencia, CA). .. Normal human lung, liver and colon RNAs, as well as their corresponding tumor RNAs, were purchased from Chemicon Inc. (Temecula, CA).

    Recombinant:

    Article Title: Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)
    Article Snippet: Poly A+ RNA was isolated using an Oligotex mRNA Mini Kit (Qiagen, Los Angeles, CA). cDNA was prepared from polyA+ enriched, pooled samples of equivalent amounts of total RNA from each time point. .. The cDNA was directionally ligated into the Uni-Zap XR vector (Stratagene, Los Angeles, CA) and packaged using Gigapack III Gold packaging extracts.

    Agarose Gel Electrophoresis:

    Article Title: Aberrant over-expression of a forkhead family member, FOXO1A, in a brain tumor cell line
    Article Snippet: All qRT-PCR experiments were carried out in duplicate and expression levels were normalized to ACTB levels. .. PolyA+ mRNA was isolated using a Qiagen Oligotext mRNA Mini Kit. mRNA (2 ug) was prepared with deionized glyoxal, electrophoresed on a 1.2% agarose gel and transferred in 20×SSC to Magna Neutral Membrane (Osmonics Inc.). .. The membrane was probed with a gel purified 32 P labelled FOXO1A PCR product and autoradiographed.

    In Vitro:

    Article Title: Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy
    Article Snippet: Total RNA from each sample was extracted using TRIzol reagent (Gibco/BRL Life Technologies, Inc., Gaithersburg, MD) and used to prepare biotinylated target cRNA, according to the Affymetrix recommendations [ ]. .. Purification of PolyA+ mRNA from total RNA was performed with the Oligotex mRNA Kit (QIAGEN GmbH, Hilden, Germany): 1 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo(dT) primer; after second-strand synthesis, in-vitro transcription was performed with biotinylated UTP and CTP using the Enzo BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY), resulting in approximately 100-fold amplification of RNA. .. The target cRNA generated from each sample was processed as recommended by the manufacturer and using an Affymetrix GeneChip Instrument System.

    Spectrophotometry:

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: The RNA was shipped to University of Illinois at Urbana-Champaign (UIUC), USA in 70% ethanol where it was resuspended in water and quantified by measuring the absorbance at 260 nm using a NanoDrop spectrophotometer (Thermo Scientific, DE, USA). .. Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA).

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Total RNA was isolated with Trizol Reagent (Invitrogen), after which the concentration, quality and integrity were determined with a NanoDrop spectrophotometer and an Agilent 2100 Bioanalyzer. .. Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen).

    Article Title: De Novo Sequencing, Assembly, and Analysis of the Root Transcriptome of Persea americana (Mill.) in Response to Phytophthora cinnamomi and Flooding
    Article Snippet: The chloroform: isoamyl alcohol step was repeated 3–5 times, depending on the stability of the interphase and colour of the sample. .. RNA concentration and integrity was estimated using the NanoDrop® ND-1000 (Nanodrop Technologies, Inc., Montchanin, USA) spectrophotometer and non-denaturing 2% TAE agarose gels. mRNA isolation was performed using the Oligotex™ mRNA kit (Qiagen Inc., Hilden, Germany). .. See supplementary materials for additional information.

    Concentration Assay:

    Article Title: Development of Reference Transcriptomes for the Major Field Insect Pests of Cowpea: A Toolbox for Insect Pest Management Approaches in West Africa
    Article Snippet: Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA). .. Briefly, messenger RNA (mRNA) was isolated from 10μg of total RNA with the Oligotex kit (Qiagen, Valencia, CA).

    Article Title: Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis
    Article Snippet: Total RNA was isolated with Trizol Reagent (Invitrogen), after which the concentration, quality and integrity were determined with a NanoDrop spectrophotometer and an Agilent 2100 Bioanalyzer. .. Poly-(A)-containing mRNA was purified using oligo(dT) magnetic beads and Oligotex mRNA Kits (Qiagen).

    Article Title: De Novo Sequencing, Assembly, and Analysis of the Root Transcriptome of Persea americana (Mill.) in Response to Phytophthora cinnamomi and Flooding
    Article Snippet: The chloroform: isoamyl alcohol step was repeated 3–5 times, depending on the stability of the interphase and colour of the sample. .. RNA concentration and integrity was estimated using the NanoDrop® ND-1000 (Nanodrop Technologies, Inc., Montchanin, USA) spectrophotometer and non-denaturing 2% TAE agarose gels. mRNA isolation was performed using the Oligotex™ mRNA kit (Qiagen Inc., Hilden, Germany). .. See supplementary materials for additional information.

    Lysis:

    Article Title: Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses
    Article Snippet: At least 5,000 cells were collected for each experimental condition. .. After cell lysis, mRNA was extracted (Oligotex Kit; QIAGEN) and subjected to a nonnested, template-switch anchored RT-PCR using a 3′ TCRB constant region primer (5′-GCTTCTGATGGCTCAAACACAGCGACCTC-3′) as described previously ( ). .. Amplified products were ligated into pGEM-T Easy vector (Promega) and cloned by transformation of competent DH5α E. coli .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 76
    Qiagen oligo dt beads
    Oligo Dt Beads, supplied by Qiagen, used in various techniques. Bioz Stars score: 76/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt beads/product/Qiagen
    Average 76 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    oligo dt beads - by Bioz Stars, 2019-10
    76/100 stars
      Buy from Supplier

    99
    Qiagen oligo dt magnetic beads
    Oligo Dt Magnetic Beads, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt magnetic beads/product/Qiagen
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    oligo dt magnetic beads - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results