nova taq dna polymerase  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Taq DNA Polymerase
    Description:
    Taq DNA Polymerase 1 U μl dNTPack comprises Taq DNA Polymerase and a ready to use solution of PCR grade nucleotides Taq DNA polymerase is a highly processive 5 3 DNA polymerase that lacks 3 5 exonuclease activity It is stable during prolonged incubations at elevated temperatures 95 C Additionally it exhibits highest activity at a pH of around 9 adjusted at 20 C and temperatures around 75 C It accepts dNTP analogs as substrates There is no difference in stability or performance when compared to the standard concentration of Taq DNA Polymerase
    Catalog Number:
    taqnl-ro
    Price:
    None
    Applications:
    Taq DNA Polymerase (1 U/mul), dNTPack may be used for: . PCR. RT-PCR. Other primer-extension reactions, such as sequencing and labeling
    Buy from Supplier


    Structured Review

    Millipore nova taq dna polymerase
    Taq DNA Polymerase 1 U μl dNTPack comprises Taq DNA Polymerase and a ready to use solution of PCR grade nucleotides Taq DNA polymerase is a highly processive 5 3 DNA polymerase that lacks 3 5 exonuclease activity It is stable during prolonged incubations at elevated temperatures 95 C Additionally it exhibits highest activity at a pH of around 9 adjusted at 20 C and temperatures around 75 C It accepts dNTP analogs as substrates There is no difference in stability or performance when compared to the standard concentration of Taq DNA Polymerase
    https://www.bioz.com/result/nova taq dna polymerase/product/Millipore
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nova taq dna polymerase - by Bioz Stars, 2020-01
    90/100 stars

    Related Products / Commonly Used Together

    pcr
    proteinase k
    upah gene
    rnaase

    Images

    Related Articles

    Clone Assay:

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. The band was excised from the gel, purified using a gel extraction kit (Qiagen, Hilden, Germany) and blunt-end cloned into pST Blue Vector (Novagen, Schwalbach, Germany).

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: Routine PCR amplifications were done with the Sigma Taq DNA polymerase. .. For cloning purposes, higher-fidelity amplifications were obtained with the native Pfu DNA polymerase (Stratagene).

    Amplification:

    Article Title: Gal80 Dimerization and the Yeast GAL Gene Switch
    Article Snippet: Mutagenesis of the GAL80 gene was performed using Taq DNA Polymerase (Sigma, St. Louis) and the manganese (Mn)-dITP error-prone PCR method ( ; ). pAKS42 (2μ TRP1 , PADH1 ::DBGAL80 ) encoding the two-hybrid bait fusion protein, DBGal80, was used as template for the Mn-dITP error-prone PCR reactions. .. Each of four separate regions of the GAL80 ORF was amplified to create four PCR product pools, which together represented the entire GAL80 ORF.

    Article Title: Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin
    Article Snippet: .. Mouse-tail biopsies were used for genotyping and DNA was amplified by using PCR with specific primers for galanin 5′-TGCCTCCCTAGAGTCGACGAGGGATCCTCGTGCGCT-3′ and 5′-AGGCATCCCAAGTCCCAGAGTGGCTGA-3′ and Taq DNA polymerase (2.5 units; Sigma); incubations were at 95°C for 45 s, at 54°C for 1 min, and at 72°C for 1 min for 30 cycles, finally, at 72°C for 10 min. .. The PCR product showed a 445-bp wild-type (WT) band or a 248-bp GalOE band.

    Article Title: cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications 1
    Article Snippet: Three sets of primer pairs were designed for each SSR to provide alternatives if amplification was unsuccessful. .. PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich).

    Article Title: Investigation of the Matrix Metalloproteinase-2 Gene in Patients with Non-Syndromic Mitral Valve Prolapse
    Article Snippet: Genomic DNA from 47 familial cases and four DNAs of unaffected probands were amplified by PCR. .. Reactions were performed in 25 µL volumes containing 50 ng genomic DNA, 1X reaction buffer (Sigma-Aldrich, Saint-Louis, MO, USA), 1.5 mM MgCl2 (Sigma-Aldrich), 0.2 mM each dNTP (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 0.25 µM each of both primers and 1.25 U Taq DNA polymerase (Sigma-Aldrich).

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: .. Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. After a ‘hot start’ with an initial denaturation at 95 °C for 3 min, each PCR cycle involved denaturation at 94 °C for 30 s, annealing at 60 °C for 60 s and extension at 72 °C for 45 s. The last cycle was followed by an extension step at 72 °C for 7 min. Isolated RNA amplified without reverse transcriptase or random hexamers was used as a negative control.

    Article Title: Direct contact of platelets and their released products exert different effects on human dendritic cell maturation
    Article Snippet: .. After DNAse I treatment, 1 mg mRNA was retro-transcribed with M-MuLV reverse transcriptase (Promega, Charbonières, France) and fragments were amplified with Taq polymerase (Sigma-Aldrich) using primers specific for human RANTES and for β-actin (R & D Systems Europe Ltd, Lille, France), as described previously [ ]. .. Expected product lengths were 320 bp for RANTES internal positive control, 198 bp for RANTES complementary DNA (cDNA), and 634 bp for β-actin cDNA.

    Article Title: Characterisation of a panel of anti-tetanus toxin single-chain Fvs reveals cooperative binding
    Article Snippet: 2.1 Bst NI antibody fingerprinting The scFv DNA sequence inserts were amplified from pCANTAB6 by PCR using primers LMB3 (5′-CAGGAAACAGCTATGAC-3′) and FDSEQ1 (5′-GAATTTTCTGTATGAGG-3′). .. TAQ polymerase (Sigma) (5 u) was added along with the appropriate buffer supplied by the manufacturer and nuclease free water.

    Article Title: Aspartate transporter expression and activity in hypertrophic rat heart and ischaemia-reperfusion injury
    Article Snippet: PCR was carried out in a reaction volume of 50 µl containing cDNA, dNTPs, polymerase buffer (Sigma), primers, and Taq DNA polymerase (Sigma). .. Amplification of EAAT2-4 was performed with initial denaturation at 94°C for 3 min followed by 27 cycles comprising 30 s at 94°C, 45 s at 50°C, 30 s at 72°C followed by a 7-min extension at 72°C.

    Article Title: Salmonella enterica Serotype Bredeney: Antimicrobial Susceptibility and Molecular Diversity of Isolates from Ireland and Northern Ireland
    Article Snippet: DNA amplification fingerprinting (DAF) was carried out following the DAF protocol described previously ( ). .. Reactions were performed in 50-μl final volumes containing 200 ng of genomic DNA, 100 pmol of a 10-mer arbitrary primer, P1254 (5′-CCGCAGCCAA-3′) , 5 μl of 10× PCR buffer (100 mmol of Tris-HCl [pH 9.0], 500 mmol of KCl, and 1% Triton X-100 per liter), 8 μl of deoxynucleoside triphosphate mix (containing 1.25 mmol/liter each of dATP, dCTP, dGTP, and dTTP), 2.5 mmol of MgCl2, and 2.5 U of Taq DNA polymerase (Sigma, St. Louis, Mo.) per liter.

    Article Title: In-Vitro Helix Opening of M. tuberculosis oriC by DnaA Occurs at Precise Location and Is Inhibited by IciA Like Protein
    Article Snippet: Primer extension 10 μl of the primer extension mix included 200 μM each dNTPs, 0.04 pM 32 P end labeled primer [SeqOriR1, SeqOriR2 or SeqOriR3 ( )] 0.5 mM MgCl2 , 2% DMSO and 0.5 Units Taq DNA polymerase (SIGMA). .. The mixture was subjected to primer extension (SeqOriR1) in a thermocycler for 30 cycles: 94°C for 1 min, 92°C for 30 sec., 54°C for 30 sec. and 72°C for 1 min except for 5 min in the last amplification cycle.

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: .. Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions. .. Reactions were performed by touchdown PCR amplification as follows: an initial denaturation step at 94°C for 2 min, followed by 20 amplification cycles: 30 sec at 94°C; 45 sec at 68°C initially, 45 sec at 72°C (minus 1°C at each cycle) followed by 15 amplification cycles: 30 sec at 94°C; 45 sec at 53°C, 45 sec at 72°C, followed by a final extension step at 72°C for 7 min. Products were subjected to 2% agarose gel electrophoresis, visualized by ethidium bromide staining and photographed by using an eagle eye apparatus (Stratagene).

    Positive Control:

    Article Title: Molecular Cloning and Functional Analysis of a Na+-Insensitive K+ Transporter of Capsicum chinense Jacq
    Article Snippet: Tubulin served as a positive control in the reaction with primers forward (5′-GACCTTGAATCGGCTTATGG-3′) and reverse (5′ TATCCTGGGTGAACGCTTTG 3′). .. PCR was repeated three times using Taq polymerase (Sigma).

    Article Title: Direct contact of platelets and their released products exert different effects on human dendritic cell maturation
    Article Snippet: After DNAse I treatment, 1 mg mRNA was retro-transcribed with M-MuLV reverse transcriptase (Promega, Charbonières, France) and fragments were amplified with Taq polymerase (Sigma-Aldrich) using primers specific for human RANTES and for β-actin (R & D Systems Europe Ltd, Lille, France), as described previously [ ]. .. Expected product lengths were 320 bp for RANTES internal positive control, 198 bp for RANTES complementary DNA (cDNA), and 634 bp for β-actin cDNA.

    Synthesized:

    Article Title: Application of a phenotypic drug discovery strategy to identify biological and chemical starting points for inhibition of TSLP production in lung epithelial cells
    Article Snippet: All primers were synthesized at SIGMA. cDNA synthesis was performed with Clontech´s Advantage® RT-for-PCR Kit (639506) using 1 μg of RNA in 20 μl of reaction volume. .. Endpoint PCR reactions were performed in a total volume of 25 μl with 2.5 μl of the cDNA, 0.5 μl (0.5 U) of SIGMA Taq DNA Polymerase (D-6677), 200 μM of each dNTP (SIGMA DNTP10 Set), 1x SIGMA PCR buffer (P-2192) and 0.5 μM each of the corresponding GADPH or TSLP primers.

    Article Title: cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications 1
    Article Snippet: Thirty-three primer pairs were designed initially, synthesized, and tested on seven individuals from Kashmir and Quebec by running the PCR products in 1.5% agarose gel in 1× Tris-acetate/EDTA (TAE). .. PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich).

    Article Title: Molecular Cloning and Functional Analysis of a Na+-Insensitive K+ Transporter of Capsicum chinense Jacq
    Article Snippet: Semi-quantitative PCR was performed using cDNA synthesized from 1 μg of total RNA isolated as described above. .. PCR was repeated three times using Taq polymerase (Sigma).

    Article Title: Aspartate transporter expression and activity in hypertrophic rat heart and ischaemia-reperfusion injury
    Article Snippet: Complimentary DNA was synthesized using an Ambion kit (Ambion Inc. Cat. no. 1710) as instructed. cDNAs were stored at −20°C until use. .. PCR was carried out in a reaction volume of 50 µl containing cDNA, dNTPs, polymerase buffer (Sigma), primers, and Taq DNA polymerase (Sigma).

    Construct:

    Article Title: Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin
    Article Snippet: A galanin/galanin message-associated peptide (GMAP) gene construct, including the second endogenous intron of the galanin gene, using a 1.3-kb PDGF-B promoter , was injected into pronuclei from fertilized mouse oocytes ( ) from a cross between F1 (C57BL/6 × CBA) mice. .. Mouse-tail biopsies were used for genotyping and DNA was amplified by using PCR with specific primers for galanin 5′-TGCCTCCCTAGAGTCGACGAGGGATCCTCGTGCGCT-3′ and 5′-AGGCATCCCAAGTCCCAGAGTGGCTGA-3′ and Taq DNA polymerase (2.5 units; Sigma); incubations were at 95°C for 45 s, at 54°C for 1 min, and at 72°C for 1 min for 30 cycles, finally, at 72°C for 10 min.

    Electrophoresis:

    Article Title: cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications 1
    Article Snippet: PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich). .. The PCR products were separated by electrophoresis in 1.5% agarose gels in 1× Tris-borate/EDTA (TBE) buffer and visualized by ethidium bromide staining.

    Article Title: Direct contact of platelets and their released products exert different effects on human dendritic cell maturation
    Article Snippet: After DNAse I treatment, 1 mg mRNA was retro-transcribed with M-MuLV reverse transcriptase (Promega, Charbonières, France) and fragments were amplified with Taq polymerase (Sigma-Aldrich) using primers specific for human RANTES and for β-actin (R & D Systems Europe Ltd, Lille, France), as described previously [ ]. .. Amplification products were resolved by electrophoresis and product sizes were verified against a 100 bp DNA ladder (Invitrogen).

    Article Title: Aspartate transporter expression and activity in hypertrophic rat heart and ischaemia-reperfusion injury
    Article Snippet: PCR was carried out in a reaction volume of 50 µl containing cDNA, dNTPs, polymerase buffer (Sigma), primers, and Taq DNA polymerase (Sigma). .. For EAAT1, amplification was performed as follows: initial denaturation at 94°C for 3 min, then 30 cycles of 30 s at 94°C, 30 s at 60°C, and 60 s at 72°C with a final extension at 72°C for 7 min. Amplified products were subjected to electrophoresis in 1% agarose gels, and visualized by ultraviolet illumination in the presence of ethidium bromide (0.1 mg ml−1 ).

    Article Title: Salmonella enterica Serotype Bredeney: Antimicrobial Susceptibility and Molecular Diversity of Isolates from Ireland and Northern Ireland
    Article Snippet: Reactions were performed in 50-μl final volumes containing 200 ng of genomic DNA, 100 pmol of a 10-mer arbitrary primer, P1254 (5′-CCGCAGCCAA-3′) , 5 μl of 10× PCR buffer (100 mmol of Tris-HCl [pH 9.0], 500 mmol of KCl, and 1% Triton X-100 per liter), 8 μl of deoxynucleoside triphosphate mix (containing 1.25 mmol/liter each of dATP, dCTP, dGTP, and dTTP), 2.5 mmol of MgCl2, and 2.5 U of Taq DNA polymerase (Sigma, St. Louis, Mo.) per liter. .. PCR products were analyzed by electrophoresis of 10-μl aliquots of the PCR in ethidium bromide-stained agarose gels.

    Random Hexamer Labeling:

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Three micrograms of total RNA were reverse transcribed to obtain complementary DNA using 50 ng random hexamer primers (Boehringer Mannheim, Mannheim, Germany) and 200 U SuperScript II RNase H− reverse transcriptase (Gibco BRL). .. Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions.

    Expressing:

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: To determine expression of phosphodiesterase 5 (PDE 5) mRNA in LM-MP, we subsequently performed PCR using primers specific for the PDE 5 isozyme ( ). .. Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions.

    Touchdown PCR:

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions. .. Reactions were performed by touchdown PCR amplification as follows: an initial denaturation step at 94°C for 2 min, followed by 20 amplification cycles: 30 sec at 94°C; 45 sec at 68°C initially, 45 sec at 72°C (minus 1°C at each cycle) followed by 15 amplification cycles: 30 sec at 94°C; 45 sec at 53°C, 45 sec at 72°C, followed by a final extension step at 72°C for 7 min. Products were subjected to 2% agarose gel electrophoresis, visualized by ethidium bromide staining and photographed by using an eagle eye apparatus (Stratagene).

    Transformation Assay:

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: L. plantarum , B. subtilis , and E. coli DNA transformation and nucleic acid preparations were performed as previously described ( ). .. Routine PCR amplifications were done with the Sigma Taq DNA polymerase.

    Serial Dilution:

    Article Title: Alzheimer's brains show inter-related changes in RNA and lipid metabolism
    Article Snippet: PCR was performed using Taq DNA polymerase (Sigma). .. Serial dilution of samples served to evaluate primer-efficiency and the cDNA concentration that yields linear differences.

    Cell Culture:

    Article Title: Direct contact of platelets and their released products exert different effects on human dendritic cell maturation
    Article Snippet: RANTES mRNA analysis DCs and PLTs were cultured separately or together for 2 days as described in "dendritic cell/platelet coculture" section. .. After DNAse I treatment, 1 mg mRNA was retro-transcribed with M-MuLV reverse transcriptase (Promega, Charbonières, France) and fragments were amplified with Taq polymerase (Sigma-Aldrich) using primers specific for human RANTES and for β-actin (R & D Systems Europe Ltd, Lille, France), as described previously [ ].

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Alzheimer's brains show inter-related changes in RNA and lipid metabolism
    Article Snippet: Paragraph title: Standard RT-PCR ... PCR was performed using Taq DNA polymerase (Sigma).

    Article Title: Molecular Cloning and Functional Analysis of a Na+-Insensitive K+ Transporter of Capsicum chinense Jacq
    Article Snippet: Paragraph title: Analysis of transcript levels of CcHAK1 by RT-PCR ... PCR was repeated three times using Taq polymerase (Sigma).

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions.

    Article Title: Aspartate transporter expression and activity in hypertrophic rat heart and ischaemia-reperfusion injury
    Article Snippet: Paragraph title: RT-PCR of system Xag -transporters ... PCR was carried out in a reaction volume of 50 µl containing cDNA, dNTPs, polymerase buffer (Sigma), primers, and Taq DNA polymerase (Sigma).

    DNA Sequencing:

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: Routine PCR amplifications were done with the Sigma Taq DNA polymerase. .. DNA sequencing was done with a Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Pharmacia Biotech).

    DNA Labeling:

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: Nucleic acid hybrids on Hybond positively charged nylon membranes (Amersham) were detected with a nonradioactive digoxigenin DNA labeling and detection kit using the alkaline phosphatase chemiluminescent substrate CDP-Star (Boehringer Mannheim). .. Routine PCR amplifications were done with the Sigma Taq DNA polymerase.

    Sequencing:

    Article Title: Investigation of the Matrix Metalloproteinase-2 Gene in Patients with Non-Syndromic Mitral Valve Prolapse
    Article Snippet: Paragraph title: 2.2. Sequencing of the MMP2 Gene ... Reactions were performed in 25 µL volumes containing 50 ng genomic DNA, 1X reaction buffer (Sigma-Aldrich, Saint-Louis, MO, USA), 1.5 mM MgCl2 (Sigma-Aldrich), 0.2 mM each dNTP (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 0.25 µM each of both primers and 1.25 U Taq DNA polymerase (Sigma-Aldrich).

    Article Title: Molecular Cloning and Functional Analysis of a Na+-Insensitive K+ Transporter of Capsicum chinense Jacq
    Article Snippet: For PCR, we used sense (5′-TACAACAACAAGTGGATTCAAG-3′) and antisense (5′-CGAATTCGTTATACCTCATAAGTCATGCCAACC-3′) primers designed based on the total cDNA sequence from CcHAK1 . .. PCR was repeated three times using Taq polymerase (Sigma).

    Article Title: Characterisation of a panel of anti-tetanus toxin single-chain Fvs reveals cooperative binding
    Article Snippet: 2.1 Bst NI antibody fingerprinting The scFv DNA sequence inserts were amplified from pCANTAB6 by PCR using primers LMB3 (5′-CAGGAAACAGCTATGAC-3′) and FDSEQ1 (5′-GAATTTTCTGTATGAGG-3′). .. TAQ polymerase (Sigma) (5 u) was added along with the appropriate buffer supplied by the manufacturer and nuclease free water.

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: Routine PCR amplifications were done with the Sigma Taq DNA polymerase. .. DNA sequencing was done with a Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Pharmacia Biotech).

    Article Title: In-Vitro Helix Opening of M. tuberculosis oriC by DnaA Occurs at Precise Location and Is Inhibited by IciA Like Protein
    Article Snippet: Primer extension 10 μl of the primer extension mix included 200 μM each dNTPs, 0.04 pM 32 P end labeled primer [SeqOriR1, SeqOriR2 or SeqOriR3 ( )] 0.5 mM MgCl2 , 2% DMSO and 0.5 Units Taq DNA polymerase (SIGMA). .. The reactions were stopped by adding 2 μl of formamide sequencing dye (95% Formamide, 10 mM NaOH, 0.05% Bromophenol blue and 0.05%Xylene Cyanol FF).

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: These primers were designed to differ from PPP3CA and PPP3CB sequence, particularly at the 3′ end, to be PPP3CC specific. .. Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions.

    Injection:

    Article Title: Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin
    Article Snippet: A galanin/galanin message-associated peptide (GMAP) gene construct, including the second endogenous intron of the galanin gene, using a 1.3-kb PDGF-B promoter , was injected into pronuclei from fertilized mouse oocytes ( ) from a cross between F1 (C57BL/6 × CBA) mice. .. Mouse-tail biopsies were used for genotyping and DNA was amplified by using PCR with specific primers for galanin 5′-TGCCTCCCTAGAGTCGACGAGGGATCCTCGTGCGCT-3′ and 5′-AGGCATCCCAAGTCCCAGAGTGGCTGA-3′ and Taq DNA polymerase (2.5 units; Sigma); incubations were at 95°C for 45 s, at 54°C for 1 min, and at 72°C for 1 min for 30 cycles, finally, at 72°C for 10 min.

    Crocin Bleaching Assay:

    Article Title: Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin
    Article Snippet: A galanin/galanin message-associated peptide (GMAP) gene construct, including the second endogenous intron of the galanin gene, using a 1.3-kb PDGF-B promoter , was injected into pronuclei from fertilized mouse oocytes ( ) from a cross between F1 (C57BL/6 × CBA) mice. .. Mouse-tail biopsies were used for genotyping and DNA was amplified by using PCR with specific primers for galanin 5′-TGCCTCCCTAGAGTCGACGAGGGATCCTCGTGCGCT-3′ and 5′-AGGCATCCCAAGTCCCAGAGTGGCTGA-3′ and Taq DNA polymerase (2.5 units; Sigma); incubations were at 95°C for 45 s, at 54°C for 1 min, and at 72°C for 1 min for 30 cycles, finally, at 72°C for 10 min.

    Imaging:

    Article Title: Application of a phenotypic drug discovery strategy to identify biological and chemical starting points for inhibition of TSLP production in lung epithelial cells
    Article Snippet: Endpoint PCR reactions were performed in a total volume of 25 μl with 2.5 μl of the cDNA, 0.5 μl (0.5 U) of SIGMA Taq DNA Polymerase (D-6677), 200 μM of each dNTP (SIGMA DNTP10 Set), 1x SIGMA PCR buffer (P-2192) and 0.5 μM each of the corresponding GADPH or TSLP primers. .. The reaction was performed using a G-Storm GS1 Thermal Cycler (Gene Technologies), and analyzed using 1.5% agarose gel electrophoresis and a Bio-Rad ChemiDoc XRS+ imaging system.

    Mutagenesis:

    Article Title: Gal80 Dimerization and the Yeast GAL Gene Switch
    Article Snippet: .. Mutagenesis of the GAL80 gene was performed using Taq DNA Polymerase (Sigma, St. Louis) and the manganese (Mn)-dITP error-prone PCR method ( ; ). pAKS42 (2μ TRP1 , PADH1 ::DBGAL80 ) encoding the two-hybrid bait fusion protein, DBGal80, was used as template for the Mn-dITP error-prone PCR reactions. .. Each of four separate regions of the GAL80 ORF was amplified to create four PCR product pools, which together represented the entire GAL80 ORF.

    Isolation:

    Article Title: Molecular Cloning and Functional Analysis of a Na+-Insensitive K+ Transporter of Capsicum chinense Jacq
    Article Snippet: Semi-quantitative PCR was performed using cDNA synthesized from 1 μg of total RNA isolated as described above. .. PCR was repeated three times using Taq polymerase (Sigma).

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions.

    Article Title: Aspartate transporter expression and activity in hypertrophic rat heart and ischaemia-reperfusion injury
    Article Snippet: Total RNA was isolated from hearts and brains of SHR and WKY rats using TRI Reagent (Sigma) in accordance with the manufacturer's instructions. .. PCR was carried out in a reaction volume of 50 µl containing cDNA, dNTPs, polymerase buffer (Sigma), primers, and Taq DNA polymerase (Sigma).

    Size-exclusion Chromatography:

    Article Title: In-Vitro Helix Opening of M. tuberculosis oriC by DnaA Occurs at Precise Location and Is Inhibited by IciA Like Protein
    Article Snippet: Primer extension 10 μl of the primer extension mix included 200 μM each dNTPs, 0.04 pM 32 P end labeled primer [SeqOriR1, SeqOriR2 or SeqOriR3 ( )] 0.5 mM MgCl2 , 2% DMSO and 0.5 Units Taq DNA polymerase (SIGMA). .. The mixture was subjected to primer extension (SeqOriR1) in a thermocycler for 30 cycles: 94°C for 1 min, 92°C for 30 sec., 54°C for 30 sec. and 72°C for 1 min except for 5 min in the last amplification cycle.

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions. .. Reactions were performed by touchdown PCR amplification as follows: an initial denaturation step at 94°C for 2 min, followed by 20 amplification cycles: 30 sec at 94°C; 45 sec at 68°C initially, 45 sec at 72°C (minus 1°C at each cycle) followed by 15 amplification cycles: 30 sec at 94°C; 45 sec at 53°C, 45 sec at 72°C, followed by a final extension step at 72°C for 7 min. Products were subjected to 2% agarose gel electrophoresis, visualized by ethidium bromide staining and photographed by using an eagle eye apparatus (Stratagene).

    Labeling:

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: Routine PCR amplifications were done with the Sigma Taq DNA polymerase. .. DNA primers were 32 P end labeled with the T4 polynucleotide kinase , and primer extension was performed as previously described ( ).

    Article Title: In-Vitro Helix Opening of M. tuberculosis oriC by DnaA Occurs at Precise Location and Is Inhibited by IciA Like Protein
    Article Snippet: .. Primer extension 10 μl of the primer extension mix included 200 μM each dNTPs, 0.04 pM 32 P end labeled primer [SeqOriR1, SeqOriR2 or SeqOriR3 ( )] 0.5 mM MgCl2 , 2% DMSO and 0.5 Units Taq DNA polymerase (SIGMA). .. The mixture was subjected to primer extension (SeqOriR1) in a thermocycler for 30 cycles: 94°C for 1 min, 92°C for 30 sec., 54°C for 30 sec. and 72°C for 1 min except for 5 min in the last amplification cycle.

    Purification:

    Article Title: Investigation of the Matrix Metalloproteinase-2 Gene in Patients with Non-Syndromic Mitral Valve Prolapse
    Article Snippet: Reactions were performed in 25 µL volumes containing 50 ng genomic DNA, 1X reaction buffer (Sigma-Aldrich, Saint-Louis, MO, USA), 1.5 mM MgCl2 (Sigma-Aldrich), 0.2 mM each dNTP (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 0.25 µM each of both primers and 1.25 U Taq DNA polymerase (Sigma-Aldrich). .. Purified PCR products were then sequenced with a big dye terminator cycle-sequencing system (Applied Biosystems, Thermo Fisher Scientific) and amplified DNA fragments were separated using an ABI Prism 3730 DNA Analyzer Sequencer (Applied Biosystems, Thermo Fisher Scientific).

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. The band was excised from the gel, purified using a gel extraction kit (Qiagen, Hilden, Germany) and blunt-end cloned into pST Blue Vector (Novagen, Schwalbach, Germany).

    Polymerase Chain Reaction:

    Article Title: Gal80 Dimerization and the Yeast GAL Gene Switch
    Article Snippet: .. Mutagenesis of the GAL80 gene was performed using Taq DNA Polymerase (Sigma, St. Louis) and the manganese (Mn)-dITP error-prone PCR method ( ; ). pAKS42 (2μ TRP1 , PADH1 ::DBGAL80 ) encoding the two-hybrid bait fusion protein, DBGal80, was used as template for the Mn-dITP error-prone PCR reactions. .. Each of four separate regions of the GAL80 ORF was amplified to create four PCR product pools, which together represented the entire GAL80 ORF.

    Article Title: Alzheimer's brains show inter-related changes in RNA and lipid metabolism
    Article Snippet: .. PCR was performed using Taq DNA polymerase (Sigma). ..

    Article Title: Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin
    Article Snippet: .. Mouse-tail biopsies were used for genotyping and DNA was amplified by using PCR with specific primers for galanin 5′-TGCCTCCCTAGAGTCGACGAGGGATCCTCGTGCGCT-3′ and 5′-AGGCATCCCAAGTCCCAGAGTGGCTGA-3′ and Taq DNA polymerase (2.5 units; Sigma); incubations were at 95°C for 45 s, at 54°C for 1 min, and at 72°C for 1 min for 30 cycles, finally, at 72°C for 10 min. .. The PCR product showed a 445-bp wild-type (WT) band or a 248-bp GalOE band.

    Article Title: Application of a phenotypic drug discovery strategy to identify biological and chemical starting points for inhibition of TSLP production in lung epithelial cells
    Article Snippet: .. Endpoint PCR reactions were performed in a total volume of 25 μl with 2.5 μl of the cDNA, 0.5 μl (0.5 U) of SIGMA Taq DNA Polymerase (D-6677), 200 μM of each dNTP (SIGMA DNTP10 Set), 1x SIGMA PCR buffer (P-2192) and 0.5 μM each of the corresponding GADPH or TSLP primers. .. The reaction was performed using a G-Storm GS1 Thermal Cycler (Gene Technologies), and analyzed using 1.5% agarose gel electrophoresis and a Bio-Rad ChemiDoc XRS+ imaging system.

    Article Title: cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications 1
    Article Snippet: .. PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich). ..

    Article Title: Investigation of the Matrix Metalloproteinase-2 Gene in Patients with Non-Syndromic Mitral Valve Prolapse
    Article Snippet: Genomic DNA from 47 familial cases and four DNAs of unaffected probands were amplified by PCR. .. Reactions were performed in 25 µL volumes containing 50 ng genomic DNA, 1X reaction buffer (Sigma-Aldrich, Saint-Louis, MO, USA), 1.5 mM MgCl2 (Sigma-Aldrich), 0.2 mM each dNTP (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 0.25 µM each of both primers and 1.25 U Taq DNA polymerase (Sigma-Aldrich).

    Article Title: Molecular Cloning and Functional Analysis of a Na+-Insensitive K+ Transporter of Capsicum chinense Jacq
    Article Snippet: .. PCR was repeated three times using Taq polymerase (Sigma). ..

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: .. Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. After a ‘hot start’ with an initial denaturation at 95 °C for 3 min, each PCR cycle involved denaturation at 94 °C for 30 s, annealing at 60 °C for 60 s and extension at 72 °C for 45 s. The last cycle was followed by an extension step at 72 °C for 7 min. Isolated RNA amplified without reverse transcriptase or random hexamers was used as a negative control.

    Article Title: Characterisation of a panel of anti-tetanus toxin single-chain Fvs reveals cooperative binding
    Article Snippet: 2.1 Bst NI antibody fingerprinting The scFv DNA sequence inserts were amplified from pCANTAB6 by PCR using primers LMB3 (5′-CAGGAAACAGCTATGAC-3′) and FDSEQ1 (5′-GAATTTTCTGTATGAGG-3′). .. TAQ polymerase (Sigma) (5 u) was added along with the appropriate buffer supplied by the manufacturer and nuclease free water.

    Article Title: Aspartate transporter expression and activity in hypertrophic rat heart and ischaemia-reperfusion injury
    Article Snippet: .. PCR was carried out in a reaction volume of 50 µl containing cDNA, dNTPs, polymerase buffer (Sigma), primers, and Taq DNA polymerase (Sigma). .. Amplification of EAAT2-4 was performed with initial denaturation at 94°C for 3 min followed by 27 cycles comprising 30 s at 94°C, 45 s at 50°C, 30 s at 72°C followed by a 7-min extension at 72°C.

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: .. Routine PCR amplifications were done with the Sigma Taq DNA polymerase. .. For cloning purposes, higher-fidelity amplifications were obtained with the native Pfu DNA polymerase (Stratagene).

    Article Title: Salmonella enterica Serotype Bredeney: Antimicrobial Susceptibility and Molecular Diversity of Isolates from Ireland and Northern Ireland
    Article Snippet: .. Reactions were performed in 50-μl final volumes containing 200 ng of genomic DNA, 100 pmol of a 10-mer arbitrary primer, P1254 (5′-CCGCAGCCAA-3′) , 5 μl of 10× PCR buffer (100 mmol of Tris-HCl [pH 9.0], 500 mmol of KCl, and 1% Triton X-100 per liter), 8 μl of deoxynucleoside triphosphate mix (containing 1.25 mmol/liter each of dATP, dCTP, dGTP, and dTTP), 2.5 mmol of MgCl2, and 2.5 U of Taq DNA polymerase (Sigma, St. Louis, Mo.) per liter. .. Amplification conditions were denaturation at 94°C for 5 min, followed by 40 cycles of 94°C for 1 min, 40°C for 1 min, and 72°C for 1 min and a final extension step at 72°C for 5 min.

    Staining:

    Article Title: cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications 1
    Article Snippet: PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich). .. The PCR products were separated by electrophoresis in 1.5% agarose gels in 1× Tris-borate/EDTA (TBE) buffer and visualized by ethidium bromide staining.

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. The amplification product was separated by 1.5 % agarose gel electrophoresis and visualized by ethidium bromide staining.

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions. .. Reactions were performed by touchdown PCR amplification as follows: an initial denaturation step at 94°C for 2 min, followed by 20 amplification cycles: 30 sec at 94°C; 45 sec at 68°C initially, 45 sec at 72°C (minus 1°C at each cycle) followed by 15 amplification cycles: 30 sec at 94°C; 45 sec at 53°C, 45 sec at 72°C, followed by a final extension step at 72°C for 7 min. Products were subjected to 2% agarose gel electrophoresis, visualized by ethidium bromide staining and photographed by using an eagle eye apparatus (Stratagene).

    Mouse Assay:

    Article Title: Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin
    Article Snippet: Paragraph title: Generation and Genotyping of GalOE Mice. ... Mouse-tail biopsies were used for genotyping and DNA was amplified by using PCR with specific primers for galanin 5′-TGCCTCCCTAGAGTCGACGAGGGATCCTCGTGCGCT-3′ and 5′-AGGCATCCCAAGTCCCAGAGTGGCTGA-3′ and Taq DNA polymerase (2.5 units; Sigma); incubations were at 95°C for 45 s, at 54°C for 1 min, and at 72°C for 1 min for 30 cycles, finally, at 72°C for 10 min.

    Plasmid Preparation:

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. The band was excised from the gel, purified using a gel extraction kit (Qiagen, Hilden, Germany) and blunt-end cloned into pST Blue Vector (Novagen, Schwalbach, Germany).

    Negative Control:

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. After a ‘hot start’ with an initial denaturation at 95 °C for 3 min, each PCR cycle involved denaturation at 94 °C for 30 s, annealing at 60 °C for 60 s and extension at 72 °C for 45 s. The last cycle was followed by an extension step at 72 °C for 7 min. Isolated RNA amplified without reverse transcriptase or random hexamers was used as a negative control.

    Agarose Gel Electrophoresis:

    Article Title: Application of a phenotypic drug discovery strategy to identify biological and chemical starting points for inhibition of TSLP production in lung epithelial cells
    Article Snippet: Endpoint PCR reactions were performed in a total volume of 25 μl with 2.5 μl of the cDNA, 0.5 μl (0.5 U) of SIGMA Taq DNA Polymerase (D-6677), 200 μM of each dNTP (SIGMA DNTP10 Set), 1x SIGMA PCR buffer (P-2192) and 0.5 μM each of the corresponding GADPH or TSLP primers. .. The reaction was performed using a G-Storm GS1 Thermal Cycler (Gene Technologies), and analyzed using 1.5% agarose gel electrophoresis and a Bio-Rad ChemiDoc XRS+ imaging system.

    Article Title: cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications 1
    Article Snippet: Thirty-three primer pairs were designed initially, synthesized, and tested on seven individuals from Kashmir and Quebec by running the PCR products in 1.5% agarose gel in 1× Tris-acetate/EDTA (TAE). .. PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich).

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. The amplification product was separated by 1.5 % agarose gel electrophoresis and visualized by ethidium bromide staining.

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions. .. Reactions were performed by touchdown PCR amplification as follows: an initial denaturation step at 94°C for 2 min, followed by 20 amplification cycles: 30 sec at 94°C; 45 sec at 68°C initially, 45 sec at 72°C (minus 1°C at each cycle) followed by 15 amplification cycles: 30 sec at 94°C; 45 sec at 53°C, 45 sec at 72°C, followed by a final extension step at 72°C for 7 min. Products were subjected to 2% agarose gel electrophoresis, visualized by ethidium bromide staining and photographed by using an eagle eye apparatus (Stratagene).

    Concentration Assay:

    Article Title: Alzheimer's brains show inter-related changes in RNA and lipid metabolism
    Article Snippet: PCR was performed using Taq DNA polymerase (Sigma). .. Serial dilution of samples served to evaluate primer-efficiency and the cDNA concentration that yields linear differences.

    Article Title: Characterisation of a panel of anti-tetanus toxin single-chain Fvs reveals cooperative binding
    Article Snippet: Reactions included primers at a concentration of 10 pmol/μl, an equimolar mixture of dNTPs (200 μM final concentration) and 25 mM MgCl2 . .. TAQ polymerase (Sigma) (5 u) was added along with the appropriate buffer supplied by the manufacturer and nuclease free water.

    Article Title: In Lactobacillus plantarum, Carbamoyl Phosphate Is Synthesized by Two Carbamoyl-Phosphate Synthetases (CPS): Carbon Dioxide Differentiates the Arginine-Repressed from the Pyrimidine-Regulated CPS
    Article Snippet: RNA extractions were performed according to the Lactobacillus bulgaricus hot phenol protocol ( ) adapted to L. plantarum by adding β-mercaptoethanol (1.9 mM, final concentration) and increasing lysozyme 30-fold and sodium dodecyl sulfate 10-fold ( ). .. Routine PCR amplifications were done with the Sigma Taq DNA polymerase.

    Article Title: Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit
    Article Snippet: .. Fragments were amplified in a 25-μl reaction mixture containing ≈0.25 ng cDNA (CLONTECH) or 1.0 ng (Origene), each primer at 400 nM concentration, each dNTP at 200 μM concentration and 1.5 units of Taq polymerase (Sigma) in OptiPrime (Stratagene) buffer 6 conditions. .. Reactions were performed by touchdown PCR amplification as follows: an initial denaturation step at 94°C for 2 min, followed by 20 amplification cycles: 30 sec at 94°C; 45 sec at 68°C initially, 45 sec at 72°C (minus 1°C at each cycle) followed by 15 amplification cycles: 30 sec at 94°C; 45 sec at 53°C, 45 sec at 72°C, followed by a final extension step at 72°C for 7 min. Products were subjected to 2% agarose gel electrophoresis, visualized by ethidium bromide staining and photographed by using an eagle eye apparatus (Stratagene).

    Marker:

    Article Title: Application of a phenotypic drug discovery strategy to identify biological and chemical starting points for inhibition of TSLP production in lung epithelial cells
    Article Snippet: Endpoint PCR reactions were performed in a total volume of 25 μl with 2.5 μl of the cDNA, 0.5 μl (0.5 U) of SIGMA Taq DNA Polymerase (D-6677), 200 μM of each dNTP (SIGMA DNTP10 Set), 1x SIGMA PCR buffer (P-2192) and 0.5 μM each of the corresponding GADPH or TSLP primers. .. The reference marker used was 100 bp DNA ladder from VWR (K180).

    Gel Extraction:

    Article Title: Functional coupling between nitric oxide synthesis and VIP release within enteric nerve terminals of the rat: involvement of protein kinase G and phosphodiesterase 5
    Article Snippet: Thirty-five rounds of PCR amplification were carried out in a Biometra UNO I thermal cycler using 2.5 U Taq polymerase (Sigma), 1 μl of the RT reaction mixture and the following conditions. .. The band was excised from the gel, purified using a gel extraction kit (Qiagen, Hilden, Germany) and blunt-end cloned into pST Blue Vector (Novagen, Schwalbach, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Millipore nova taq dna polymerase
    Nova Taq Dna Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nova taq dna polymerase/product/Millipore
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nova taq dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results