Structured Review

Roche nonidet p40 np 40
Nonidet P40 Np 40, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nonidet p40 np 40/product/Roche
Average 91 stars, based on 1 article reviews
Price from $9.99 to $1999.99
nonidet p40 np 40 - by Bioz Stars, 2020-03
91/100 stars

Images

Related Articles

Centrifugation:

Article Title: Secoisolariciresinol Diglucoside Abrogates Oxidative Stress-Induced Damage in Cardiac Iron Overload Condition
Article Snippet: Western blot Cells were homogenized in 200 μL of Nonidet P40 (NP-40) (Roche Diagnostics, Mannheim, Germany) buffer containing 150 mM NaCl, 1% NP-40, 50 mM Tris (pH 8.0) and protease inhibitors phenylmethylsulfonyl fluoride, leupeptin, aprotinin and pepstatin. .. Cell debris was removed by centrifugation at 12,000 x g for 30 minutes at 4°C, and the protein content determined by Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Oligonucleotide Synthesis:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

Purification:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′ .. Tissue culture plates (Denville, cat. no. T1115) Pipette tips (Denville, cat. nos.

SYBR Green Assay:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′ .. Tissue culture plates (Denville, cat. no. T1115) Pipette tips (Denville, cat. nos.

Concentration Assay:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: Ethanol (200 proof; Gold Shield, cat. no. 412804) Buffer RWT (Qiagen, cat. no. 1067933) HEPES, 1 M (Life Technologies, cat. no. 15630-080) Magnesium chloride, 1 M (MgCl2 ; Ambion, cat. no. AM9530G) Sodium chloride, 5 M (NaCl; Ambion, cat. no. AM9759) Click-IT biotin DIBO alkyne (Life Technologies, cat. no. C-10412) RiboLock RNase inhibitor (40 U/µl; Thermo Scientific, cat. no. EO0384) RNA fragmentation reagents (Ambion, cat. no. AM8740) T4 polynucleotide kinase (PNK; New England BioLabs, cat. no. M0201L) Tris, pH 7.0, 1 M (Ambion, cat. no. AM9850G) FastAP thermosensitive alkaline phosphatase (1 U/µl; Thermo Scientific, cat. no. EF0651) T4 RNA ligase 1 (ssRNA ligase), high concentration (New England BioLabs, cat. no. M0437M) Preadenylylated and 3′-biotin blocked RNA linker (DMSO samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3Biotin/ ▲ CRITICAL 5′preadenylylated and 3′ blocked RNA linkers are important for efficient 3′end RNA ligations. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

Polyacrylamide Gel Electrophoresis:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′ .. Tissue culture plates (Denville, cat. no. T1115) Pipette tips (Denville, cat. nos.

Bradford Assay:

Article Title: Secoisolariciresinol Diglucoside Abrogates Oxidative Stress-Induced Damage in Cardiac Iron Overload Condition
Article Snippet: Western blot Cells were homogenized in 200 μL of Nonidet P40 (NP-40) (Roche Diagnostics, Mannheim, Germany) buffer containing 150 mM NaCl, 1% NP-40, 50 mM Tris (pH 8.0) and protease inhibitors phenylmethylsulfonyl fluoride, leupeptin, aprotinin and pepstatin. .. Cell debris was removed by centrifugation at 12,000 x g for 30 minutes at 4°C, and the protein content determined by Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Polymerase Chain Reaction:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′ .. Tissue culture plates (Denville, cat. no. T1115) Pipette tips (Denville, cat. nos.

Western Blot:

Article Title: Secoisolariciresinol Diglucoside Abrogates Oxidative Stress-Induced Damage in Cardiac Iron Overload Condition
Article Snippet: .. Western blot Cells were homogenized in 200 μL of Nonidet P40 (NP-40) (Roche Diagnostics, Mannheim, Germany) buffer containing 150 mM NaCl, 1% NP-40, 50 mM Tris (pH 8.0) and protease inhibitors phenylmethylsulfonyl fluoride, leupeptin, aprotinin and pepstatin. .. Cell debris was removed by centrifugation at 12,000 x g for 30 minutes at 4°C, and the protein content determined by Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Hood:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: CAUTION Trizol and chloroform are hazardous, and caution should be taken when handling them; work should be performed in a chemical fume hood. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

Staining:

Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
Article Snippet: .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′ .. Tissue culture plates (Denville, cat. no. T1115) Pipette tips (Denville, cat. nos.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Roche nonident p40 np 40 lysis buffer
    Nonident P40 Np 40 Lysis Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nonident p40 np 40 lysis buffer/product/Roche
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    nonident p40 np 40 lysis buffer - by Bioz Stars, 2020-03
    93/100 stars
      Buy from Supplier

    99
    Roche nonidet p40
    Nonidet P40, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 109 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nonidet p40/product/Roche
    Average 99 stars, based on 109 article reviews
    Price from $9.99 to $1999.99
    nonidet p40 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    96
    Roche nonidet p40 substitute
    Nonidet P40 Substitute, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nonidet p40 substitute/product/Roche
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nonidet p40 substitute - by Bioz Stars, 2020-03
    96/100 stars
      Buy from Supplier

    99
    Roche nonident p40
    Nonident P40, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nonident p40/product/Roche
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nonident p40 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results