platelet activating factor paf  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Cyclopiazonic acid from Penicillium cyclopium
    Description:

    Catalog Number:
    c1530
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore platelet activating factor paf
    Cyclopiazonic acid from Penicillium cyclopium

    https://www.bioz.com/result/platelet activating factor paf/product/Millipore
    Average 99 stars, based on 8431 article reviews
    Price from $9.99 to $1999.99
    platelet activating factor paf - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "S-nitrosation of ?-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability"

    Article Title: S-nitrosation of ?-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    Journal: Circulation research

    doi: 10.1161/CIRCRESAHA.112.274548

    PAF-induced hyperpermeability to macromolecules correlates strongly with SNO of β-catenin and p120 in EAhy926 cells. A) PAF-induced hyperpermeability in EAhy926 cells is blocked by inhibition of SNO with NAC (left side) and by inhibition of eNOS
    Figure Legend Snippet: PAF-induced hyperpermeability to macromolecules correlates strongly with SNO of β-catenin and p120 in EAhy926 cells. A) PAF-induced hyperpermeability in EAhy926 cells is blocked by inhibition of SNO with NAC (left side) and by inhibition of eNOS

    Techniques Used: Inhibition

    Related Articles

    MTT Assay:

    Article Title: Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
    Article Snippet: Cells and neurons were treated with either 20 μM aggregation inhibitor ASI‐1D ( > 98% pure H‐RGGAVVTGRRRRRR‐NH2 (Schafer‐N, Copenhagen, DK), 10 mM stock in 98% ethanol ) or 0.5 μM CPA (Sigma‐Aldrich, #C1530, 10 mM stock in DMSO). .. The viability of SH‐SY5Y cells was evaluated by metabolic activity in an MTT assay (Life Technologies).

    Cell Isolation:

    Article Title: There and back again: iterating between population-based modeling and experiments reveals surprising regulation of calcium transients in rat cardiac myocytes
    Article Snippet: Cell isolation was carried out in otherwise identical solutions with different concentrations of CaCl2 , as noted. .. Drugs applied during experiments were 4-aminopyridine (4-AP, Sigma-Aldrich ), cyclopiazonic acid (CPA) from Penicillium cyclopium (Sigma-Aldrich C1530), and caffeine (Sigma-Aldrich C7731).

    Expressing:

    Article Title: Role of Mitochondrial Dynamics in Neuronal Development: Mechanism for Wolfram Syndrome
    Article Snippet: Plasmids expressing mitochondrial DsRed2 (632421) and EGFP (6085–1) were from Clontech. .. DHPG (0805) and Bay K 8644 (1544) were from Tocris Bioscience, Brefeldin A (B6542) and Cyclopiazonic acid (C1530) were from Sigma-Aldrich, and Araguspongin B was from Cayman Chemical (10006797).

    Fluorescence:

    Article Title: Role of Mitochondrial Dynamics in Neuronal Development: Mechanism for Wolfram Syndrome
    Article Snippet: DHPG (0805) and Bay K 8644 (1544) were from Tocris Bioscience, Brefeldin A (B6542) and Cyclopiazonic acid (C1530) were from Sigma-Aldrich, and Araguspongin B was from Cayman Chemical (10006797). .. All fluorescence dyes and culture media were from Life Technologies.

    Transgenic Assay:

    Article Title: Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
    Article Snippet: Primary neurons were genotyped for transgenic AS and gender using the primers ASO‐sense: 5′‐GACGGGTGTGACAGCAGTAGCC‐3′, ASO‐antisense: 5′‐GATGATGGCATGCAGCACTGG‐3′ and SRY F: 5′‐TTGTCTAGAGAGCATGGAGGGCCATGTCAA‐3′, SRY R: 5′‐CCACTCCTCTGTGACACTTTAGCCCTCCGA‐3′. .. Cells and neurons were treated with either 20 μM aggregation inhibitor ASI‐1D ( > 98% pure H‐RGGAVVTGRRRRRR‐NH2 (Schafer‐N, Copenhagen, DK), 10 mM stock in 98% ethanol ) or 0.5 μM CPA (Sigma‐Aldrich, #C1530, 10 mM stock in DMSO).

    Cell Culture:

    Article Title: Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
    Article Snippet: Paragraph title: Cell culture and assays ... Cells and neurons were treated with either 20 μM aggregation inhibitor ASI‐1D ( > 98% pure H‐RGGAVVTGRRRRRR‐NH2 (Schafer‐N, Copenhagen, DK), 10 mM stock in 98% ethanol ) or 0.5 μM CPA (Sigma‐Aldrich, #C1530, 10 mM stock in DMSO).

    Microscopy:

    Article Title: ATF6 safeguards organelle homeostasis and cellular aging in human mesenchymal stem cells
    Article Snippet: After being loaded for 30 min at room temperature (RT) (away from light), the coverslip was washed with KRH buffer for three times and then subjected to imaging on a perfusion chamber on an inverted Nikon TiE microscope with 20× Fluar objective. .. When beginning the test, the imaging buffer was perfused and changed from 2 mM Ca2+ to 0 mM Ca2+ (with 1 mM EGTA) buffer followed by 0 mM Ca2+ KRH buffer (1 mM EGTA) with CPA (20 μM, Sigma, C1530) to deplete the store of ER, and then changed to 2 mM Ca2+ buffer with CPA (20 μM) to induce store-operated calcium entry (SOCE) response.

    Purification:

    Article Title: Abnormal proplatelet formation and emperipolesis in cultured human megakaryocytes from gray platelet syndrome patients
    Article Snippet: Materials Adenosine 5′-diphosphate (ADP), Hoechst 33258, Poly-L-lysine solution, paraformaldehyde (PFA), eosin-hematoxylin solution, Triton X-100, tetramethyrhodamine isothiocyanate (TRITC)-conjugated phalloidin and cyclopiazonic acid from Penicillium cyclopium (CPA) were from Sigma Aldrich (Milan, Italy). .. Type I collagen was purified as described previously .

    Imaging:

    Article Title: ATF6 safeguards organelle homeostasis and cellular aging in human mesenchymal stem cells
    Article Snippet: .. When beginning the test, the imaging buffer was perfused and changed from 2 mM Ca2+ to 0 mM Ca2+ (with 1 mM EGTA) buffer followed by 0 mM Ca2+ KRH buffer (1 mM EGTA) with CPA (20 μM, Sigma, C1530) to deplete the store of ER, and then changed to 2 mM Ca2+ buffer with CPA (20 μM) to induce store-operated calcium entry (SOCE) response. ..

    Concentration Assay:

    Article Title: Activation of a Ca2+-permeable cation channel produces a prolonged attenuation of intracellular Ca2+ release in Aplysia bag cell neurones
    Article Snippet: Heparin (Sigma H3393; 15 mM in the electrode) was co-injected with fura-PE3 to a final estimated concentration in the cell of 75–150 μM. .. Thapsigargin (Sigma T3250), cyclopiazonic acid (Sigma C1530) and nifedipine (Sigma N7634) required dimethyl sulfoxide (DMSO) as a vehicle.

    Article Title: ATF6 safeguards organelle homeostasis and cellular aging in human mesenchymal stem cells
    Article Snippet: The Metafluor Program software was used to monitor the calcium concentration changes in the cytoplasm, and the intracellular Ca2+ concentration was expressed as the 340/380 ratio. .. When beginning the test, the imaging buffer was perfused and changed from 2 mM Ca2+ to 0 mM Ca2+ (with 1 mM EGTA) buffer followed by 0 mM Ca2+ KRH buffer (1 mM EGTA) with CPA (20 μM, Sigma, C1530) to deplete the store of ER, and then changed to 2 mM Ca2+ buffer with CPA (20 μM) to induce store-operated calcium entry (SOCE) response.

    Article Title: There and back again: iterating between population-based modeling and experiments reveals surprising regulation of calcium transients in rat cardiac myocytes
    Article Snippet: The Ca2+ -free digestion solution contained 0.35–0.5 mg/mL type II collagenase from Clostridium histolyticum (Worthington CLS-2, concentration adjusted for each lot) and 0.03 mg/mL type XIV protease from Streptomyces griseus (Sigma P5147). .. Drugs applied during experiments were 4-aminopyridine (4-AP, Sigma-Aldrich ), cyclopiazonic acid (CPA) from Penicillium cyclopium (Sigma-Aldrich C1530), and caffeine (Sigma-Aldrich C7731).

    Incubation:

    Article Title: Apoptosis-linked Gene-2 (ALG-2)/Sec31 Interactions Regulate Endoplasmic Reticulum (ER)-to-Golgi Transport
    Article Snippet: .. Cells to be depleted of luminal Ca2+ were washed twice with Ca2+ -free DMEM, 10% FBS containing 10 μ m CPA (Sigma C1530), 1 m m EGTA, and 25 m m Hepes, pH 7.2, and then incubated in that medium for 15 min. .. This was followed by a 15-min incubation in Ca2+ -free DMEM, 10% FBS, no CPA, 0.3 m m EGTA, and 25 m m Hepes, pH 7.2.

    other:

    Article Title: Calmodulin Activation of an Endoplasmic Reticulum-Located Calcium Pump Involves an Interaction with the N-Terminal Autoinhibitory Domain 1
    Article Snippet: Erythrosin B (E-7505), cyclopiazonic acid (C-1530), and bovine brain calmodulin (P-2277) were obtained from Sigma-Aldrich (St. Louis).

    Article Title: Plasma membrane calcium ATPase deficiency causes neuronal pathology in the spinal cord: a potential mechanism for neurodegeneration in multiple sclerosis and spinal cord injury
    Article Snippet: 5-(and-6)-carboxyeosin diacetate, succinimidyl ester (CE, Molecular Probes, Eugene, OR), thapsigargin and cyclopiazonic acid, Penicillium cyclopium (CPA, Calbiochem, San Diego, CA), were dissolved in DMSO.

    Article Title: Palmitoylation controls trafficking of the intracellular Ca2+ channel MCOLN3/TRPML3 to regulate autophagy
    Article Snippet: Other reagents used were Alexa Fluor 488-EGF (Invitrogen, ), Alexa Fluor 488-TF (Invitrogen, ), biotin-azide (Invitrogen, ), Fura-2 AM (Invitrogen, F1225), ML-SA1 (Merck Millipore, 648493), GPN (Cayman Chemical, 14634), 17-ODYA (Cayman Chemical, 90270), hydroxylamine hydrochloride (Sigma-Aldrich, 159417), brefeldin A (Toronto Research Chemicals, B677240), dynasore (Sigma-Aldrich, D7693), BAPTA-AM (Invitrogen, B1204), bafilomycin A1 (Merck Millipore, 196000), HBSS (Sigma-Aldrich, H8264), CPA (Sigma-Aldrich, C1530), E64d (Merck Millipore, 330005), pepstatin A (Sigma-Aldrich, P5318), and ML-SI1 ( hydrochloride; Sigma-Aldrich, G1421).

    Activity Assay:

    Article Title: Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
    Article Snippet: Cells and neurons were treated with either 20 μM aggregation inhibitor ASI‐1D ( > 98% pure H‐RGGAVVTGRRRRRR‐NH2 (Schafer‐N, Copenhagen, DK), 10 mM stock in 98% ethanol ) or 0.5 μM CPA (Sigma‐Aldrich, #C1530, 10 mM stock in DMSO). .. The viability of SH‐SY5Y cells was evaluated by metabolic activity in an MTT assay (Life Technologies).

    Article Title: Oxidative stress‐induced dysregulation of excitation–contraction coupling contributes to muscle weakness) Oxidative stress‐induced dysregulation of excitation–contraction coupling contributes to muscle weakness
    Article Snippet: .. Basal activity was determined in the presence of 40 μM of the Ca2+ ‐ATPase inhibitor cyclopiazonic acid (C‐1530, Sigma) in dimethyl sulfoxide. .. Because SERCA dysfunction can perturb cytosolic calcium levels leading to activation of calcium‐dependent proteases, we measured the calpain activity in the gastrocnemius muscle homogenates as previously described with slight modifications.

    Construct:

    Article Title: Role of Mitochondrial Dynamics in Neuronal Development: Mechanism for Wolfram Syndrome
    Article Snippet: Mito-Keima was from Amalgaam (AM-V0251), and mito-KikGR1 was constructed as described earlier [ ]. .. DHPG (0805) and Bay K 8644 (1544) were from Tocris Bioscience, Brefeldin A (B6542) and Cyclopiazonic acid (C1530) were from Sigma-Aldrich, and Araguspongin B was from Cayman Chemical (10006797).

    Inverted Microscopy:

    Article Title: Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
    Article Snippet: Cells and neurons were treated with either 20 μM aggregation inhibitor ASI‐1D ( > 98% pure H‐RGGAVVTGRRRRRR‐NH2 (Schafer‐N, Copenhagen, DK), 10 mM stock in 98% ethanol ) or 0.5 μM CPA (Sigma‐Aldrich, #C1530, 10 mM stock in DMSO). .. Images were obtained using a Zeiss Observer Z1 inverted microscope equipped with ApoTome.2.

    Staining:

    Article Title: There and back again: iterating between population-based modeling and experiments reveals surprising regulation of calcium transients in rat cardiac myocytes
    Article Snippet: Cells were stained with di-8-ANEPPS in a solution of 10 μM di-8-ANEPPS (Biotium 61012) in 0.2% DMSO. .. Drugs applied during experiments were 4-aminopyridine (4-AP, Sigma-Aldrich ), cyclopiazonic acid (CPA) from Penicillium cyclopium (Sigma-Aldrich C1530), and caffeine (Sigma-Aldrich C7731).

    Modification:

    Article Title: There and back again: iterating between population-based modeling and experiments reveals surprising regulation of calcium transients in rat cardiac myocytes
    Article Snippet: Cells were loaded with fluo-3 in a solution of 5 μM Fluo-3, acetoxymethyl (AM) ester (Biotium 50013) and 0.2% pluronic F-127 (Sigma P2443) in modified Tyrode solution with 0.8% DMSO. .. Drugs applied during experiments were 4-aminopyridine (4-AP, Sigma-Aldrich ), cyclopiazonic acid (CPA) from Penicillium cyclopium (Sigma-Aldrich C1530), and caffeine (Sigma-Aldrich C7731).

    Western Blot:

    Article Title: Stem cell-derived cranial and spinal motor neurons reveal proteostatic differences between ALS resistant and sensitive motor neurons
    Article Snippet: .. Antibodies and reagents Reagents used in the western blot and survival assays: cyclopiazonic acid (CPA; Sigma, C1530-5MG), tunicamycin (Sigma, T7765), thapsigargin (Sigma, 586005), brefeldin A (Sigma, B7651), MG-132 (Sigma, 474790), PD169316 (Sigma, P9248) and dimethyl sulfoxide (DMSO; Sigma, D2650). .. Primary antibodies used for immunocytochemistry (ICC) mouse monoclonal antibody to neuronal class III β-tubulin (Tuj1, 1:500; BioLegend, MMS-); rabbit monoclonal antibody to Islet1 (1:200; Abcam, ab109517); rabbit polyclonal antibody to HA tag (1:1000; Abcam, ab9110); mouse monoclonal antibody to SQSTM1/p62 (1:500; Abcam, ab56416) and goat polyclonal anti-ChAT (1:100; AB144P, Millipore).

    Allele-specific Oligonucleotide:

    Article Title: Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
    Article Snippet: Primary neurons were genotyped for transgenic AS and gender using the primers ASO‐sense: 5′‐GACGGGTGTGACAGCAGTAGCC‐3′, ASO‐antisense: 5′‐GATGATGGCATGCAGCACTGG‐3′ and SRY F: 5′‐TTGTCTAGAGAGCATGGAGGGCCATGTCAA‐3′, SRY R: 5′‐CCACTCCTCTGTGACACTTTAGCCCTCCGA‐3′. .. Cells and neurons were treated with either 20 μM aggregation inhibitor ASI‐1D ( > 98% pure H‐RGGAVVTGRRRRRR‐NH2 (Schafer‐N, Copenhagen, DK), 10 mM stock in 98% ethanol ) or 0.5 μM CPA (Sigma‐Aldrich, #C1530, 10 mM stock in DMSO).

    Plasmid Preparation:

    Article Title: Role of Mitochondrial Dynamics in Neuronal Development: Mechanism for Wolfram Syndrome
    Article Snippet: The IP3 R1 channel fragment (MmCD00312368) was from PlasmID, pRL-CMV (E2261) was from Promega Co., and mKate2-mito (FP187) was from Evrogen. .. DHPG (0805) and Bay K 8644 (1544) were from Tocris Bioscience, Brefeldin A (B6542) and Cyclopiazonic acid (C1530) were from Sigma-Aldrich, and Araguspongin B was from Cayman Chemical (10006797).

    Software:

    Article Title: ATF6 safeguards organelle homeostasis and cellular aging in human mesenchymal stem cells
    Article Snippet: The Metafluor Program software was used to monitor the calcium concentration changes in the cytoplasm, and the intracellular Ca2+ concentration was expressed as the 340/380 ratio. .. When beginning the test, the imaging buffer was perfused and changed from 2 mM Ca2+ to 0 mM Ca2+ (with 1 mM EGTA) buffer followed by 0 mM Ca2+ KRH buffer (1 mM EGTA) with CPA (20 μM, Sigma, C1530) to deplete the store of ER, and then changed to 2 mM Ca2+ buffer with CPA (20 μM) to induce store-operated calcium entry (SOCE) response.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Millipore n g methyl l arginine
    N G Methyl L Arginine, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n g methyl l arginine/product/Millipore
    Average 96 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    n g methyl l arginine - by Bioz Stars, 2020-03
    96/100 stars
      Buy from Supplier

    Image Search Results