neb3 buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs neb3 buffer
    Neb3 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb3 buffer/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    neb3 buffer - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title:
    Article Snippet: .. Dephosphorylation For dephosphorylation experi-ments, H2 O2 treated or untreated HeLa cells were harvested by trypsinization, collected by centrifugation at 170g for 10 min, washed twice with PBS and resuspended in NEB3 Buffer (New England Biolabs, Ipswich, MA, USA), in which Calf intestinal phosphatase (CIP; New England Biolabs, Ipswich, MA, USA) has optimal activity. .. Cells were lysed by sonication and subsequent centrifugation at maximum speed for 30 min at 4°C.

    Amplification:

    Article Title:
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Article Title:
    Article Snippet: .. We circularized the linear 378-nt pseudogene (5 ng/μl) by T4 ligase (0.25 U/μl; Fermentas) in 1× rapid ligation buffer at 22°C for 10 min, followed by an inactivation step at 65°C for 10 min. We nicked the resulting circular pseudogene (1 ng/μl) by Nb.BsrDI and Nt.BspQI (0.5 U/μl, New England Biolabs) in 1× NEB3 buffer at 65°C for 2 h and we stopped the reaction by heating at 80°C for 20 min. We amplified the nicked circular pseudogene (0.1 ng/μl) at 30°C by RCA and T4 gene 32 (25 ng/μl; NEB) stopping the reaction by heat inactivation (80°C, for 20 min) at different time points. .. We digested RCA products by BseGI restriction enzyme (0.75 U/μl; Fermentas), which recognizes GGATG(2/0)∧ sites, incubating in Tango 1× buffer for 24 h at 55°C.

    Article Title:
    Article Snippet: .. RCA of DNA plasmids and digestion of RCA products We incubated pUC19 plasmid DNA (1 ng/μl, Invitrogen) with nicking endonuclease Nt.BspQI (0.5 U/μl, New England Biolabs (NEB)) in 1× NEB3 buffer for 2 h at 50°C, and then we heat inactivated the enzyme incubating the reaction mixture at 80°C for 20 min. We then amplified the resulting nicked DNA (0.25 ng/μl) by using phi29 DNA polymerase (0.5 U/μl, Fermentas) for 24 h at 30°C in a 1× phi29 reaction buffer (33 mM Tris acetate, 10 mM magnesium acetate, 66 mM potassium acetate, 0.1% (v/v) Tween 20 and 1 mM Dithiothreitol (DTT); Fermentas) containing dNTP mix (1 mM each; Fermentas) and increasing concentration of single stranded binding protein T4 gene 32 (0–100 ng/μl, NEB). .. We also performed nicking and amplification reactions with pBluescript II SK (+) (with and without T4 gene 32 protein) in the same conditions.

    Article Title:
    Article Snippet: ALU-Combined Bisulfite Restriction Analysis (COBRA) To observe methylation levels of Alu in samples, the sodium-bisulfite-treated DNA in each sample was amplified by PCR containing 1x PCR buffer (Qiagen, Germany), 0.2 mM of deoxynucleotide triphosphate (Promega, USA), 1 mM of magnesium chloride (Qiagen, Germany), 25 U of HotStarTaq DNA Polymerase (Qiagen, Germany), and 0.3 μM primer pairs: ALU-BRev (5′-CTAACTTTTTATATTTTTAATAAAAACRAAATTTCAC CA-3′) where R = A and G and Y = C and T. For Alu amplification, the program was set as follows: 95 °C for 15 min, 40 cycles of 95 °C for 45 s, 57 °C for 45 s, and 72 °C for 45 s, followed by a final extension of 72 °C for 7 min [ ]. .. Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight.

    Article Title:
    Article Snippet: The second PCR amplification of the standard SSH protocol (a total of 50 µl reaction volume) was performed and DNA ethanol precipitated. .. Together with the tester DNA, 50 µl reactions contained 15 U of restriction enzyme, 5 µl 10× NEB3 buffer (New England Biolabs) and 5 µg of bovine serum albumin.

    Article Title:
    Article Snippet: ・ QIAquick PCR Purification Kit (Qiagen) ・ QIAquick Gel Extraction kit (Qiagen) ・ Primer pairs for amplification of CNEs: 10 pmol/μL in TE (see Methods for details), stored at −20°C. .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge

    Polyacrylamide Gel Electrophoresis:

    Article Title:
    Article Snippet: Prior to CIP treatment of immunoprecipitations and phosphate-affinity PAGE, cells were collected and lyzed in 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40 supplemented with EDTA-free protease inhibitors (Roche). .. For CIP treatment beads were resuspended in 20 μl H2 O, splitted and each sample was supplied with 3 μl buffer NEB3 (New England Biolabs).

    Article Title:
    Article Snippet: We circularized the linear 378-nt pseudogene (5 ng/μl) by T4 ligase (0.25 U/μl; Fermentas) in 1× rapid ligation buffer at 22°C for 10 min, followed by an inactivation step at 65°C for 10 min. We nicked the resulting circular pseudogene (1 ng/μl) by Nb.BsrDI and Nt.BspQI (0.5 U/μl, New England Biolabs) in 1× NEB3 buffer at 65°C for 2 h and we stopped the reaction by heating at 80°C for 20 min. We amplified the nicked circular pseudogene (0.1 ng/μl) at 30°C by RCA and T4 gene 32 (25 ng/μl; NEB) stopping the reaction by heat inactivation (80°C, for 20 min) at different time points. .. We analyzed digested products on 1.5% agarose gel as described before and also on polyacrylamide gel electrophoresis (PAGE) (20% polyacrylamide, 20% formamide, 8 M urea mixed in 1× TBE which is made of 89 mM Tris-borate, 2 mM Na2 EDTA dissolved in deionized water) at 180 V for 1:15 h. We acquired images by UV trans-illumination (UVITEC) and we analyzed them by the software ImageJ, measuring the intensities of bands corresponding to double stranded digestion products (agarose gel) and the total DNA (denaturing PAGE).

    Article Title:
    Article Snippet: The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight. .. The products were identified by polyacrylamide gel electrophoresis (8% non-denaturing) and stained with SYBR green nucleic acid stain (Sigma-Aldrich, St. Louis, Missouri).

    Phosphatase Assay:

    Article Title:
    Article Snippet: Paragraph title: In Vitro Phosphatase Assay ... A total of 60 μg of lysate was incubated in 1× NEB3 buffer and with or without 10 units of calf intestinal phosphatase (CIP) (New England BioLabs, M0290S) for 1 h at 37 °C.

    Pyrolysis Gas Chromatography:

    Article Title:
    Article Snippet: The PGC was subsequently washed with 2 mL of 50 mM triethylamine acetate (TEAA) buffer, pH 7.0. .. Dried material was reconstituted in 85 µL of MilliQ water before 10 µL of 10× NEB3 buffer and 5 µL (50 U) of calf intestinal phosphatase (both New England Biolabs) were added.

    Construct:

    Article Title:
    Article Snippet: Paragraph title: RCA of MOSIC p378 construct ... We circularized the linear 378-nt pseudogene (5 ng/μl) by T4 ligase (0.25 U/μl; Fermentas) in 1× rapid ligation buffer at 22°C for 10 min, followed by an inactivation step at 65°C for 10 min. We nicked the resulting circular pseudogene (1 ng/μl) by Nb.BsrDI and Nt.BspQI (0.5 U/μl, New England Biolabs) in 1× NEB3 buffer at 65°C for 2 h and we stopped the reaction by heating at 80°C for 20 min. We amplified the nicked circular pseudogene (0.1 ng/μl) at 30°C by RCA and T4 gene 32 (25 ng/μl; NEB) stopping the reaction by heat inactivation (80°C, for 20 min) at different time points.

    SYBR Green Assay:

    Article Title:
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title:
    Article Snippet: The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight. .. The products were identified by polyacrylamide gel electrophoresis (8% non-denaturing) and stained with SYBR green nucleic acid stain (Sigma-Aldrich, St. Louis, Missouri).

    Incubation:

    Article Title:
    Article Snippet: .. Nuclei were resuspended in 500 μl of 1.2× NEB3 buffer (New England BioLabs) with 0.3% SDS and incubated at 37 °C for 1 h and then with 2% Triton X-100 for another 1 h. Digestion was performed with 800 U of BglII (New England BioLabs)overnight at 37 °C shaking. ..

    Article Title:
    Article Snippet: .. The beads were split into 3 portions, resuspended in 30 µl NEB3 buffer, and incubated at 37°C for 1 h with 10 units of calf intestinal phosphatase (CIP; New England Biolabs). .. Controls were incubated without CIP, and with CIP in the presence of inhibitors (10 mM Na3 VO4 and 4 mM Na2 MoO4 ).

    Article Title:
    Article Snippet: .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture. ..

    Article Title:
    Article Snippet: .. RCA of DNA plasmids and digestion of RCA products We incubated pUC19 plasmid DNA (1 ng/μl, Invitrogen) with nicking endonuclease Nt.BspQI (0.5 U/μl, New England Biolabs (NEB)) in 1× NEB3 buffer for 2 h at 50°C, and then we heat inactivated the enzyme incubating the reaction mixture at 80°C for 20 min. We then amplified the resulting nicked DNA (0.25 ng/μl) by using phi29 DNA polymerase (0.5 U/μl, Fermentas) for 24 h at 30°C in a 1× phi29 reaction buffer (33 mM Tris acetate, 10 mM magnesium acetate, 66 mM potassium acetate, 0.1% (v/v) Tween 20 and 1 mM Dithiothreitol (DTT); Fermentas) containing dNTP mix (1 mM each; Fermentas) and increasing concentration of single stranded binding protein T4 gene 32 (0–100 ng/μl, NEB). .. We also performed nicking and amplification reactions with pBluescript II SK (+) (with and without T4 gene 32 protein) in the same conditions.

    Article Title:
    Article Snippet: Briefly, 10 µg of tRNA was combined with 40 mU of Nuclease P1 from Penicillium citrinum (Sigma-Aldrich Biochemie GmbH) resuspended in 0.2 M CH3 CO2 Na (sodium acetate) pH 5.3 and 0.1 U of Shrimp Alkaline Phosphatase (Thermo Scientific) in 30 µL reactions at 37°C containing 2 mg/mL ZnCl2 and 1×NEB3 buffer (New England Biolabs GmbH) for near neutral reaction conditions, or 20 mM CH3 CO2 Na pH 5.3 for acidic conditions. .. After 1.5 h the reaction mixture was supplemented with 15 µL 0.5 M NH4 HCO3 and incubation at 37°C was resumed for 1 h. The reaction was terminated by adding 5.0% C2 HF3 O2 (trifluoroacetic acid; TFA; Sigma-Aldrich Chemie GmbH) in water to a final concentration of 1.0%.

    Article Title:
    Article Snippet: Dried material was reconstituted in 85 µL of MilliQ water before 10 µL of 10× NEB3 buffer and 5 µL (50 U) of calf intestinal phosphatase (both New England Biolabs) were added. .. Samples were incubated 45 min at 37 °C and thereafter diluted with 10 mM NH4 HCO3 pH 7.5 to a final volume of 1 mL.

    Article Title:
    Article Snippet: .. Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. .. The cut PCR products were analyzed by 8% acrylamide gel and SYBR stain (Lonza, USA).

    Article Title:
    Article Snippet: Dephosphorylation For dephosphorylation experi-ments, H2 O2 treated or untreated HeLa cells were harvested by trypsinization, collected by centrifugation at 170g for 10 min, washed twice with PBS and resuspended in NEB3 Buffer (New England Biolabs, Ipswich, MA, USA), in which Calf intestinal phosphatase (CIP; New England Biolabs, Ipswich, MA, USA) has optimal activity. .. Cleared lysates were split and one half was incubated with 10U CIP for 30 min at 37°C, whereas the other half was mock treated.

    Article Title:
    Article Snippet: .. A total of 60 μg of lysate was incubated in 1× NEB3 buffer and with or without 10 units of calf intestinal phosphatase (CIP) (New England BioLabs, M0290S) for 1 h at 37 °C. ..

    Article Title:
    Article Snippet: GammaBind Plus Sepharose beads were resuspended in RIPApi buffer, and 30 µl of this mixture was added to the ovary extracts and incubated for 1.5 h at 4°C with constant mixing. .. For phosphatase treatment, beads were washed twice with wash buffer 1, once with wash buffer 2 (wash buffer 1 lacking phosphatase inhibitors) and once in a 1∶1 mixture of wash buffer 2 and NEB3 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM DTT, pH 7.9; New England Biolabs).

    Article Title:
    Article Snippet: The axons were collected, resuspended in 50 µL ice-cold NEB3 buffer (New England BioLabs) containing protease inhibitor (Complete-Mini; Roche), and lysed by vortexing three times. .. Lysates were incubated at 37 °C with 10 µL of calf intestinal phosphatase (New England BioLabs) for 1 h. Control axons were processed in parallel, in the presence of phosphatase inhibitor mixture 2 and 3 (Sigma).

    Article Title:
    Article Snippet: .. The pronuclei were washed once through PBS and 1× NEB3 buffer (NEB) with 0.6% SDS, in which they were then incubated at 37°C for 2 h with shaking in humidified atmosphere. .. Pronuclei were washed once in 1× DpnII buffer (NEB) with 2× BSA (NEB), and then, chromatin was digested overnight in 9 μl of the same solution but with 5 U DpnII (NEB).

    Article Title:
    Article Snippet: .. Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions. .. Fractionation of liver tissue samples was done using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Scientific).

    Article Title:
    Article Snippet: .. For dephosphorylation, 8 × 106 beads were resuspended in 20 μl of 1× NEB3 buffer and incubated for 1 h at 37 °C with 2 μl of CIP (New England Biolabs). ..

    Activity Assay:

    Article Title:
    Article Snippet: .. Dephosphorylation For dephosphorylation experi-ments, H2 O2 treated or untreated HeLa cells were harvested by trypsinization, collected by centrifugation at 170g for 10 min, washed twice with PBS and resuspended in NEB3 Buffer (New England Biolabs, Ipswich, MA, USA), in which Calf intestinal phosphatase (CIP; New England Biolabs, Ipswich, MA, USA) has optimal activity. .. Cells were lysed by sonication and subsequent centrifugation at maximum speed for 30 min at 4°C.

    Article Title:
    Article Snippet: A plasmid carrying the gata2 basal promoter linked to the GFP-polyA , which is available from R. M. Grainger, may provide more sensitivity for the co-transgenesis assay since it appears to impart higher levels of transcriptional activity to enhancers without causing background expression on its own. .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge

    Article Title:
    Article Snippet: Glucokinase activity was measured as previously described ( ). .. Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions.

    Expressing:

    Article Title:
    Article Snippet: A plasmid carrying the gata2 basal promoter linked to the GFP-polyA , which is available from R. M. Grainger, may provide more sensitivity for the co-transgenesis assay since it appears to impart higher levels of transcriptional activity to enhancers without causing background expression on its own. .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge

    Acrylamide Gel Assay:

    Article Title:
    Article Snippet: Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. .. The cut PCR products were analyzed by 8% acrylamide gel and SYBR stain (Lonza, USA).

    Western Blot:

    Article Title:
    Article Snippet: Paragraph title: Small scale immunoprecipitations and western blotting ... The beads were split into 3 portions, resuspended in 30 µl NEB3 buffer, and incubated at 37°C for 1 h with 10 units of calf intestinal phosphatase (CIP; New England Biolabs).

    Article Title:
    Article Snippet: Paragraph title: Immunoprecipitation and Western blot ... For CIP treatment beads were resuspended in 20 μl H2 O, splitted and each sample was supplied with 3 μl buffer NEB3 (New England Biolabs).

    Article Title:
    Article Snippet: To demonstrate that the upper RPB1 band detected in immunoblots with anti-HA or anti-RPB1 antibodies corresponded to phosphorylated RPB1, 8 × 107 parasites were resuspended in 25 μl of lysis buffer (2% SDS, 100 mM Tris-HCl [pH 6.8]) and boiled for 5 min. To enable alkaline phosphatase treatment, the lysate was diluted 20-fold with Tryp wash solution (100 mM NaCl, 3 mM MgCl2 , 20 mM Tris-HCl [pH 7.5]) to reduce the SDS concentration to 0.05% and subsequently reduced to a volume of 100 μl by using an Amicon Ultra 0.5-ml filter device (Millipore). .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture.

    Article Title:
    Article Snippet: The axons were collected, resuspended in 50 µL ice-cold NEB3 buffer (New England BioLabs) containing protease inhibitor (Complete-Mini; Roche), and lysed by vortexing three times. .. For Western blot analysis, samples were lysed further by adding 5 µL of 10% (wt/vol) SDS, vortexing, incubation on ice for 10 min, and boiling at 100 °C for 10 min. Western blot was performed as described.

    Article Title:
    Article Snippet: Paragraph title: Sample preparation, biochemical and RNA analyses, and Western blotting ... Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions.

    Lysis:

    Article Title:
    Article Snippet: To demonstrate that the upper RPB1 band detected in immunoblots with anti-HA or anti-RPB1 antibodies corresponded to phosphorylated RPB1, 8 × 107 parasites were resuspended in 25 μl of lysis buffer (2% SDS, 100 mM Tris-HCl [pH 6.8]) and boiled for 5 min. To enable alkaline phosphatase treatment, the lysate was diluted 20-fold with Tryp wash solution (100 mM NaCl, 3 mM MgCl2 , 20 mM Tris-HCl [pH 7.5]) to reduce the SDS concentration to 0.05% and subsequently reduced to a volume of 100 μl by using an Amicon Ultra 0.5-ml filter device (Millipore). .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture.

    Article Title:
    Article Snippet: Briefly, after pronuclei were isolated, they were fixed in 2% formaldehyde for 15 min and then lysed on ice in lysis buffer (10 mM Tris–HCl pH 8.0, 10 mM NaCl, 0.5% (v/v) NP‐40 substitute (Sigma), 1% (v/v) Triton X‐100 (Sigma), 1× Halt™ Protease Inhibitor Cocktail (Thermo Scientific)) for at least 15 min. .. The pronuclei were washed once through PBS and 1× NEB3 buffer (NEB) with 0.6% SDS, in which they were then incubated at 37°C for 2 h with shaking in humidified atmosphere.

    Hybridization:

    Article Title:
    Article Snippet: Paragraph title: PCR-based positive hybridization ... Together with the tester DNA, 50 µl reactions contained 15 U of restriction enzyme, 5 µl 10× NEB3 buffer (New England Biolabs) and 5 µg of bovine serum albumin.

    Flow Cytometry:

    Article Title:
    Article Snippet: The flow through of the C-18 column was collected and loaded onto the porous graphitic carbon (PGC) cartridge. .. Dried material was reconstituted in 85 µL of MilliQ water before 10 µL of 10× NEB3 buffer and 5 µL (50 U) of calf intestinal phosphatase (both New England Biolabs) were added.

    Ligation:

    Article Title:
    Article Snippet: Nuclei were resuspended in 500 μl of 1.2× NEB3 buffer (New England BioLabs) with 0.3% SDS and incubated at 37 °C for 1 h and then with 2% Triton X-100 for another 1 h. Digestion was performed with 800 U of BglII (New England BioLabs)overnight at 37 °C shaking. .. Then the sample was incubated with 1.6% SDS for 25 min at 65 °C and with 1.15× ligation buffer (New England BioLabs) and 1% Triton X-100 for 1 h at 37 °C.

    Article Title:
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Article Title:
    Article Snippet: .. We circularized the linear 378-nt pseudogene (5 ng/μl) by T4 ligase (0.25 U/μl; Fermentas) in 1× rapid ligation buffer at 22°C for 10 min, followed by an inactivation step at 65°C for 10 min. We nicked the resulting circular pseudogene (1 ng/μl) by Nb.BsrDI and Nt.BspQI (0.5 U/μl, New England Biolabs) in 1× NEB3 buffer at 65°C for 2 h and we stopped the reaction by heating at 80°C for 20 min. We amplified the nicked circular pseudogene (0.1 ng/μl) at 30°C by RCA and T4 gene 32 (25 ng/μl; NEB) stopping the reaction by heat inactivation (80°C, for 20 min) at different time points. .. We digested RCA products by BseGI restriction enzyme (0.75 U/μl; Fermentas), which recognizes GGATG(2/0)∧ sites, incubating in Tango 1× buffer for 24 h at 55°C.

    Chromatin Immunoprecipitation:

    Article Title:
    Article Snippet: Chromosome Conformation Capture (3C) For 3C analysis cells were crosslinked and digested as described for ChIP . .. Nuclei were resuspended in 500 μl of 1.2× NEB3 buffer (New England BioLabs) with 0.3% SDS and incubated at 37 °C for 1 h and then with 2% Triton X-100 for another 1 h. Digestion was performed with 800 U of BglII (New England BioLabs)overnight at 37 °C shaking.

    Footprinting:

    Article Title:
    Article Snippet: Paragraph title: Dimethylsulfate footprinting ... Following the removal of DMS, DNA was heated at 65°C for 20 min in water, and treated with RNase H (17 U/mL) and PstI (NEB) for 30 min at 37°C in NEB3 buffer, and then with BstXI (NEB) at 55°C for 1 h to excise the insert.

    Cell Culture:

    Article Title:
    Article Snippet: Embryonic DRG explants (E14.5–15.5) were cultured with the method used for DRG spots. .. The axons were collected, resuspended in 50 µL ice-cold NEB3 buffer (New England BioLabs) containing protease inhibitor (Complete-Mini; Roche), and lysed by vortexing three times.

    Generated:

    Article Title:
    Article Snippet: Conditional yeast strains can be generated de novo, or located in previously published work and requested. .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    other:

    Article Title:
    Article Snippet: Simultaneous reactions with two or more restriction endonucleases were carried out in NEB3 buffer (NEB).

    Article Title:
    Article Snippet: As controls, BACs corresponding to the region of interested were digested with 100 U BglII in NEB3 buffer in 50 μl o/n at 37 °C.

    Sequencing:

    Article Title:
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title:
    Article Snippet: COBRALINE-1 COBRA for LINE-1 was performed as previously described, the 5′UTR of LINE-1.2 (L1Hs) sequence from NCBI Accession Number M80343 was used . .. The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight.

    Sonication:

    Article Title:
    Article Snippet: Dephosphorylation For dephosphorylation experi-ments, H2 O2 treated or untreated HeLa cells were harvested by trypsinization, collected by centrifugation at 170g for 10 min, washed twice with PBS and resuspended in NEB3 Buffer (New England Biolabs, Ipswich, MA, USA), in which Calf intestinal phosphatase (CIP; New England Biolabs, Ipswich, MA, USA) has optimal activity. .. Cells were lysed by sonication and subsequent centrifugation at maximum speed for 30 min at 4°C.

    Article Title:
    Article Snippet: For Western blotting, tissue samples were homogenized with a tissue-tearor in 30 volumes of ice-cold buffer (100 m m HEPES, pH 7.5, 4 m m EDTA, 2 m m EGTA, 20 m m KF, 300 m m NaCl, 20% glycerol, 0.1% Igepal, 0.35% β-mercaptoethanol, 20 m m β-glycerophosphate, 2 m m sodium pyrophosphate, 1 m m Na3 VO4 , 10 μg/ml of aprotinin, 10 μg/ml of leupeptin, 2 m m benzamidine, 0.5 m m PMSF), then were sonicated for 10 s on ice, rotated for 1 h at 4 °C, centrifuged at 18,000 × g for 20 min at 4 °C, and the supernatant was collected. .. Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions.

    Injection:

    Article Title:
    Article Snippet: To obtain G2‐phase data, zygotes were fixed 27 h post‐hCG injection (corresponding to about 15 h post‐fertilization) and lysed, and pronuclei were separated into different wells after SDS lysis according to their size. .. The pronuclei were washed once through PBS and 1× NEB3 buffer (NEB) with 0.6% SDS, in which they were then incubated at 37°C for 2 h with shaking in humidified atmosphere.

    Binding Assay:

    Article Title:
    Article Snippet: .. RCA of DNA plasmids and digestion of RCA products We incubated pUC19 plasmid DNA (1 ng/μl, Invitrogen) with nicking endonuclease Nt.BspQI (0.5 U/μl, New England Biolabs (NEB)) in 1× NEB3 buffer for 2 h at 50°C, and then we heat inactivated the enzyme incubating the reaction mixture at 80°C for 20 min. We then amplified the resulting nicked DNA (0.25 ng/μl) by using phi29 DNA polymerase (0.5 U/μl, Fermentas) for 24 h at 30°C in a 1× phi29 reaction buffer (33 mM Tris acetate, 10 mM magnesium acetate, 66 mM potassium acetate, 0.1% (v/v) Tween 20 and 1 mM Dithiothreitol (DTT); Fermentas) containing dNTP mix (1 mM each; Fermentas) and increasing concentration of single stranded binding protein T4 gene 32 (0–100 ng/μl, NEB). .. We also performed nicking and amplification reactions with pBluescript II SK (+) (with and without T4 gene 32 protein) in the same conditions.

    Hi-C:

    Article Title:
    Article Snippet: Paragraph title: Single‐nucleus Hi‐C ... The pronuclei were washed once through PBS and 1× NEB3 buffer (NEB) with 0.6% SDS, in which they were then incubated at 37°C for 2 h with shaking in humidified atmosphere.

    Nucleic Acid Electrophoresis:

    Article Title:
    Article Snippet: .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge ..

    Combined Bisulfite Restriction Analysis Assay:

    Article Title:
    Article Snippet: .. Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. .. The cut PCR products were analyzed by 8% acrylamide gel and SYBR stain (Lonza, USA).

    Article Title:
    Article Snippet: COBRALINE-1 COBRA for LINE-1 was performed as previously described, the 5′UTR of LINE-1.2 (L1Hs) sequence from NCBI Accession Number M80343 was used . .. The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight.

    Methylation:

    Article Title:
    Article Snippet: ALU-Combined Bisulfite Restriction Analysis (COBRA) To observe methylation levels of Alu in samples, the sodium-bisulfite-treated DNA in each sample was amplified by PCR containing 1x PCR buffer (Qiagen, Germany), 0.2 mM of deoxynucleotide triphosphate (Promega, USA), 1 mM of magnesium chloride (Qiagen, Germany), 25 U of HotStarTaq DNA Polymerase (Qiagen, Germany), and 0.3 μM primer pairs: ALU-BRev (5′-CTAACTTTTTATATTTTTAATAAAAACRAAATTTCAC CA-3′) where R = A and G and Y = C and T. For Alu amplification, the program was set as follows: 95 °C for 15 min, 40 cycles of 95 °C for 45 s, 57 °C for 45 s, and 72 °C for 45 s, followed by a final extension of 72 °C for 7 min [ ]. .. Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight.

    Article Title:
    Article Snippet: In brief, the DNA samples were converted by a bisulphite reaction such that unmethylated cytosine (u C) would be converted to uracil (U), whereas methylated cytosine (m C) would remain as cytosine. .. The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight.

    Isolation:

    Article Title:
    Article Snippet: Paragraph title: tRNA isolation and preparation for LC-MS analysis ... Briefly, 10 µg of tRNA was combined with 40 mU of Nuclease P1 from Penicillium citrinum (Sigma-Aldrich Biochemie GmbH) resuspended in 0.2 M CH3 CO2 Na (sodium acetate) pH 5.3 and 0.1 U of Shrimp Alkaline Phosphatase (Thermo Scientific) in 30 µL reactions at 37°C containing 2 mg/mL ZnCl2 and 1×NEB3 buffer (New England Biolabs GmbH) for near neutral reaction conditions, or 20 mM CH3 CO2 Na pH 5.3 for acidic conditions.

    Article Title:
    Article Snippet: Paragraph title: Isolation of Nucleoside Diphospho Sugars. ... Dried material was reconstituted in 85 µL of MilliQ water before 10 µL of 10× NEB3 buffer and 5 µL (50 U) of calf intestinal phosphatase (both New England Biolabs) were added.

    Article Title:
    Article Snippet: Briefly, after pronuclei were isolated, they were fixed in 2% formaldehyde for 15 min and then lysed on ice in lysis buffer (10 mM Tris–HCl pH 8.0, 10 mM NaCl, 0.5% (v/v) NP‐40 substitute (Sigma), 1% (v/v) Triton X‐100 (Sigma), 1× Halt™ Protease Inhibitor Cocktail (Thermo Scientific)) for at least 15 min. .. The pronuclei were washed once through PBS and 1× NEB3 buffer (NEB) with 0.6% SDS, in which they were then incubated at 37°C for 2 h with shaking in humidified atmosphere.

    Article Title:
    Article Snippet: RNA isolation and quantitative real-time PCR was performed as described by Irimia et al. ( ). .. Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions.

    Labeling:

    Article Title:
    Article Snippet: Chemicals Isotopically labeled glycine (U-13 C2 , 15 N) was purchased from Cambridge Isotope Laboratories (Andover, MA, USA). .. Calf intestinal alkaline phosphatase (CIP) and NEB3 buffer were purchased from New England Biolabs (NEB, Ipswich, MA, USA), and Dulbecco's minimum essential medium (DMEM), F12 nutrient mix, and fetal bovine serum (FBS) were obtained from Life Technologies, ThermoFisher Scientific (MA, USA).

    Purification:

    Article Title:
    Article Snippet: Nuclei were resuspended in 500 μl of 1.2× NEB3 buffer (New England BioLabs) with 0.3% SDS and incubated at 37 °C for 1 h and then with 2% Triton X-100 for another 1 h. Digestion was performed with 800 U of BglII (New England BioLabs)overnight at 37 °C shaking. .. Ligation was performed with 1000 U of T4 DNA ligase (New England BioLabs) for 8 h at 16 °C and at 22°C for 30 min. DNA was purified with phenol-chloroform extraction after RNase A (Sigma) and Proteinase K (Sigma) digestion.

    Article Title:
    Article Snippet: For the generation of a polyclonal anti-RPB1 immune serum, the CTD portion of RPB1, comprising the C-terminal 228 amino acids, was expressed with an N-terminal glutathione S -transferase (GST) tag in Escherichia coli , purified by glutathione affinity chromatography, and used as a GST fusion protein to immunize rats according to a previously published protocol ( ). .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture.

    Article Title:
    Article Snippet: Isolation and purification of tRNA from C. reinhardtii and S. cerevisiae was performed as previously described ( ). .. Briefly, 10 µg of tRNA was combined with 40 mU of Nuclease P1 from Penicillium citrinum (Sigma-Aldrich Biochemie GmbH) resuspended in 0.2 M CH3 CO2 Na (sodium acetate) pH 5.3 and 0.1 U of Shrimp Alkaline Phosphatase (Thermo Scientific) in 30 µL reactions at 37°C containing 2 mg/mL ZnCl2 and 1×NEB3 buffer (New England Biolabs GmbH) for near neutral reaction conditions, or 20 mM CH3 CO2 Na pH 5.3 for acidic conditions.

    Article Title:
    Article Snippet: ・ QIAquick PCR Purification Kit (Qiagen) ・ QIAquick Gel Extraction kit (Qiagen) ・ Primer pairs for amplification of CNEs: 10 pmol/μL in TE (see Methods for details), stored at −20°C. .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge

    Polymerase Chain Reaction:

    Article Title:
    Article Snippet: .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! ..

    Article Title:
    Article Snippet: .. Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. .. The cut PCR products were analyzed by 8% acrylamide gel and SYBR stain (Lonza, USA).

    Article Title:
    Article Snippet: Paragraph title: PCR-based positive hybridization ... Together with the tester DNA, 50 µl reactions contained 15 U of restriction enzyme, 5 µl 10× NEB3 buffer (New England Biolabs) and 5 µg of bovine serum albumin.

    Article Title:
    Article Snippet: One microlitre of bisulphite DNA was then subjected to 35 cycles of PCR, at a 50°C annealing temperature using the following primer sets: LINE-1-F (5′-CCGTAAGGGGTTAGGGAGTTTTT-3′) and LINE-1-R (5′-RTAAAACCCTCCRAACCAAATATAAA-3′). .. The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight.

    Article Title:
    Article Snippet: .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge ..

    Blocking Assay:

    Article Title:
    Article Snippet: .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture. ..

    Article Title:
    Article Snippet: .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge ..

    De-Phosphorylation Assay:

    Article Title:
    Article Snippet: .. Dephosphorylation For dephosphorylation experi-ments, H2 O2 treated or untreated HeLa cells were harvested by trypsinization, collected by centrifugation at 170g for 10 min, washed twice with PBS and resuspended in NEB3 Buffer (New England Biolabs, Ipswich, MA, USA), in which Calf intestinal phosphatase (CIP; New England Biolabs, Ipswich, MA, USA) has optimal activity. .. Cells were lysed by sonication and subsequent centrifugation at maximum speed for 30 min at 4°C.

    Article Title:
    Article Snippet: Paragraph title: Protein Dephosphorylation. ... The axons were collected, resuspended in 50 µL ice-cold NEB3 buffer (New England BioLabs) containing protease inhibitor (Complete-Mini; Roche), and lysed by vortexing three times.

    Article Title:
    Article Snippet: .. For dephosphorylation, 8 × 106 beads were resuspended in 20 μl of 1× NEB3 buffer and incubated for 1 h at 37 °C with 2 μl of CIP (New England Biolabs). ..

    Gel Extraction:

    Article Title:
    Article Snippet: C. reinhardtii tRNA was additionally subjected to gel extraction from a denaturing 8 M urea 8% polyacrylamide gel ( ). .. Briefly, 10 µg of tRNA was combined with 40 mU of Nuclease P1 from Penicillium citrinum (Sigma-Aldrich Biochemie GmbH) resuspended in 0.2 M CH3 CO2 Na (sodium acetate) pH 5.3 and 0.1 U of Shrimp Alkaline Phosphatase (Thermo Scientific) in 30 µL reactions at 37°C containing 2 mg/mL ZnCl2 and 1×NEB3 buffer (New England Biolabs GmbH) for near neutral reaction conditions, or 20 mM CH3 CO2 Na pH 5.3 for acidic conditions.

    Article Title:
    Article Snippet: ・ QIAquick PCR Purification Kit (Qiagen) ・ QIAquick Gel Extraction kit (Qiagen) ・ Primer pairs for amplification of CNEs: 10 pmol/μL in TE (see Methods for details), stored at −20°C. .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge

    Concentration Assay:

    Article Title:
    Article Snippet: To demonstrate that the upper RPB1 band detected in immunoblots with anti-HA or anti-RPB1 antibodies corresponded to phosphorylated RPB1, 8 × 107 parasites were resuspended in 25 μl of lysis buffer (2% SDS, 100 mM Tris-HCl [pH 6.8]) and boiled for 5 min. To enable alkaline phosphatase treatment, the lysate was diluted 20-fold with Tryp wash solution (100 mM NaCl, 3 mM MgCl2 , 20 mM Tris-HCl [pH 7.5]) to reduce the SDS concentration to 0.05% and subsequently reduced to a volume of 100 μl by using an Amicon Ultra 0.5-ml filter device (Millipore). .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture.

    Article Title:
    Article Snippet: .. RCA of DNA plasmids and digestion of RCA products We incubated pUC19 plasmid DNA (1 ng/μl, Invitrogen) with nicking endonuclease Nt.BspQI (0.5 U/μl, New England Biolabs (NEB)) in 1× NEB3 buffer for 2 h at 50°C, and then we heat inactivated the enzyme incubating the reaction mixture at 80°C for 20 min. We then amplified the resulting nicked DNA (0.25 ng/μl) by using phi29 DNA polymerase (0.5 U/μl, Fermentas) for 24 h at 30°C in a 1× phi29 reaction buffer (33 mM Tris acetate, 10 mM magnesium acetate, 66 mM potassium acetate, 0.1% (v/v) Tween 20 and 1 mM Dithiothreitol (DTT); Fermentas) containing dNTP mix (1 mM each; Fermentas) and increasing concentration of single stranded binding protein T4 gene 32 (0–100 ng/μl, NEB). .. We also performed nicking and amplification reactions with pBluescript II SK (+) (with and without T4 gene 32 protein) in the same conditions.

    Article Title:
    Article Snippet: Briefly, 10 µg of tRNA was combined with 40 mU of Nuclease P1 from Penicillium citrinum (Sigma-Aldrich Biochemie GmbH) resuspended in 0.2 M CH3 CO2 Na (sodium acetate) pH 5.3 and 0.1 U of Shrimp Alkaline Phosphatase (Thermo Scientific) in 30 µL reactions at 37°C containing 2 mg/mL ZnCl2 and 1×NEB3 buffer (New England Biolabs GmbH) for near neutral reaction conditions, or 20 mM CH3 CO2 Na pH 5.3 for acidic conditions. .. After 1.5 h the reaction mixture was supplemented with 15 µL 0.5 M NH4 HCO3 and incubation at 37°C was resumed for 1 h. The reaction was terminated by adding 5.0% C2 HF3 O2 (trifluoroacetic acid; TFA; Sigma-Aldrich Chemie GmbH) in water to a final concentration of 1.0%.

    Agarose Gel Electrophoresis:

    Article Title:
    Article Snippet: We circularized the linear 378-nt pseudogene (5 ng/μl) by T4 ligase (0.25 U/μl; Fermentas) in 1× rapid ligation buffer at 22°C for 10 min, followed by an inactivation step at 65°C for 10 min. We nicked the resulting circular pseudogene (1 ng/μl) by Nb.BsrDI and Nt.BspQI (0.5 U/μl, New England Biolabs) in 1× NEB3 buffer at 65°C for 2 h and we stopped the reaction by heating at 80°C for 20 min. We amplified the nicked circular pseudogene (0.1 ng/μl) at 30°C by RCA and T4 gene 32 (25 ng/μl; NEB) stopping the reaction by heat inactivation (80°C, for 20 min) at different time points. .. We analyzed digested products on 1.5% agarose gel as described before and also on polyacrylamide gel electrophoresis (PAGE) (20% polyacrylamide, 20% formamide, 8 M urea mixed in 1× TBE which is made of 89 mM Tris-borate, 2 mM Na2 EDTA dissolved in deionized water) at 180 V for 1:15 h. We acquired images by UV trans-illumination (UVITEC) and we analyzed them by the software ImageJ, measuring the intensities of bands corresponding to double stranded digestion products (agarose gel) and the total DNA (denaturing PAGE).

    Article Title:
    Article Snippet: Genomic DNAs from 3 × 108 cells ( mre11-58 cells at 8 h and wild-type cells at 3 h after entering into meiosis), added with or without the addition of 10 pg of the Pst I- Eco RI fragments from pNKY291, were treated with 8 U of lambda exonuclease (GIBCO BRL) for 2 h at 37°C in a mixture containing 1× NEB3 buffer (New England Biolabs, Inc. Beverly, Mass.). .. Samples were separated on a 0.7% agarose gel and Southern blotted with a Pst I- Eco RI fragment from pNKY291 as a probe.

    Article Title:
    Article Snippet: .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge ..

    Inter Assay:

    Article Title:
    Article Snippet: The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight. .. The same preparation of DNA from 3 cell lines, HeLa (cervical cancer), Daudi (Human Burkitt’s lymphoma), and Jurkat (acute T cell leukemia) (ATCC, Manassas, VA, USA) were used as positive controls in all experiments and for inter-assay variation adjustment .

    Plasmid Preparation:

    Article Title:
    Article Snippet: The pRNDM plasmid will be provided on request. .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Article Title:
    Article Snippet: .. RCA of DNA plasmids and digestion of RCA products We incubated pUC19 plasmid DNA (1 ng/μl, Invitrogen) with nicking endonuclease Nt.BspQI (0.5 U/μl, New England Biolabs (NEB)) in 1× NEB3 buffer for 2 h at 50°C, and then we heat inactivated the enzyme incubating the reaction mixture at 80°C for 20 min. We then amplified the resulting nicked DNA (0.25 ng/μl) by using phi29 DNA polymerase (0.5 U/μl, Fermentas) for 24 h at 30°C in a 1× phi29 reaction buffer (33 mM Tris acetate, 10 mM magnesium acetate, 66 mM potassium acetate, 0.1% (v/v) Tween 20 and 1 mM Dithiothreitol (DTT); Fermentas) containing dNTP mix (1 mM each; Fermentas) and increasing concentration of single stranded binding protein T4 gene 32 (0–100 ng/μl, NEB). .. We also performed nicking and amplification reactions with pBluescript II SK (+) (with and without T4 gene 32 protein) in the same conditions.

    Article Title:
    Article Snippet: A plasmid carrying the gata2 basal promoter linked to the GFP-polyA , which is available from R. M. Grainger, may provide more sensitivity for the co-transgenesis assay since it appears to impart higher levels of transcriptional activity to enhancers without causing background expression on its own. .. ・ 50 mM MgSO4 (included in a set of the Platinum Pfx DNA polymerase) ・ dNTP mixture, 2.5 mM each (Invitrogen) ・ Bam HI: 10-20 U/μL (New England Biolabs) ・ Xho I: 10-20 U/μL (New England Biolabs) ・ 10× NEB3 buffer (for double-digestion with Bam HI and Xho I, New England Biolabs) ・ 1 × TAE buffer: 40 mM Tris-acetate, 1mM EDTA, pH 8.0 ・ Agarose (molecular biology grade) ・ Ethidium bromide solution: 10 μg/mL (Sigma) ・ TE buffer: 10 mM Tris-HCl, 1mM EDTA, pH 8.0 ・ 10 mM KCl ・ Ethanol (96-100%, molecular biology grade) ・ 70% Ethanol (prepare by mixing 96-100% ethanol and distilled water) ・ Distilled water ・ Heating block or water bath (for restriction enzyme digestion at 37°C and for melting agarose gel at 50°C) ・ GeneAmp PCR System 2400 (PerkinElmer) or an equivalent standard thermal cycler ・ UV transilluminator (for visualizing ethidium bromide-stained DNA after gel electrophoresis) ・ Microcentrifuge

    Software:

    Article Title:
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title:
    Article Snippet: We circularized the linear 378-nt pseudogene (5 ng/μl) by T4 ligase (0.25 U/μl; Fermentas) in 1× rapid ligation buffer at 22°C for 10 min, followed by an inactivation step at 65°C for 10 min. We nicked the resulting circular pseudogene (1 ng/μl) by Nb.BsrDI and Nt.BspQI (0.5 U/μl, New England Biolabs) in 1× NEB3 buffer at 65°C for 2 h and we stopped the reaction by heating at 80°C for 20 min. We amplified the nicked circular pseudogene (0.1 ng/μl) at 30°C by RCA and T4 gene 32 (25 ng/μl; NEB) stopping the reaction by heat inactivation (80°C, for 20 min) at different time points. .. We analyzed digested products on 1.5% agarose gel as described before and also on polyacrylamide gel electrophoresis (PAGE) (20% polyacrylamide, 20% formamide, 8 M urea mixed in 1× TBE which is made of 89 mM Tris-borate, 2 mM Na2 EDTA dissolved in deionized water) at 180 V for 1:15 h. We acquired images by UV trans-illumination (UVITEC) and we analyzed them by the software ImageJ, measuring the intensities of bands corresponding to double stranded digestion products (agarose gel) and the total DNA (denaturing PAGE).

    Article Title:
    Article Snippet: Following the removal of DMS, DNA was heated at 65°C for 20 min in water, and treated with RNase H (17 U/mL) and PstI (NEB) for 30 min at 37°C in NEB3 buffer, and then with BstXI (NEB) at 55°C for 1 h to excise the insert. .. Membranes were washed and scanned by PhosphorImager, and signals quantified using Imagequant Software (Amersham Pharmacia Biotech).

    Article Title:
    Article Snippet: Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. .. The band intensity of Alu methylation was observed and measured by typhoon fla 7000 and ImageQuanNT Software (Amersham biosciences, UK) (Additional file : Figure S1) [ ].

    Real-time Polymerase Chain Reaction:

    Article Title:
    Article Snippet: RNA isolation and quantitative real-time PCR was performed as described by Irimia et al. ( ). .. Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions.

    Negative Control:

    Article Title:
    Article Snippet: The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight. .. Distilled water was used as a negative control.

    Affinity Chromatography:

    Article Title:
    Article Snippet: For the generation of a polyclonal anti-RPB1 immune serum, the CTD portion of RPB1, comprising the C-terminal 228 amino acids, was expressed with an N-terminal glutathione S -transferase (GST) tag in Escherichia coli , purified by glutathione affinity chromatography, and used as a GST fusion protein to immunize rats according to a previously published protocol ( ). .. The phosphatase reaction was carried out in a volume of 30 μl containing 20 μl of sample, 1× NEB3 buffer, and 10 units of calf intestinal phosphatase (New England BioLabs), and incubation at 37°C for 1 h. To block the phosphatase, 0.5 μl of phosphatase inhibitor cocktail 2 (Sigma) was added to the reaction mixture.

    Sample Prep:

    Article Title:
    Article Snippet: Paragraph title: Sample preparation, biochemical and RNA analyses, and Western blotting ... Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions.

    In Vitro:

    Article Title:
    Article Snippet: Paragraph title: In Vitro Phosphatase Assay ... A total of 60 μg of lysate was incubated in 1× NEB3 buffer and with or without 10 units of calf intestinal phosphatase (CIP) (New England BioLabs, M0290S) for 1 h at 37 °C.

    Immunoprecipitation:

    Article Title:
    Article Snippet: Paragraph title: Immunoprecipitation and Western blot ... For CIP treatment beads were resuspended in 20 μl H2 O, splitted and each sample was supplied with 3 μl buffer NEB3 (New England Biolabs).

    Fractionation:

    Article Title:
    Article Snippet: Total liver extracts obtained in NEB3 buffer with protease inhibitors were treated with 10 units/μl of calf intestine phosphatase (New England Biolabs) at 37 °C for 1 h. To immunoprecipitate IRS1, 750 μg of protein obtained as described above (without Igepal) were incubated with the antibody overnight at 4 °C under rotation and then precipitated with Dynabeads-Protein A (Invitrogen) following the manufacturer's instructions. .. Fractionation of liver tissue samples was done using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Scientific).

    Liquid Chromatography with Mass Spectroscopy:

    Article Title:
    Article Snippet: Paragraph title: tRNA isolation and preparation for LC-MS analysis ... Briefly, 10 µg of tRNA was combined with 40 mU of Nuclease P1 from Penicillium citrinum (Sigma-Aldrich Biochemie GmbH) resuspended in 0.2 M CH3 CO2 Na (sodium acetate) pH 5.3 and 0.1 U of Shrimp Alkaline Phosphatase (Thermo Scientific) in 30 µL reactions at 37°C containing 2 mg/mL ZnCl2 and 1×NEB3 buffer (New England Biolabs GmbH) for near neutral reaction conditions, or 20 mM CH3 CO2 Na pH 5.3 for acidic conditions.

    Protease Inhibitor:

    Article Title:
    Article Snippet: .. The axons were collected, resuspended in 50 µL ice-cold NEB3 buffer (New England BioLabs) containing protease inhibitor (Complete-Mini; Roche), and lysed by vortexing three times. .. Lysates were incubated at 37 °C with 10 µL of calf intestinal phosphatase (New England BioLabs) for 1 h. Control axons were processed in parallel, in the presence of phosphatase inhibitor mixture 2 and 3 (Sigma).

    Article Title:
    Article Snippet: Briefly, after pronuclei were isolated, they were fixed in 2% formaldehyde for 15 min and then lysed on ice in lysis buffer (10 mM Tris–HCl pH 8.0, 10 mM NaCl, 0.5% (v/v) NP‐40 substitute (Sigma), 1% (v/v) Triton X‐100 (Sigma), 1× Halt™ Protease Inhibitor Cocktail (Thermo Scientific)) for at least 15 min. .. The pronuclei were washed once through PBS and 1× NEB3 buffer (NEB) with 0.6% SDS, in which they were then incubated at 37°C for 2 h with shaking in humidified atmosphere.

    Marker:

    Article Title:
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Staining:

    Article Title:
    Article Snippet: Alu PCR products were subjected to COBRA using 2 U of TaqI (Thermo scientific, USA), 2 U of TasI (Thermo scientific, USA), 5x NEB3 buffer (New England Biolabs, USA), and 1 μg/ul bovine serum albumin (BSA) (New England Biolabs, USA) and incubated at 65 °C overnight. .. The cut PCR products were analyzed by 8% acrylamide gel and SYBR stain (Lonza, USA).

    Article Title:
    Article Snippet: The LINE-1 amplicons (160 bp) were digested with 2 U of Taq I and 2 U of Tas I in NEB3 buffer (New England Biolabs, Ontario, Canada) at 65°C overnight. .. The products were identified by polyacrylamide gel electrophoresis (8% non-denaturing) and stained with SYBR green nucleic acid stain (Sigma-Aldrich, St. Louis, Missouri).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs neb3 buffer
    Neb3 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb3 buffer/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    neb3 buffer - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    79
    New England Biolabs buffer neb3
    Buffer Neb3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/buffer neb3/product/New England Biolabs
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    buffer neb3 - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    90
    New England Biolabs 1x neb3 buffer
    1x Neb3 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x neb3 buffer/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    1x neb3 buffer - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    80
    New England Biolabs neb3
    Neb3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb3/product/New England Biolabs
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    neb3 - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    Image Search Results