ndei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    NdeI
    Description:
    NdeI 20 000 units
    Catalog Number:
    r0111l
    Price:
    264
    Size:
    20 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs ndei
    NdeI
    NdeI 20 000 units
    https://www.bioz.com/result/ndei/product/New England Biolabs
    Average 90 stars, based on 112 article reviews
    Price from $9.99 to $1999.99
    ndei - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells"

    Article Title: Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells

    Journal: Genes & Development

    doi: 10.1101/gad.1369805

    Replication initiation factors fused to GAL4 stimulate replication of a plasmid containing GAL4 DNA-binding sites in vivo. ( A ) Extrachromosomal DNA was isolated from HEK293 cells cotransfected with the indicated plasmids and pFR_Luc, which contains five GAL4-binding sites (lanes 3-10 ). After digestion with DpnI and NdeI ( A ) or NdeI alone ( B ), samples were separated by agarose gel electrophoresis, and DNA was visualized by Southern blotting using a probe to the SmaI-BstEII fragment of pFR_Luc. NdeI-digested pFR_Luc was loaded in lane 1 as a size marker for linearized plasmid. In lane 2 , pFR_Luc was digested with NdeI and DpnI as a control ensuring complete digestion by DpnI. ( C ) Replication was quantified by PhosphorImaging. (R/S) The intensity of the DpnI-resistant band in A divided by the intensity of the NdeI-digested band in B . ( D ) C33a cells were transfected with the indicated plasmids and replication measured as in A . The bottom panel represents a lighter exposure of the top panel as a control showing equal amounts of transfected DNA. ( E ) The transcriptional activity of the GAL4 fusions in A were measured by a luciferase assay. (RLU) Firefly luciferase activity under control of GAL4-binding sites was normalized to Renilla luciferase under the control of a constitutively active promoter.
    Figure Legend Snippet: Replication initiation factors fused to GAL4 stimulate replication of a plasmid containing GAL4 DNA-binding sites in vivo. ( A ) Extrachromosomal DNA was isolated from HEK293 cells cotransfected with the indicated plasmids and pFR_Luc, which contains five GAL4-binding sites (lanes 3-10 ). After digestion with DpnI and NdeI ( A ) or NdeI alone ( B ), samples were separated by agarose gel electrophoresis, and DNA was visualized by Southern blotting using a probe to the SmaI-BstEII fragment of pFR_Luc. NdeI-digested pFR_Luc was loaded in lane 1 as a size marker for linearized plasmid. In lane 2 , pFR_Luc was digested with NdeI and DpnI as a control ensuring complete digestion by DpnI. ( C ) Replication was quantified by PhosphorImaging. (R/S) The intensity of the DpnI-resistant band in A divided by the intensity of the NdeI-digested band in B . ( D ) C33a cells were transfected with the indicated plasmids and replication measured as in A . The bottom panel represents a lighter exposure of the top panel as a control showing equal amounts of transfected DNA. ( E ) The transcriptional activity of the GAL4 fusions in A were measured by a luciferase assay. (RLU) Firefly luciferase activity under control of GAL4-binding sites was normalized to Renilla luciferase under the control of a constitutively active promoter.

    Techniques Used: Plasmid Preparation, Binding Assay, In Vivo, Isolation, Agarose Gel Electrophoresis, Southern Blot, Marker, Transfection, Activity Assay, Luciferase

    2) Product Images from "Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells"

    Article Title: Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells

    Journal: Genes & Development

    doi: 10.1101/gad.1369805

    Replication initiation factors fused to GAL4 stimulate replication of a plasmid containing GAL4 DNA-binding sites in vivo. ( A ) Extrachromosomal DNA was isolated from HEK293 cells cotransfected with the indicated plasmids and pFR_Luc, which contains five GAL4-binding sites (lanes 3-10 ). After digestion with DpnI and NdeI ( A ) or NdeI alone ( B ), samples were separated by agarose gel electrophoresis, and DNA was visualized by Southern blotting using a probe to the SmaI-BstEII fragment of pFR_Luc. NdeI-digested pFR_Luc was loaded in lane 1 as a size marker for linearized plasmid. In lane 2 , pFR_Luc was digested with NdeI and DpnI as a control ensuring complete digestion by DpnI. ( C ) Replication was quantified by PhosphorImaging. (R/S) The intensity of the DpnI-resistant band in A divided by the intensity of the NdeI-digested band in B . ( D ) C33a cells were transfected with the indicated plasmids and replication measured as in A . The bottom panel represents a lighter exposure of the top panel as a control showing equal amounts of transfected DNA. ( E ) The transcriptional activity of the GAL4 fusions in A were measured by a luciferase assay. (RLU) Firefly luciferase activity under control of GAL4-binding sites was normalized to Renilla luciferase under the control of a constitutively active promoter.
    Figure Legend Snippet: Replication initiation factors fused to GAL4 stimulate replication of a plasmid containing GAL4 DNA-binding sites in vivo. ( A ) Extrachromosomal DNA was isolated from HEK293 cells cotransfected with the indicated plasmids and pFR_Luc, which contains five GAL4-binding sites (lanes 3-10 ). After digestion with DpnI and NdeI ( A ) or NdeI alone ( B ), samples were separated by agarose gel electrophoresis, and DNA was visualized by Southern blotting using a probe to the SmaI-BstEII fragment of pFR_Luc. NdeI-digested pFR_Luc was loaded in lane 1 as a size marker for linearized plasmid. In lane 2 , pFR_Luc was digested with NdeI and DpnI as a control ensuring complete digestion by DpnI. ( C ) Replication was quantified by PhosphorImaging. (R/S) The intensity of the DpnI-resistant band in A divided by the intensity of the NdeI-digested band in B . ( D ) C33a cells were transfected with the indicated plasmids and replication measured as in A . The bottom panel represents a lighter exposure of the top panel as a control showing equal amounts of transfected DNA. ( E ) The transcriptional activity of the GAL4 fusions in A were measured by a luciferase assay. (RLU) Firefly luciferase activity under control of GAL4-binding sites was normalized to Renilla luciferase under the control of a constitutively active promoter.

    Techniques Used: Plasmid Preparation, Binding Assay, In Vivo, Isolation, Agarose Gel Electrophoresis, Southern Blot, Marker, Transfection, Activity Assay, Luciferase

    3) Product Images from "Structure-based functional identification of Helicobacter pylori HP0268 as a nuclease with both DNA nicking and RNase activities"

    Article Title: Structure-based functional identification of Helicobacter pylori HP0268 as a nuclease with both DNA nicking and RNase activities

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv348

    Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.
    Figure Legend Snippet: Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.

    Techniques Used: Activity Assay, Incubation, Plasmid Preparation, Positron Emission Tomography

    Nuclease activity of HP0268 mutants. (A) Nicking endonuclease assay of wild-type and mutant HP0268 using gel electrophoresis. The substrate plasmid DNA was incubated with the wild-type and mutants (2 μM) at 37ºC for 30 min. Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. (B) Graph of the nicking endonuclease activities of wild-type and mutant HP0268. The DNA nicking activities of the mutants are normalized by that of the wild-type. (C) Fluorometric ribonuclease activities of wild-type and mutant HP0268. The protein concentrations were maintained at 6 μM. The fluorescence spectra are shown in a color-coded mode. In every figure, Cont. and WT indicate the reference condition of having only a buffer and the wild-type protein, respectively. The reaction buffer consisted of 20 mM Tris (pH 8.0) and 150 mM NaCl.
    Figure Legend Snippet: Nuclease activity of HP0268 mutants. (A) Nicking endonuclease assay of wild-type and mutant HP0268 using gel electrophoresis. The substrate plasmid DNA was incubated with the wild-type and mutants (2 μM) at 37ºC for 30 min. Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. (B) Graph of the nicking endonuclease activities of wild-type and mutant HP0268. The DNA nicking activities of the mutants are normalized by that of the wild-type. (C) Fluorometric ribonuclease activities of wild-type and mutant HP0268. The protein concentrations were maintained at 6 μM. The fluorescence spectra are shown in a color-coded mode. In every figure, Cont. and WT indicate the reference condition of having only a buffer and the wild-type protein, respectively. The reaction buffer consisted of 20 mM Tris (pH 8.0) and 150 mM NaCl.

    Techniques Used: Activity Assay, Mutagenesis, Nucleic Acid Electrophoresis, Plasmid Preparation, Incubation, Fluorescence

    4) Product Images from "An exogenous chloroplast genome for complex sequence manipulation in algae"

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr1008

    Characterization of the cloned C. reinhardtii chloroplast genome in vivo . ( A ) A nested set representing the presence of increasing numbers of markers in primary transformants of pCr03 into a psbD knockout strain as determined by PCR ( Table 2 ; primers used as follows: M1, 11 606 and 11 607; M2, 5512 and 5513; M3, 11 456 and 11 457; and M4, 14 067 and 14 068.). The broken circle shows the subset of transformants with M1, M2, M3 and M4 that gave rise to the same genotype upon rescreening. ( B–E ) Southern blot analysis of EcoRI (B, C and E) or NdeI (D) digests (see ‘Materials and Methods’ section). Probes were specific for sequences adjacent to integration sites for M1 (B), M2 (C), M3 (D) and M4 (E). All samples are arranged as follows: Lane L, 1 kb DNA ladder (Invitrogen; Carlsbad, CA); lane 1, wild-type; lane 2, purified pCr03; and lane 3, a representative algae clone containing all unique markers. A single band in lane 3 indicates homoplasmic integration of the marker, while two bands indicate heteroplasmy with the wild-type locus.
    Figure Legend Snippet: Characterization of the cloned C. reinhardtii chloroplast genome in vivo . ( A ) A nested set representing the presence of increasing numbers of markers in primary transformants of pCr03 into a psbD knockout strain as determined by PCR ( Table 2 ; primers used as follows: M1, 11 606 and 11 607; M2, 5512 and 5513; M3, 11 456 and 11 457; and M4, 14 067 and 14 068.). The broken circle shows the subset of transformants with M1, M2, M3 and M4 that gave rise to the same genotype upon rescreening. ( B–E ) Southern blot analysis of EcoRI (B, C and E) or NdeI (D) digests (see ‘Materials and Methods’ section). Probes were specific for sequences adjacent to integration sites for M1 (B), M2 (C), M3 (D) and M4 (E). All samples are arranged as follows: Lane L, 1 kb DNA ladder (Invitrogen; Carlsbad, CA); lane 1, wild-type; lane 2, purified pCr03; and lane 3, a representative algae clone containing all unique markers. A single band in lane 3 indicates homoplasmic integration of the marker, while two bands indicate heteroplasmy with the wild-type locus.

    Techniques Used: Clone Assay, In Vivo, Knock-Out, Polymerase Chain Reaction, Southern Blot, Purification, Marker

    5) Product Images from "The Caulobacter crescentus DNA-(adenine-N6)-methyltransferase CcrM methylates DNA in a distributive manner"

    Article Title: The Caulobacter crescentus DNA-(adenine-N6)-methyltransferase CcrM methylates DNA in a distributive manner

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr768

    Various substrates used for studying CcrM processivity. ( A ) Substrate used by Berdis et al. ( 14 ) to study CcrM processivity, referred to as N 6 60/66-mer. Two GANTC target sites are present, hemimethylated on the upper strand. HindII target sites (GTYRAC) coupled to CcrM target sites were used to screen for methylation on the lower strand. However, only one of the two HindII sites is present, making it impossible to probe the methylation state of the second site. ( B ) The distribution of GANTC sequences (shown as HinfI target sequences) throughout the pUC19 plasmid. The position of each sequence is indicated relative to the plasmid's replication origin. The vector contains a single NdeI target site, which was used in conjunction with HinfI for vector linearization, to facilitate viewing of the progression toward fully methylated state. ( C ) 129-mer substrate containing two CcrM target sites. The expected size of the fragments obtained after HinfI digestion of completely unmethylated, partially methylated and fully methylated substrates are indicated. ( D ) 129-mer_HM substrate used to probe CcrM activity over hemimethylated GANTC sites. A M.TaqI methylation site (TCGA), as well as a HincII restriction site (GTYRAC) were linked to the GANTC site. M.TaqI-established methylation occurs as shown earlier, creating two GANTC sites hemimethylated on the lower strand. CcrM-catalyzed methylation of the upper strand was probed through protection from HincII digestion, which is blocked by hemimethylation.
    Figure Legend Snippet: Various substrates used for studying CcrM processivity. ( A ) Substrate used by Berdis et al. ( 14 ) to study CcrM processivity, referred to as N 6 60/66-mer. Two GANTC target sites are present, hemimethylated on the upper strand. HindII target sites (GTYRAC) coupled to CcrM target sites were used to screen for methylation on the lower strand. However, only one of the two HindII sites is present, making it impossible to probe the methylation state of the second site. ( B ) The distribution of GANTC sequences (shown as HinfI target sequences) throughout the pUC19 plasmid. The position of each sequence is indicated relative to the plasmid's replication origin. The vector contains a single NdeI target site, which was used in conjunction with HinfI for vector linearization, to facilitate viewing of the progression toward fully methylated state. ( C ) 129-mer substrate containing two CcrM target sites. The expected size of the fragments obtained after HinfI digestion of completely unmethylated, partially methylated and fully methylated substrates are indicated. ( D ) 129-mer_HM substrate used to probe CcrM activity over hemimethylated GANTC sites. A M.TaqI methylation site (TCGA), as well as a HincII restriction site (GTYRAC) were linked to the GANTC site. M.TaqI-established methylation occurs as shown earlier, creating two GANTC sites hemimethylated on the lower strand. CcrM-catalyzed methylation of the upper strand was probed through protection from HincII digestion, which is blocked by hemimethylation.

    Techniques Used: Methylation, Plasmid Preparation, Sequencing, Activity Assay

    CcrM processivity assayed using pUC19 ( Figure 1 B) as substrate. A double digestion with HinfI and NdeI was performed to assess the methylation state of the plasmid. pUC19 plasmid linearized by NdeI digestion was used as a control (lane marked C). A large number of incompletely methylated intermediates are formed throughout the duration of the experiment, supporting the conclusion that CcrM is a distributive, rather than a processive methyltransferase. The marker lane (lane marked M) contains the GeneRuler molecular weight marker, provided by Fermentas. The sizes of the major bands are indicated on the left.
    Figure Legend Snippet: CcrM processivity assayed using pUC19 ( Figure 1 B) as substrate. A double digestion with HinfI and NdeI was performed to assess the methylation state of the plasmid. pUC19 plasmid linearized by NdeI digestion was used as a control (lane marked C). A large number of incompletely methylated intermediates are formed throughout the duration of the experiment, supporting the conclusion that CcrM is a distributive, rather than a processive methyltransferase. The marker lane (lane marked M) contains the GeneRuler molecular weight marker, provided by Fermentas. The sizes of the major bands are indicated on the left.

    Techniques Used: Methylation, Plasmid Preparation, Marker, Molecular Weight

    Related Articles

    Clone Assay:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Paragraph title: Cloning TA-encoding genes ... Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2.

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: Molecular Cloning of wbiI and bmul_2510 Genes in B. cenocepacia Clonal Variants Lacking O-Antigen Genes wbiI and bmul_2510 were PCR amplified from B. cenocepacia IST439 chromosomal DNA using a Hot Start High Fidelity polymerase (Qiagen) and cloned into pSCrhaB2 ( ; ). .. The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation.

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: Paragraph title: Cloning, mutagenesis and in vitro cRNA synthesis ... DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: Construction, expression and purification of PTD-Strep -Tactin Escherichia coli strain TG2 was used as host for cloning. .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: Construction of pACYCDuet-1-TM The specific control sequence was cloned into multiple cloning site 2 (MCS2) of the pACYCDuet-1 vector (p15A-type replication origin; Novagen, Merck, Germany; Fig. ). .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was confirmed by gel electrophoresis and sequencing of the inserted DNA using T7-promoter and T7 terminator primers.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: Paragraph title: Cloning and purification of VicK, GcrR & ComE ... The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: The open reading frame encoding bl21 was cloned by PCR using E. coli BL21 (DE3) chromosomal DNA as template with primers (forward, 5′-TATACATATGGCTCACCACCACCACCACCACGCCAGCAG AGGCGTAAACAAG-3′ , reverse, 5′-TGGTGGTGCTCGAGTCATC AGAACGGAATGTCATCATC-3′ ). .. The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA).

    Centrifugation:

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. To overexpress VicK-Intein, cells grown to mid-logarithmic phase (OD600 nm 0.3–0.5) were induced with 1 mM IPTG for 3 hr at 37°C with aeration before being harvested by centrifugation (4°C, 5,000 x g, 15 min) and frozen at −20°C.

    Amplification:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Cloning TA-encoding genes Each of the gene fragments was amplified by PCR from genomic DNA using primers detailed in Table S1. .. Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2.

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: Molecular Cloning of wbiI and bmul_2510 Genes in B. cenocepacia Clonal Variants Lacking O-Antigen Genes wbiI and bmul_2510 were PCR amplified from B. cenocepacia IST439 chromosomal DNA using a Hot Start High Fidelity polymerase (Qiagen) and cloned into pSCrhaB2 ( ; ). .. The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation.

    Article Title: High prevalence of diabetic retinopathy and lack of association with integrin α2 gene polymorphisms in patients with type 2 diabetes from Northeastern Mexico
    Article Snippet: The 600-bp segment of intron G encompassing the Bgl II and Nde I sites was amplified from genomic DNA in a final volume of 25 µl using the following conditions: 2 cycles of 94°C for 1 min, 69°C for 1 min and 72°C for 1 min; 2 cycles of 94°C for 1 min, 67°C for 1 min and 72°C for 1 min; and 30 cycles of 94°C for 1 min, 65°C for 1 min and 72°C for 1 min. .. The PCR samples (∼1 µg) were digested overnight with Bgl II and Nde I (NEB) at 37°C in a temperature-controlled water bath (Bio-Rad).

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: To generate Bub1 -Gfp , murine Bub , sequence was amplified via PCR from a cDNA clone, (Open Biosystems, #3671932) and ligated into pIVT-GFP . .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The results of the PCR amplification were examined by agarose gel electrophoresis (1%). .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    Article Title: Genetic analysis of polymorphisms in the kalirin gene for association with age-at-onset in European Huntington disease patients
    Article Snippet: Primer sequences for PCR amplification are shown in Table . .. The PCR products were incubated with 3U Alu I (rs10934657, rs111472457, rs61746078, rs2289838, rs2289838), 2.5U Btg I (rs35057827), 1.9U Msc I (rs13074913), 3U BamH I (rs61745397), 3U Spe I (rs112304715), 3U Nde I (rs2289838) or 3U Sac I (rs1062749) according to the manufacturer’s instructions (New England Biolabs, Inc., Beverly, MA, USA).

    Article Title: Efficient fermentative production of polymer-grade d-lactate by an engineered alkaliphilic Bacillus sp. strain under non-sterile conditions
    Article Snippet: The D -ldh gene was PCR amplified using primers LDH-PR (5′–GGAAAGGTAGATGTTTAAACATGACTAAAATTTTTGCTTACG–3′) and 165LDHR (5′–CGC GGATCC TTAGCCAACCTTAACTGGAG–3′; the Bam HI site is underlined). .. The expression fragment was obtained by fusing the genes by overlapping PCR, and the product was digested with Nde I and Bam HI (New England Biolabs) and ligated into the same sites in the pMK4 vector.

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: Paragraph title: Amplicon sequencing analysis of ClYVV genomic RNAs in planta ... Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA).

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was confirmed by gel electrophoresis and sequencing of the inserted DNA using T7-promoter and T7 terminator primers.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Molecular Cloning:

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: Paragraph title: Molecular Cloning of wbiI and bmul_2510 Genes in B. cenocepacia Clonal Variants Lacking O-Antigen ... The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation.

    Construct:

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2. .. Plasmid DNA was isolated from the cultures using a Qiagen Miniprep Kit, according to the manufacturers' instructions and sequenced by Macrogen (South Korea) to confirm the construct.

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs). .. After DNA linearization, the digests were purified (Qiagen, QIAquick PCR Purification) and in vitro transcription was carried out using an mMessage mMachine T7 kit (Ambion) according to the manufacturer's instructions.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: In brief, a 191-bp amplicon encoding the specific control sequence was obtained by PCR using a de novo template construct and the TM-NdeI F and TM-AvrII pac R primer pair, which included Nde I and Avr II restriction enzyme sites; the TM-AvrII pac R primer also included one C-variant pac site (Table ). .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: Construction and purification of carboxy-terminally His-tagged UvrY protein His-tagged UvrY (UvrY-His6 ) protein was constructed by PCR amplification of the coding sequence of uvrY gene using genomic DNA of E . coli MG1655 as template DNA and oligonucleotides UvrY-6xhis-F and UvrY-6xhis-R as primers ( ). .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Electrophoresis:

    Article Title: High prevalence of diabetic retinopathy and lack of association with integrin α2 gene polymorphisms in patients with type 2 diabetes from Northeastern Mexico
    Article Snippet: The PCR samples (∼1 µg) were digested overnight with Bgl II and Nde I (NEB) at 37°C in a temperature-controlled water bath (Bio-Rad). .. The digested amplicons were analyzed by electrophoresis in 2% agarose gels using ethidium bromide (Invitrogen Life Technologies) and a 2UV™ transilluminator (UVP, LLC, Upland, CA, USA).

    Incubation:

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2. .. Following incubation at 37°C overnight, transformants were used to inoculate 10 mL LBAmp cultures.

    Article Title: Genetic analysis of polymorphisms in the kalirin gene for association with age-at-onset in European Huntington disease patients
    Article Snippet: .. The PCR products were incubated with 3U Alu I (rs10934657, rs111472457, rs61746078, rs2289838, rs2289838), 2.5U Btg I (rs35057827), 1.9U Msc I (rs13074913), 3U BamH I (rs61745397), 3U Spe I (rs112304715), 3U Nde I (rs2289838) or 3U Sac I (rs1062749) according to the manufacturer’s instructions (New England Biolabs, Inc., Beverly, MA, USA). ..

    Article Title: Functional characterization of a small heat shock protein from Mycobacterium leprae
    Article Snippet: In this assay, restriction enzymes Sma I and Nde I (New England Biolabs, Beverly, MA) were used, according to the manufacturer's recommendations. .. For heat inactivation, Sma I was incubated at 37°C for 90 min and Nde I at 45°C for 90 min with or without sHsp18 or α-crystallin.

    Activity Assay:

    Article Title: Functional characterization of a small heat shock protein from Mycobacterium leprae
    Article Snippet: Paragraph title: Determination of chaperone activity ... In this assay, restriction enzymes Sma I and Nde I (New England Biolabs, Beverly, MA) were used, according to the manufacturer's recommendations.

    Expressing:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: Paragraph title: Expression and purification of Ha24 in the prokaryotic expression system ... To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: Paragraph title: Construction, expression and purification of PTD-Strep -Tactin ... PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Article Title: Efficient fermentative production of polymer-grade d-lactate by an engineered alkaliphilic Bacillus sp. strain under non-sterile conditions
    Article Snippet: .. The expression fragment was obtained by fusing the genes by overlapping PCR, and the product was digested with Nde I and Bam HI (New England Biolabs) and ligated into the same sites in the pMK4 vector. ..

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was moved into BL21 (DE3) E . coli strain for expression.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: .. The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA). .. After sequence confirmation, the correct plasmids were used for SSB protein expression.

    Modification:

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: The library preparation was performed using a modified protocol for double digest restriction-associated DNA sequencing . .. Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA).

    Transformation Assay:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: Then the pGEX-4 T-1-Ha24 was transformed into BL21 (DE3) (TIANGEN, Beijing, China) clones were picked and the plasmids were purified using the AxyPrep™ plasmid Miniprep kit (Axygen, Suzhou, China). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: .. The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation. .. Transformants carrying recombinant plasmids with the DNA insert were screened by colony PCR with primers 824 and pSC rev, which anneal to vector sequences flanking the cloning sites.

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was confirmed by gel electrophoresis and sequencing of the inserted DNA using T7-promoter and T7 terminator primers.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Activated Clotting Time Assay:

    Article Title: High prevalence of diabetic retinopathy and lack of association with integrin α2 gene polymorphisms in patients with type 2 diabetes from Northeastern Mexico
    Article Snippet: In brief, the method for the PCR was as follows: 250 ng genomic DNA, 0.5 µM primers (forward, 5′-GAT TTA ACT TTC CCG ACT GCC TTC-3′ and reverse, 5′-CAT AGG TTT TTG GGG AAC AGG TGG-3′), 0.2 mM deoxyribonucleotide triphosphates (Invitrogen Life Technologies, Carlsbad, CA, USA), 1.5 mM MgCl2 and 2.5 units of Taq DNA polymerase (Invitrogen Life Technologies) were combined to form the reaction mixture. .. The PCR samples (∼1 µg) were digested overnight with Bgl II and Nde I (NEB) at 37°C in a temperature-controlled water bath (Bio-Rad).

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: To generate Aurkc -DN T171 and 175 were changed to an A (ACA and ACT to GCC; ). .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Derivative Assay:

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: SSB Protein Expression and Purification We selected three SSB proteins derived from the thermophilic bacteria Thermus thermophilus HB8 (AP008226.1), Sulfolobus Solfataricus P2 (AE006641.1), and Thermococcus kodakarensis KOD1 (AP006878.1), and one SSB protein from Escherichia coli BL21 (AM946981) termed tth, ssob, kod and bl21, respectively. .. The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA).

    Ligation:

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: .. Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA). .. Amplicon-adaptor complexes were purified using Agencourt AMPure XP (Beckman Coulter, Brea, CA, USA) and were amplified by PCR with index and universal primers.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The restriction mixture was composed of 500 ng of plasmid DNA, 5 µl of NEBuffer 2 (NEB) 20 U and 4 U of Nde I and AvrII endonucleases, respectively (both NEB), in a final volume of 50 µl. .. Ligation of the specific control sequence to the MCS2 of the cleaved pACYCDuet-1 vector was performed using the Quick-ligation kit (NEB) according to the manufacturer’s instructions.

    Generated:

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: Aurkc -LA and Aurkc -DN mutants were generated by site-directed mutagenesis using the QuikChange Multi-site Mutagenesis kit (Agilent Technologies) following manufacturer's instructions. .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: PTD-ST fusions were generated by PCR-amplification using Taq DNA polymerase (Invitrogen, Karlsruhe, Germany), primers 5′-G GAA TTC CAT ATG CGC CAG ATT AAG ATT TGG TTC CAG AAC CGC CGC ATG AAG TGG AAG AAG GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Ant16-ST, 5′-G GAA TTC CAT ATG CGT CGT ATG AAG TGG AAG AAG GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Ant7-ST, 5′-G GAA TTC CAT ATG TAC GGA AGA AAG AAG CGC AGA CAA AGA AGA CGT CCA CCA GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Tat13-ST, 5′-G GAA TTC CAT ATG AGA CGC AGA AGA AGA AGA AGA CGC AGA GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for R9 -ST (bold letters denote the respective PTD sequences), and reverse primer 5′-CGC AAG CTT TTA TTA GGA AGC AGC GG-3′. .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Article Title: Genetic analysis of polymorphisms in the kalirin gene for association with age-at-onset in European Huntington disease patients
    Article Snippet: The mismatch primers were generated using dCAPs Finder 2.0 software ( http://helix.wustl.edu/dcaps/dcaps.html ) and optimized by Primer 3 program ( http://frodo.wi.mit.edu/primer3/ ). .. The PCR products were incubated with 3U Alu I (rs10934657, rs111472457, rs61746078, rs2289838, rs2289838), 2.5U Btg I (rs35057827), 1.9U Msc I (rs13074913), 3U BamH I (rs61745397), 3U Spe I (rs112304715), 3U Nde I (rs2289838) or 3U Sac I (rs1062749) according to the manufacturer’s instructions (New England Biolabs, Inc., Beverly, MA, USA).

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: Cloning and purification of VicK, GcrR & ComE To generate a tagless version of VicK we used the Impact Kit (New England Biolabs) and generated a C-terminal VicK-Intein fusion protein by PCR amplifying the vicK coding sequence from S. mutans UA159 chromosomal DNA with oligonucleotides oSG548 and oSG550 ( ). .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    DNA Sequencing:

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: The library preparation was performed using a modified protocol for double digest restriction-associated DNA sequencing . .. Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA).

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Polymerase Chain Reaction:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Cloning TA-encoding genes Each of the gene fragments was amplified by PCR from genomic DNA using primers detailed in Table S1. .. Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2.

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: Molecular Cloning of wbiI and bmul_2510 Genes in B. cenocepacia Clonal Variants Lacking O-Antigen Genes wbiI and bmul_2510 were PCR amplified from B. cenocepacia IST439 chromosomal DNA using a Hot Start High Fidelity polymerase (Qiagen) and cloned into pSCrhaB2 ( ; ). .. The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation.

    Article Title: High prevalence of diabetic retinopathy and lack of association with integrin α2 gene polymorphisms in patients with type 2 diabetes from Northeastern Mexico
    Article Snippet: .. The PCR samples (∼1 µg) were digested overnight with Bgl II and Nde I (NEB) at 37°C in a temperature-controlled water bath (Bio-Rad). .. The digested amplicons were analyzed by electrophoresis in 2% agarose gels using ethidium bromide (Invitrogen Life Technologies) and a 2UV™ transilluminator (UVP, LLC, Upland, CA, USA).

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: To generate Bub1 -Gfp , murine Bub , sequence was amplified via PCR from a cDNA clone, (Open Biosystems, #3671932) and ligated into pIVT-GFP . .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a. ..

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl. .. The cleaved PCR product was also purified using the QIAquick PCR purification kit (Qiagen).

    Article Title: Genetic analysis of polymorphisms in the kalirin gene for association with age-at-onset in European Huntington disease patients
    Article Snippet: .. The PCR products were incubated with 3U Alu I (rs10934657, rs111472457, rs61746078, rs2289838, rs2289838), 2.5U Btg I (rs35057827), 1.9U Msc I (rs13074913), 3U BamH I (rs61745397), 3U Spe I (rs112304715), 3U Nde I (rs2289838) or 3U Sac I (rs1062749) according to the manufacturer’s instructions (New England Biolabs, Inc., Beverly, MA, USA). ..

    Article Title: Efficient fermentative production of polymer-grade d-lactate by an engineered alkaliphilic Bacillus sp. strain under non-sterile conditions
    Article Snippet: .. The expression fragment was obtained by fusing the genes by overlapping PCR, and the product was digested with Nde I and Bam HI (New England Biolabs) and ligated into the same sites in the pMK4 vector. ..

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: Construction and purification of carboxy-terminally His-tagged UvrY protein His-tagged UvrY (UvrY-His6 ) protein was constructed by PCR amplification of the coding sequence of uvrY gene using genomic DNA of E . coli MG1655 as template DNA and oligonucleotides UvrY-6xhis-F and UvrY-6xhis-R as primers ( ). .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: Cloning and purification of VicK, GcrR & ComE To generate a tagless version of VicK we used the Impact Kit (New England Biolabs) and generated a C-terminal VicK-Intein fusion protein by PCR amplifying the vicK coding sequence from S. mutans UA159 chromosomal DNA with oligonucleotides oSG548 and oSG550 ( ). .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The cleaved PCR product was also purified using the QIAquick PCR purification kit (Qiagen). .. The restriction mixture was composed of 500 ng of plasmid DNA, 5 µl of NEBuffer 2 (NEB) 20 U and 4 U of Nde I and AvrII endonucleases, respectively (both NEB), in a final volume of 50 µl.

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: .. The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA). .. After sequence confirmation, the correct plasmids were used for SSB protein expression.

    Affinity Purification:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: For induction of recombinant Ha24 expression, isopropyl thio -β-D -galactoside (IPTG) was added to a final concentration of 1 mM and expression was induced at 20 °C for 12 h. After expression, the recombinant Ha24 (rHa24) was affinity-purified under both native and denaturation conditions using GST agarose and the AKTA FPLC protein purification system (GE). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Recombinant:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: For induction of recombinant Ha24 expression, isopropyl thio -β-D -galactoside (IPTG) was added to a final concentration of 1 mM and expression was induced at 20 °C for 12 h. After expression, the recombinant Ha24 (rHa24) was affinity-purified under both native and denaturation conditions using GST agarose and the AKTA FPLC protein purification system (GE). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation. .. Transformants carrying recombinant plasmids with the DNA insert were screened by colony PCR with primers 824 and pSC rev, which anneal to vector sequences flanking the cloning sites.

    Cellular Antioxidant Activity Assay:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: PTD-ST fusions were generated by PCR-amplification using Taq DNA polymerase (Invitrogen, Karlsruhe, Germany), primers 5′-G GAA TTC CAT ATG CGC CAG ATT AAG ATT TGG TTC CAG AAC CGC CGC ATG AAG TGG AAG AAG GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Ant16-ST, 5′-G GAA TTC CAT ATG CGT CGT ATG AAG TGG AAG AAG GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Ant7-ST, 5′-G GAA TTC CAT ATG TAC GGA AGA AAG AAG CGC AGA CAA AGA AGA CGT CCA CCA GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Tat13-ST, 5′-G GAA TTC CAT ATG AGA CGC AGA AGA AGA AGA AGA CGC AGA GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for R9 -ST (bold letters denote the respective PTD sequences), and reverse primer 5′-CGC AAG CTT TTA TTA GGA AGC AGC GG-3′. .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Nucleic Acid Electrophoresis:

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was confirmed by gel electrophoresis and sequencing of the inserted DNA using T7-promoter and T7 terminator primers.

    Mutagenesis:

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: Paragraph title: Cloning, mutagenesis and in vitro cRNA synthesis ... DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: ST was expressed from the same vector backbone after QuikChange mutagenesis (Stratagene, Heidelberg, Germany) of the SA portion with primers 5′-G ACC GGT ACC TAC ATC GGT GCG AGG GGT AAC GCT GAA TC-3′ and 5′-GA TTC AGC GTT ACC CCT CGC ACC GAT GTA GGT ACC GGT C-3′ (bold letters indicate mutations to induce amino acid substitutions E44 I, S45 G and V47 R which convert SA into ST [ ]). .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Isolation:

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2. .. Plasmid DNA was isolated from the cultures using a Qiagen Miniprep Kit, according to the manufacturers' instructions and sequenced by Macrogen (South Korea) to confirm the construct.

    Purification:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: Paragraph title: Expression and purification of Ha24 in the prokaryotic expression system ... To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs). .. After DNA linearization, the digests were purified (Qiagen, QIAquick PCR Purification) and in vitro transcription was carried out using an mMessage mMachine T7 kit (Ambion) according to the manufacturer's instructions.

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: Paragraph title: Construction, expression and purification of PTD-Strep -Tactin ... PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The PCR product was purified using the QIAquick PCR purification kit (Qiagen, Germany) and subsequently cleaved at 37 °C for 2 hours. .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA). .. Amplicon-adaptor complexes were purified using Agencourt AMPure XP (Beckman Coulter, Brea, CA, USA) and were amplified by PCR with index and universal primers.

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: Paragraph title: Construction and purification of carboxy-terminally His-tagged UvrY protein ... The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The cleaved PCR product was also purified using the QIAquick PCR purification kit (Qiagen). .. The restriction mixture was composed of 500 ng of plasmid DNA, 5 µl of NEBuffer 2 (NEB) 20 U and 4 U of Nde I and AvrII endonucleases, respectively (both NEB), in a final volume of 50 µl.

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: Paragraph title: SSB Protein Expression and Purification ... The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA).

    Protein Purification:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: For induction of recombinant Ha24 expression, isopropyl thio -β-D -galactoside (IPTG) was added to a final concentration of 1 mM and expression was induced at 20 °C for 12 h. After expression, the recombinant Ha24 (rHa24) was affinity-purified under both native and denaturation conditions using GST agarose and the AKTA FPLC protein purification system (GE). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Sequencing:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: Primers were designed based on the genome sequence of IST439 and included specific restriction enzyme sites and a sequence encoding the FLAG epitope tag (Supplementary Table ). .. The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation.

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: To generate Bub1 -Gfp , murine Bub , sequence was amplified via PCR from a cDNA clone, (Open Biosystems, #3671932) and ligated into pIVT-GFP . .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: In brief, a 191-bp amplicon encoding the specific control sequence was obtained by PCR using a de novo template construct and the TM-NdeI F and TM-AvrII pac R primer pair, which included Nde I and Avr II restriction enzyme sites; the TM-AvrII pac R primer also included one C-variant pac site (Table ). .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: Paragraph title: Amplicon sequencing analysis of ClYVV genomic RNAs in planta ... Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA).

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: Construction and purification of carboxy-terminally His-tagged UvrY protein His-tagged UvrY (UvrY-His6 ) protein was constructed by PCR amplification of the coding sequence of uvrY gene using genomic DNA of E . coli MG1655 as template DNA and oligonucleotides UvrY-6xhis-F and UvrY-6xhis-R as primers ( ). .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: Cloning and purification of VicK, GcrR & ComE To generate a tagless version of VicK we used the Impact Kit (New England Biolabs) and generated a C-terminal VicK-Intein fusion protein by PCR amplifying the vicK coding sequence from S. mutans UA159 chromosomal DNA with oligonucleotides oSG548 and oSG550 ( ). .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The restriction mixture was composed of 500 ng of plasmid DNA, 5 µl of NEBuffer 2 (NEB) 20 U and 4 U of Nde I and AvrII endonucleases, respectively (both NEB), in a final volume of 50 µl. .. Ligation of the specific control sequence to the MCS2 of the cleaved pACYCDuet-1 vector was performed using the Quick-ligation kit (NEB) according to the manufacturer’s instructions.

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA). .. After sequence confirmation, the correct plasmids were used for SSB protein expression.

    Fast Protein Liquid Chromatography:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: For induction of recombinant Ha24 expression, isopropyl thio -β-D -galactoside (IPTG) was added to a final concentration of 1 mM and expression was induced at 20 °C for 12 h. After expression, the recombinant Ha24 (rHa24) was affinity-purified under both native and denaturation conditions using GST agarose and the AKTA FPLC protein purification system (GE). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: PTD-ST fusions were generated by PCR-amplification using Taq DNA polymerase (Invitrogen, Karlsruhe, Germany), primers 5′-G GAA TTC CAT ATG CGC CAG ATT AAG ATT TGG TTC CAG AAC CGC CGC ATG AAG TGG AAG AAG GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Ant16-ST, 5′-G GAA TTC CAT ATG CGT CGT ATG AAG TGG AAG AAG GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Ant7-ST, 5′-G GAA TTC CAT ATG TAC GGA AGA AAG AAG CGC AGA CAA AGA AGA CGT CCA CCA GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for Tat13-ST, 5′-G GAA TTC CAT ATG AGA CGC AGA AGA AGA AGA AGA CGC AGA GGT GCT GAA GCT GGT ATC ACC GGC ACC-3′ for R9 -ST (bold letters denote the respective PTD sequences), and reverse primer 5′-CGC AAG CTT TTA TTA GGA AGC AGC GG-3′. .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Plasmid Preparation:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: Then the pGEX-4 T-1-Ha24 was transformed into BL21 (DE3) (TIANGEN, Beijing, China) clones were picked and the plasmids were purified using the AxyPrep™ plasmid Miniprep kit (Axygen, Suzhou, China). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    Article Title: Identification of novel transaminases from a 12-aminododecanoic acid-metabolizing Pseudomonas strain
    Article Snippet: Amplicons were digested using Nde I and Bam HI restriction endonucleases (NEB) and ligated (T4 DNA ligase, NEB) into pETcc2. .. Plasmid DNA was isolated from the cultures using a Qiagen Miniprep Kit, according to the manufacturers' instructions and sequenced by Macrogen (South Korea) to confirm the construct.

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation. .. Transformants carrying recombinant plasmids with the DNA insert were screened by colony PCR with primers 824 and pSC rev, which anneal to vector sequences flanking the cloning sites.

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: ST was expressed from the same vector backbone after QuikChange mutagenesis (Stratagene, Heidelberg, Germany) of the SA portion with primers 5′-G ACC GGT ACC TAC ATC GGT GCG AGG GGT AAC GCT GAA TC-3′ and 5′-GA TTC AGC GTT ACC CCT CGC ACC GAT GTA GGT ACC GGT C-3′ (bold letters indicate mutations to induce amino acid substitutions E44 I, S45 G and V47 R which convert SA into ST [ ]). .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: Construction of pACYCDuet-1-TM The specific control sequence was cloned into multiple cloning site 2 (MCS2) of the pACYCDuet-1 vector (p15A-type replication origin; Novagen, Merck, Germany; Fig. ). .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    Article Title: Efficient fermentative production of polymer-grade d-lactate by an engineered alkaliphilic Bacillus sp. strain under non-sterile conditions
    Article Snippet: .. The expression fragment was obtained by fusing the genes by overlapping PCR, and the product was digested with Nde I and Bam HI (New England Biolabs) and ligated into the same sites in the pMK4 vector. ..

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: The amplicons were also prepared from 10 pg of parental infectious plasmid DNAs. .. Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA).

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: .. The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was confirmed by gel electrophoresis and sequencing of the inserted DNA using T7-promoter and T7 terminator primers.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: .. The restriction mixture was composed of 500 ng of plasmid DNA, 5 µl of NEBuffer 2 (NEB) 20 U and 4 U of Nde I and AvrII endonucleases, respectively (both NEB), in a final volume of 50 µl. .. The cleaved vector was dephosphorylated with 0.25 U of calf-intestinal alkaline phosphatase (CIP) (NEB) at 37 °C for 1 hour.

    Article Title: Functional characterization of a small heat shock protein from Mycobacterium leprae
    Article Snippet: In this assay, restriction enzymes Sma I and Nde I (New England Biolabs, Beverly, MA) were used, according to the manufacturer's recommendations. .. Two units of enzyme was used to digest 1 μg of plasmid DNA (pQE31).

    Article Title: Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism
    Article Snippet: .. The PCR product with a His-tag was inserted into a pET21a expression vector (Merck, Whitehouse Station, NJ) after digestion with Nde I and Xho I (New England Biolabs, Ipswich, MA). .. After sequence confirmation, the correct plasmids were used for SSB protein expression.

    Software:

    Article Title: Genetic analysis of polymorphisms in the kalirin gene for association with age-at-onset in European Huntington disease patients
    Article Snippet: The mismatch primers were generated using dCAPs Finder 2.0 software ( http://helix.wustl.edu/dcaps/dcaps.html ) and optimized by Primer 3 program ( http://frodo.wi.mit.edu/primer3/ ). .. The PCR products were incubated with 3U Alu I (rs10934657, rs111472457, rs61746078, rs2289838, rs2289838), 2.5U Btg I (rs35057827), 1.9U Msc I (rs13074913), 3U BamH I (rs61745397), 3U Spe I (rs112304715), 3U Nde I (rs2289838) or 3U Sac I (rs1062749) according to the manufacturer’s instructions (New England Biolabs, Inc., Beverly, MA, USA).

    Article Title: Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses
    Article Snippet: Briefly, the amplicons were digested with 5 units of Bgl II and 2.5 units of Nde I (New England Biolabs, Ipswich, MA, USA) simultaneously, with adapter ligation using T4 DNA Ligase (Enzymatics, Beverly, MA, USA). .. The raw sequence reads were aligned using BWA 0.7.10 software ( http://sourceforge.net/projects/bio-bwa/ ) to the 209 nt sequence of Cl30 or RB.

    Positron Emission Tomography:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Transtactin: a universal transmembrane delivery system for Strep-tag II-fused cargos
    Article Snippet: .. PCR-products were digested with Nde I and Hind III (New England Biolabs, Frankfurt, Germany) and subsequently ligated into linearized pET-21a. ..

    Article Title: Genomic Targets and Features of BarA-UvrY (-SirA) Signal Transduction Systems
    Article Snippet: The amplicon was gel-purified, digested using Nde I and Xho I restriction enzymes (NEB), and cloned into a similarly digested and dephosphorylated pET24-a (+) vector DNA (NEB) using electrocompetent DH5α for the transformation. .. The pET-UvrY plasmid was confirmed by gel electrophoresis and sequencing of the inserted DNA using T7-promoter and T7 terminator primers.

    Agarose Gel Electrophoresis:

    Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles
    Article Snippet: The results of the PCR amplification were examined by agarose gel electrophoresis (1%). .. The composition of the restriction mixture was 500 ng of PCR product, 2 µl of NEBuffer 2 (New England Biolabs, UK; NEB), 20 U and 4 U of Nde I and Avr II endonucleases, respectively (both NEB), in a final volume of 20 µl.

    In Vitro:

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: Paragraph title: Cloning, mutagenesis and in vitro cRNA synthesis ... DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Concentration Assay:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: For induction of recombinant Ha24 expression, isopropyl thio -β-D -galactoside (IPTG) was added to a final concentration of 1 mM and expression was induced at 20 °C for 12 h. After expression, the recombinant Ha24 (rHa24) was affinity-purified under both native and denaturation conditions using GST agarose and the AKTA FPLC protein purification system (GE). .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio).

    FLAG-tag:

    Article Title: Structure of O-Antigen and Hybrid Biosynthetic Locus in Burkholderia cenocepacia Clonal Variants Recovered from a Cystic Fibrosis Patient
    Article Snippet: Primers WbiI–flag–NdeI and WbiI_439_XbaI were used to clone wbiI fused to an N-terminal FLAG tag; primers wbiI_439_NdeI and WbiI–flag–XbaI were used to clone wbiI fused to a C-terminal FLAG tag; primers Bmul_2510-439-NdeI and Bmul_2510-flag-XbaI were used to clone bmul_2510 fused to a C-terminal FLAG tag; primers P1, P2, P3 and P4 were used to clone both wbiI and bmul_2510 with C-terminal FLAGs using the Gibson Assembly strategy (New England BioLabs). .. The resulting products were digested with Nde I and Xba I, ligated to pSCrhaB2 and introduced into E. coli ER2925 (New England BioLabs) ( ) by transformation.

    CTG Assay:

    Article Title: Specific histamine binding activity of a new lipocalin from Hyalomma asiaticum (Ixodidae) and therapeutic effects on allergic asthma in mice
    Article Snippet: .. To obtain the polyclonal antibody (PcAb), we cloned the Ha24 gene into pET-30a (Invitrogen) using gene specific primers: F-Nde I (5'-AAG GAG ATA TAC ATA TG G AGA AAG TAA TGG CTCA CAA AGA GGA G-3') and R-Xho I (5'-GGT GGT GGT GCT CGA G CG ATT TCG GCA ATA TTT TCT TCA ATT CTT TTT CTG-3'). pET-30a were digested with Nde I and Xho I (New England Biolabs), and ligated with the Ha24 gene sequence which was amplified by CloneAmp™ HiFi PCR Premix (Clontech, Takara Bio, Palo Alto, CA, USA) using In-Fusion HD Cloning Kits (Clontech, Takara Bio). .. After the pET-30a-Ha24 was obtained, the next steps were in line with methods above.

    Article Title: Selective Disruption of Aurora C Kinase Reveals Distinct Functions from Aurora B Kinase during Meiosis in Mouse Oocytes
    Article Snippet: To generate Aurkc -L93 was changed to an A (CTG to GCC; ). .. DNA linearization of all Gfp - and mCherry - containing constructs was carried out using Nde I (New England BioLabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs nde i
    Nde I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 149 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nde i/product/New England Biolabs
    Average 90 stars, based on 149 article reviews
    Price from $9.99 to $1999.99
    nde i - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results