ndei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NdeI
    Description:
    NdeI 20 000 units
    Catalog Number:
    R0111L
    Price:
    264
    Size:
    20 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs ndei
    NdeI
    NdeI 20 000 units
    https://www.bioz.com/result/ndei/product/New England Biolabs
    Average 99 stars, based on 290 article reviews
    Price from $9.99 to $1999.99
    ndei - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Efficient method for site-directed mutagenesis in large plasmids without subcloning"

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0177788

    Validation of the URMAC method by insertion (I), substitution (S), or deletion (D) of some restriction sites in pUC18 plasmid. (A) Illustration of the Modification Target (NdeI restriction site) relative to the flanking restriction sites and location of the Starter Primers SP1 and SP2. After the first PCR, the Starter DNA migrated as expected, 532 bp on a 1% agarose gel (photo, arrow at right). A 100 bp DNA size ladder is shown in left lane for comparison. (B) Diagram of the strategy for I, S, or D using the Closed Starter DNA circularized from the PCR product in (A) as template and the Opener/Mutagenic Primers . The top photo shows the PCR product, Intermediate DNA , which contained the mutations. The bottom photo shows the Modified DNA after enrichment PCR step using SP1 and SP2. (C) Validation of URMAC mutagenesis for the three different types of mutations by restriction analysis. Fig 2C shows bands of expected DNA fragment size after digestion with respective restriction enzymes. In the control Starter PCR lane, only DNA treated with NdeI enzyme, cut the DNA into two fragments of 382 150 bp. Untreated DNA or DNA treated with MluI remained at the full size of 532 bp. In the Insertion lane, both NdeI and MluI cut the DNA at the expected sizes of 382 150 for NdeI and 383 149 for MluI. In the Substitution lane, only MluI cut the DNA producing the expected 383 149 bp bands. In the Deletion lane, none of the enzymes cut the DNA, leaving the bands at their original Modified DNA size.
    Figure Legend Snippet: Validation of the URMAC method by insertion (I), substitution (S), or deletion (D) of some restriction sites in pUC18 plasmid. (A) Illustration of the Modification Target (NdeI restriction site) relative to the flanking restriction sites and location of the Starter Primers SP1 and SP2. After the first PCR, the Starter DNA migrated as expected, 532 bp on a 1% agarose gel (photo, arrow at right). A 100 bp DNA size ladder is shown in left lane for comparison. (B) Diagram of the strategy for I, S, or D using the Closed Starter DNA circularized from the PCR product in (A) as template and the Opener/Mutagenic Primers . The top photo shows the PCR product, Intermediate DNA , which contained the mutations. The bottom photo shows the Modified DNA after enrichment PCR step using SP1 and SP2. (C) Validation of URMAC mutagenesis for the three different types of mutations by restriction analysis. Fig 2C shows bands of expected DNA fragment size after digestion with respective restriction enzymes. In the control Starter PCR lane, only DNA treated with NdeI enzyme, cut the DNA into two fragments of 382 150 bp. Untreated DNA or DNA treated with MluI remained at the full size of 532 bp. In the Insertion lane, both NdeI and MluI cut the DNA at the expected sizes of 382 150 for NdeI and 383 149 for MluI. In the Substitution lane, only MluI cut the DNA producing the expected 383 149 bp bands. In the Deletion lane, none of the enzymes cut the DNA, leaving the bands at their original Modified DNA size.

    Techniques Used: Plasmid Preparation, Modification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mutagenesis

    2) Product Images from "Low copy repeats mediate distal chromosome 22q11.2 deletions: Sequence analysis predicts breakpoint mechanisms"

    Article Title: Low copy repeats mediate distal chromosome 22q11.2 deletions: Sequence analysis predicts breakpoint mechanisms

    Journal:

    doi: 10.1101/gr.5986507

    Southern hybridization analysis of CH98-18. ( A ) Restriction sites for NdeI that generate the expected 20.5 kb band in the LCR-E region are shown. The restriction site in LCR-D that would give rise to the ∼19 kb rearranged fragment is indicated
    Figure Legend Snippet: Southern hybridization analysis of CH98-18. ( A ) Restriction sites for NdeI that generate the expected 20.5 kb band in the LCR-E region are shown. The restriction site in LCR-D that would give rise to the ∼19 kb rearranged fragment is indicated

    Techniques Used: Hybridization

    3) Product Images from "Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells"

    Article Title: Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells

    Journal:

    doi: 10.1101/gad.1369805

    Replication initiation factors fused to GAL4 stimulate replication of a plasmid containing GAL4 DNA-binding sites in vivo. ( A ) Extrachromosomal DNA was isolated from HEK293 cells cotransfected with the indicated plasmids and pFR_Luc, which contains five GAL4-binding sites (lanes 3-10 ). After digestion with DpnI and NdeI ( A ) or NdeI alone ( B ), samples were separated by agarose gel electrophoresis, and DNA was visualized by Southern blotting using a probe to the SmaI-BstEII fragment of pFR_Luc. NdeI-digested pFR_Luc was loaded in lane 1 as a size marker for linearized plasmid. In lane 2 , pFR_Luc was digested with NdeI and DpnI as a control ensuring complete digestion by DpnI. ( C ) Replication was quantified by PhosphorImaging. (R/S) The intensity of the DpnI-resistant band in A divided by the intensity of the NdeI-digested band in B . ( D ) C33a cells were transfected with the indicated plasmids and replication measured as in A . The bottom panel represents a lighter exposure of the top panel as a control showing equal amounts of transfected DNA. ( E ) The transcriptional activity of the GAL4 fusions in A were measured by a luciferase assay. (RLU) Firefly luciferase activity under control of GAL4-binding sites was normalized to Renilla luciferase under the control of a constitutively active promoter.
    Figure Legend Snippet: Replication initiation factors fused to GAL4 stimulate replication of a plasmid containing GAL4 DNA-binding sites in vivo. ( A ) Extrachromosomal DNA was isolated from HEK293 cells cotransfected with the indicated plasmids and pFR_Luc, which contains five GAL4-binding sites (lanes 3-10 ). After digestion with DpnI and NdeI ( A ) or NdeI alone ( B ), samples were separated by agarose gel electrophoresis, and DNA was visualized by Southern blotting using a probe to the SmaI-BstEII fragment of pFR_Luc. NdeI-digested pFR_Luc was loaded in lane 1 as a size marker for linearized plasmid. In lane 2 , pFR_Luc was digested with NdeI and DpnI as a control ensuring complete digestion by DpnI. ( C ) Replication was quantified by PhosphorImaging. (R/S) The intensity of the DpnI-resistant band in A divided by the intensity of the NdeI-digested band in B . ( D ) C33a cells were transfected with the indicated plasmids and replication measured as in A . The bottom panel represents a lighter exposure of the top panel as a control showing equal amounts of transfected DNA. ( E ) The transcriptional activity of the GAL4 fusions in A were measured by a luciferase assay. (RLU) Firefly luciferase activity under control of GAL4-binding sites was normalized to Renilla luciferase under the control of a constitutively active promoter.

    Techniques Used: Plasmid Preparation, Binding Assay, In Vivo, Isolation, Agarose Gel Electrophoresis, Southern Blot, Marker, Transfection, Activity Assay, Luciferase

    4) Product Images from "Codon-Optimized Expression and Purification of Truncated ORF2 Protein of Hepatitis E Virus in Escherichia coli"

    Article Title: Codon-Optimized Expression and Purification of Truncated ORF2 Protein of Hepatitis E Virus in Escherichia coli

    Journal: Jundishapur Journal of Microbiology

    doi: 10.5812/jjm.11261

    Polymerase Chain Reaction Amplification and Restriction Enzyme Analyses of Different Plasmids by NdeI and XhoI Restriction Enzymes and Comparison of Undigested and Digested Patterns of Plasmids With orf2.1 and orf2.2 on Agarose Gel Electrophoresis PCR amplification and restriction enzyme analyses of plasmids pBluescript II SK-ORF2.1, pET30a-ORF2.1, pET30a-ORF2.2, and pET30a+ without ORF2.1 by NdeI and XhoI restriction enzymes. Lane 1, the 1 kb DNA marker; Lane 2, the undigested plasmid pET30a+; Lane 3, the digested plasmid pET30a+; Lane 4, the undigested pBluescript II SK-ORF2.1; Lane 5, the digested pBluescript II SK-ORF2.1; Lane 6, the undigested plasmid pET30a-ORF2.1; Lane 7, the digested plasmid pET30a- ORF2.1; Lane 8, the amplified orf2.1 gene by PCR (with T7 promoter and T7 terminator primers); Lane 9, the undigested plasmid pET30a-ORF2.2; Lane 10, the digested plasmid pET30a-ORF2.2; Lane 11, the amplified orf2.2 gene by PCR (with T7 promoter and T7 terminator primers); Lane 13, the 1kb DNA marker; Lane 14, the amplified orf2.1 gene by PCR; and Lane 15, the amplified orf2.2 gene by PCR.
    Figure Legend Snippet: Polymerase Chain Reaction Amplification and Restriction Enzyme Analyses of Different Plasmids by NdeI and XhoI Restriction Enzymes and Comparison of Undigested and Digested Patterns of Plasmids With orf2.1 and orf2.2 on Agarose Gel Electrophoresis PCR amplification and restriction enzyme analyses of plasmids pBluescript II SK-ORF2.1, pET30a-ORF2.1, pET30a-ORF2.2, and pET30a+ without ORF2.1 by NdeI and XhoI restriction enzymes. Lane 1, the 1 kb DNA marker; Lane 2, the undigested plasmid pET30a+; Lane 3, the digested plasmid pET30a+; Lane 4, the undigested pBluescript II SK-ORF2.1; Lane 5, the digested pBluescript II SK-ORF2.1; Lane 6, the undigested plasmid pET30a-ORF2.1; Lane 7, the digested plasmid pET30a- ORF2.1; Lane 8, the amplified orf2.1 gene by PCR (with T7 promoter and T7 terminator primers); Lane 9, the undigested plasmid pET30a-ORF2.2; Lane 10, the digested plasmid pET30a-ORF2.2; Lane 11, the amplified orf2.2 gene by PCR (with T7 promoter and T7 terminator primers); Lane 13, the 1kb DNA marker; Lane 14, the amplified orf2.1 gene by PCR; and Lane 15, the amplified orf2.2 gene by PCR.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Marker, Plasmid Preparation

    5) Product Images from "An exogenous chloroplast genome for complex sequence manipulation in algae"

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr1008

    Characterization of the cloned C. reinhardtii chloroplast genome in vivo . ( A ) A nested set representing the presence of increasing numbers of markers in primary transformants of pCr03 into a psbD knockout strain as determined by PCR ( Table 2 ; primers used as follows: M1, 11 606 and 11 607; M2, 5512 and 5513; M3, 11 456 and 11 457; and M4, 14 067 and 14 068.). The broken circle shows the subset of transformants with M1, M2, M3 and M4 that gave rise to the same genotype upon rescreening. ( B–E ) Southern blot analysis of EcoRI (B, C and E) or NdeI (D) digests (see ‘Materials and Methods’ section). Probes were specific for sequences adjacent to integration sites for M1 (B), M2 (C), M3 (D) and M4 (E). All samples are arranged as follows: Lane L, 1 kb DNA ladder (Invitrogen; Carlsbad, CA); lane 1, wild-type; lane 2, purified pCr03; and lane 3, a representative algae clone containing all unique markers. A single band in lane 3 indicates homoplasmic integration of the marker, while two bands indicate heteroplasmy with the wild-type locus.
    Figure Legend Snippet: Characterization of the cloned C. reinhardtii chloroplast genome in vivo . ( A ) A nested set representing the presence of increasing numbers of markers in primary transformants of pCr03 into a psbD knockout strain as determined by PCR ( Table 2 ; primers used as follows: M1, 11 606 and 11 607; M2, 5512 and 5513; M3, 11 456 and 11 457; and M4, 14 067 and 14 068.). The broken circle shows the subset of transformants with M1, M2, M3 and M4 that gave rise to the same genotype upon rescreening. ( B–E ) Southern blot analysis of EcoRI (B, C and E) or NdeI (D) digests (see ‘Materials and Methods’ section). Probes were specific for sequences adjacent to integration sites for M1 (B), M2 (C), M3 (D) and M4 (E). All samples are arranged as follows: Lane L, 1 kb DNA ladder (Invitrogen; Carlsbad, CA); lane 1, wild-type; lane 2, purified pCr03; and lane 3, a representative algae clone containing all unique markers. A single band in lane 3 indicates homoplasmic integration of the marker, while two bands indicate heteroplasmy with the wild-type locus.

    Techniques Used: Clone Assay, In Vivo, Knock-Out, Polymerase Chain Reaction, Southern Blot, Purification, Marker

    6) Product Images from "Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C"

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C

    Journal: Molecular Systems Biology

    doi: 10.15252/msb.20188293

    Diagram of the workflow (related to Fig 1 ) Annotation (SK1 background) corresponds to CDS, ARS, telomere regions, retrotransposable elements, mating type loci, tRNA, Sn/Sno RNA, rDNA, ncRNA, intron motives, and TATA boxes. All those features but CDS and transposons were labeled as “forbidden”, preventing any nucleotide substitution in these regions. DpnII, HindIII, SacI, EcoRI, NdeI, SacII, SalI, XbaI, and XhoI. Putative restriction sites are DNA sequences differing with only one base pair from a RS recognized by a RE. The sequence modifications were allowed only in non‐forbidden positions. In CDS, silent mutations were introduced. When two sites overlapped, the minimum changes needed were selected. When possible, we favored A ↔ G and C ↔ T substitutions. A validation step to test whether or not the deletion of one site creates a new site was performed after each modification, and if so, a new modification was sought for. Modifications to generate new sites were also only introduced at non‐forbidden positions. Only silent mutations were introduced within coding regions. 583 × 150 kb windows with 10‐kb overlaps were generated over the entire genome, excluding telomeres and 75 kb from each side of centromeres. Here, 400, 1,500, 2,000 and 6,000 bp. For each 150‐kb window and each interval, the following steps were performed: for each enzyme, for each starting point: putative sites within the first bin of the window (0− 0+spacing). find the putative sites at position n +1 at a distance interval ± 10% from position n until the end of window. For each window, a score is calculated as follows: for each interval, a score is calculated for each enzyme based on the median absolute deviation (MAD). the best enzyme exhibiting the lowest score was chosen for each interval. Each spacing must have a different enzyme, so multiple combinations of enzymes were computed for each window. The window score is calculated as the sum of the four chosen interval scores. A final step of manual curation was performed to introduced PCRTags (Richardson et al , 2017 ).
    Figure Legend Snippet: Diagram of the workflow (related to Fig 1 ) Annotation (SK1 background) corresponds to CDS, ARS, telomere regions, retrotransposable elements, mating type loci, tRNA, Sn/Sno RNA, rDNA, ncRNA, intron motives, and TATA boxes. All those features but CDS and transposons were labeled as “forbidden”, preventing any nucleotide substitution in these regions. DpnII, HindIII, SacI, EcoRI, NdeI, SacII, SalI, XbaI, and XhoI. Putative restriction sites are DNA sequences differing with only one base pair from a RS recognized by a RE. The sequence modifications were allowed only in non‐forbidden positions. In CDS, silent mutations were introduced. When two sites overlapped, the minimum changes needed were selected. When possible, we favored A ↔ G and C ↔ T substitutions. A validation step to test whether or not the deletion of one site creates a new site was performed after each modification, and if so, a new modification was sought for. Modifications to generate new sites were also only introduced at non‐forbidden positions. Only silent mutations were introduced within coding regions. 583 × 150 kb windows with 10‐kb overlaps were generated over the entire genome, excluding telomeres and 75 kb from each side of centromeres. Here, 400, 1,500, 2,000 and 6,000 bp. For each 150‐kb window and each interval, the following steps were performed: for each enzyme, for each starting point: putative sites within the first bin of the window (0− 0+spacing). find the putative sites at position n +1 at a distance interval ± 10% from position n until the end of window. For each window, a score is calculated as follows: for each interval, a score is calculated for each enzyme based on the median absolute deviation (MAD). the best enzyme exhibiting the lowest score was chosen for each interval. Each spacing must have a different enzyme, so multiple combinations of enzymes were computed for each window. The window score is calculated as the sum of the four chosen interval scores. A final step of manual curation was performed to introduced PCRTags (Richardson et al , 2017 ).

    Techniques Used: Labeling, Sequencing, Modification, Generated

    7) Product Images from "The Caulobacter crescentus DNA-(adenine-N6)-methyltransferase CcrM methylates DNA in a distributive manner"

    Article Title: The Caulobacter crescentus DNA-(adenine-N6)-methyltransferase CcrM methylates DNA in a distributive manner

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr768

    Various substrates used for studying CcrM processivity. ( A ) Substrate used by Berdis et al. ( 14 ) to study CcrM processivity, referred to as N 6 60/66-mer. Two GANTC target sites are present, hemimethylated on the upper strand. HindII target sites (GTYRAC) coupled to CcrM target sites were used to screen for methylation on the lower strand. However, only one of the two HindII sites is present, making it impossible to probe the methylation state of the second site. ( B ) The distribution of GANTC sequences (shown as HinfI target sequences) throughout the pUC19 plasmid. The position of each sequence is indicated relative to the plasmid's replication origin. The vector contains a single NdeI target site, which was used in conjunction with HinfI for vector linearization, to facilitate viewing of the progression toward fully methylated state. ( C ) 129-mer substrate containing two CcrM target sites. The expected size of the fragments obtained after HinfI digestion of completely unmethylated, partially methylated and fully methylated substrates are indicated. ( D ) 129-mer_HM substrate used to probe CcrM activity over hemimethylated GANTC sites. A M.TaqI methylation site (TCGA), as well as a HincII restriction site (GTYRAC) were linked to the GANTC site. M.TaqI-established methylation occurs as shown earlier, creating two GANTC sites hemimethylated on the lower strand. CcrM-catalyzed methylation of the upper strand was probed through protection from HincII digestion, which is blocked by hemimethylation.
    Figure Legend Snippet: Various substrates used for studying CcrM processivity. ( A ) Substrate used by Berdis et al. ( 14 ) to study CcrM processivity, referred to as N 6 60/66-mer. Two GANTC target sites are present, hemimethylated on the upper strand. HindII target sites (GTYRAC) coupled to CcrM target sites were used to screen for methylation on the lower strand. However, only one of the two HindII sites is present, making it impossible to probe the methylation state of the second site. ( B ) The distribution of GANTC sequences (shown as HinfI target sequences) throughout the pUC19 plasmid. The position of each sequence is indicated relative to the plasmid's replication origin. The vector contains a single NdeI target site, which was used in conjunction with HinfI for vector linearization, to facilitate viewing of the progression toward fully methylated state. ( C ) 129-mer substrate containing two CcrM target sites. The expected size of the fragments obtained after HinfI digestion of completely unmethylated, partially methylated and fully methylated substrates are indicated. ( D ) 129-mer_HM substrate used to probe CcrM activity over hemimethylated GANTC sites. A M.TaqI methylation site (TCGA), as well as a HincII restriction site (GTYRAC) were linked to the GANTC site. M.TaqI-established methylation occurs as shown earlier, creating two GANTC sites hemimethylated on the lower strand. CcrM-catalyzed methylation of the upper strand was probed through protection from HincII digestion, which is blocked by hemimethylation.

    Techniques Used: Methylation, Plasmid Preparation, Sequencing, Activity Assay

    CcrM processivity assayed using pUC19 ( Figure 1 B) as substrate. A double digestion with HinfI and NdeI was performed to assess the methylation state of the plasmid. pUC19 plasmid linearized by NdeI digestion was used as a control (lane marked C). A large number of incompletely methylated intermediates are formed throughout the duration of the experiment, supporting the conclusion that CcrM is a distributive, rather than a processive methyltransferase. The marker lane (lane marked M) contains the GeneRuler molecular weight marker, provided by Fermentas. The sizes of the major bands are indicated on the left.
    Figure Legend Snippet: CcrM processivity assayed using pUC19 ( Figure 1 B) as substrate. A double digestion with HinfI and NdeI was performed to assess the methylation state of the plasmid. pUC19 plasmid linearized by NdeI digestion was used as a control (lane marked C). A large number of incompletely methylated intermediates are formed throughout the duration of the experiment, supporting the conclusion that CcrM is a distributive, rather than a processive methyltransferase. The marker lane (lane marked M) contains the GeneRuler molecular weight marker, provided by Fermentas. The sizes of the major bands are indicated on the left.

    Techniques Used: Methylation, Plasmid Preparation, Marker, Molecular Weight

    8) Product Images from "Structure-based functional identification of Helicobacter pylori HP0268 as a nuclease with both DNA nicking and RNase activities"

    Article Title: Structure-based functional identification of Helicobacter pylori HP0268 as a nuclease with both DNA nicking and RNase activities

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv348

    Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.
    Figure Legend Snippet: Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.

    Techniques Used: Activity Assay, Incubation, Plasmid Preparation, Positron Emission Tomography

    Nuclease activity of HP0268 mutants. (A) Nicking endonuclease assay of wild-type and mutant HP0268 using gel electrophoresis. The substrate plasmid DNA was incubated with the wild-type and mutants (2 μM) at 37ºC for 30 min. Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. (B) Graph of the nicking endonuclease activities of wild-type and mutant HP0268. The DNA nicking activities of the mutants are normalized by that of the wild-type. (C) Fluorometric ribonuclease activities of wild-type and mutant HP0268. The protein concentrations were maintained at 6 μM. The fluorescence spectra are shown in a color-coded mode. In every figure, Cont. and WT indicate the reference condition of having only a buffer and the wild-type protein, respectively. The reaction buffer consisted of 20 mM Tris (pH 8.0) and 150 mM NaCl.
    Figure Legend Snippet: Nuclease activity of HP0268 mutants. (A) Nicking endonuclease assay of wild-type and mutant HP0268 using gel electrophoresis. The substrate plasmid DNA was incubated with the wild-type and mutants (2 μM) at 37ºC for 30 min. Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. (B) Graph of the nicking endonuclease activities of wild-type and mutant HP0268. The DNA nicking activities of the mutants are normalized by that of the wild-type. (C) Fluorometric ribonuclease activities of wild-type and mutant HP0268. The protein concentrations were maintained at 6 μM. The fluorescence spectra are shown in a color-coded mode. In every figure, Cont. and WT indicate the reference condition of having only a buffer and the wild-type protein, respectively. The reaction buffer consisted of 20 mM Tris (pH 8.0) and 150 mM NaCl.

    Techniques Used: Activity Assay, Mutagenesis, Nucleic Acid Electrophoresis, Plasmid Preparation, Incubation, Fluorescence

    Related Articles

    Clone Assay:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: Paragraph title: Polygalacturonase gene cloning ... The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: The recombinant plasmid for the expression of UK114 in E. coli was obtained by cloning the Nde I/Xho I-digested DNA fragment encoding goat UK114 into the corresponding sites of the pET15b expression vector (Novagen). .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The luxA and luxB genes were inserted into the pET16b vector containing the selected artificial riboswitches using a traditional cloning approach. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: GST was cloned out of the pGEX-6P-1 vector. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Paragraph title: CDT Cloning, Expression, and Purification ... The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pET-28a vector and the pET-46b EK/LIC cloning kit were obtained from Novagen (San Diego, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc1 constructs were cloned using the NcoI and NotI sites of a pACYC-DUET vector for co-expression with Scc3, or into vectors containing the cognate Smc head domain in their second ORF for Smc/kleisin complexes (see below). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Amplification:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: Colony PCR amplification of the pglA gene (gene ID:1142827) was performed using Platinum taq polymerase (Invitrogen, Carlsbad, CA) and pglA specific primers XFPGF and XFPGRH with the following PCR parameters: 94°C (2 min) followed by 35 cycles of 94°C (1 min) 60°C (1 min) 72°C (2 min) and a final extension of 72°C (6 min). .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The recombinant M. haemofelis DnaK ( M. haemofelis rDnaK) gene was obtained in two steps: first, the M. haemofelis DnaK gene was amplified as two overlapping fragments from DNA extracted from blood of cat QLA5 (using primer pairs F1-35Mp/R934-956Mhf and F666-691Mhf/R1750-1783Mhf; Table ). .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ).

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: These primers were engineered such that 5′ NdeI and 3′ BamHI restriction sites (underlined in ) were incorporated into the amplicon. .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc3, Scc1 and other cohesin subunits were amplified from yeast Genomic DNA (Millipore). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Mass Spectrometry:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The purified HIS-tagged DPS protein was then cleaved with thrombin to yield the native DPS protein and dialyzed against 10 mM tris, pH 7.4, 500 mM KCl before storing in final 30% glycerol condition at 20 °C.

    Synthesized:

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs). .. The gRNA-expression vector pUC57-gRNA was described previously ( ). gRNA sequences (Table S1 in File S1 ) were synthesized as two complementary oligonucleotides, annealed, and inserted into the pUC57-gRNA plasmid after Bbs I digestion.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The DNA template and primers were synthesized by GenScript and PCR was performed with the template described above. .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    TA Cloning:

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pGEM-T TA-cloning vector and GoTaq DNA polymerase were acquired from Promega (Madison, WI). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Construct:

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs). .. The gRNA-expression vector pUC57-gRNA was described previously ( ). gRNA sequences (Table S1 in File S1 ) were synthesized as two complementary oligonucleotides, annealed, and inserted into the pUC57-gRNA plasmid after Bbs I digestion.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: Paragraph title: 4.1. Construct for the Expression of Goat UK114 in E. coli ... The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The vectors pXOP-SCFP3A-N1, pXOP-SYFP2-N1, and pXOP-SYFP2-SCFP3A were constructed for use in the generation of transgenic Xenopus laevis . .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: All constructs contained an N-terminal His6 tag encoded in the pET28a plasmid (Novagen). .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Paragraph title: Constructs, expression and purification ... Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Incubation:

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: 1 μl of template was incubated with 200 nM forward and reverse primers and 2 mM dNTP mix (0.5 mM each dNTP) in 50 μl reaction buffer (20 mM Tris-HCl, 2 mM MgSO4 , 10 mM KCl, 10 mM (NH4 )2 SO4 , 0.1% Triton X-100, 0.1 mg/ml BSA, pH 8.8) along with 1 μl Pfu Ultra II polymerase (Agilent). .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Expressing:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: Paragraph title: 4.1. Construct for the Expression of Goat UK114 in E. coli ... The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: These expression vectors were used to transfect HEK293T cells. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: Paragraph title: Expression systems and plasmid construction ... The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: Paragraph title: 4.4. Expression and Purification of Recombinant Survivin ... The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Paragraph title: CDT Cloning, Expression, and Purification ... The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Paragraph title: Constructs, expression and purification ... Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Transformation Assay:

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: DNA was transformed into competent E. coli DH5α (Life Technologies). .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The transformed bacteria were plated on Luria–Bertani (LB) agar petri dishes supplemented with 100 μg ml−1 carbenicillin and grown aerobically at 37 °C overnight. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. To insert the gene into the vector, the digested gene and vector were incubated with 40 units/μl T4 ligase in T4 buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, pH 7.5) for 18 hours at 16°C.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Over Expression:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Paragraph title: Cloning, protein overexpression and purification ... The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: Paragraph title: Over-expression and purification of Dps and IHF ... The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Derivative Assay:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Electroporation:

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The purified products were blunt end ligated (Quick Ligase, NEB) and afterwards transformed into E. coli BL21(DE3) gold (Stratagene) by electroporation. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Ligation:

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. To insert the gene into the vector, the digested gene and vector were incubated with 40 units/μl T4 ligase in T4 buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, pH 7.5) for 18 hours at 16°C.

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: The standard PCR protocol included the primers p1 (5′-GTATACCATATGGGTGCCCGG-3′) and p2 (5′-CGGATCCTCAATCCATGGCAGC-3′). .. The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag. .. The resulting pET16b_His-Survivin plasmid was transformed into E. coli BL 21 CodonPlus RIPL (Agilent Technologies, Santa Clara, CA, USA) cells for heterologous protein expression.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was transformed into NEB DH5α chemically competent cells (NEB).

    Immunohistofluorescence:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: Paragraph title: Over-expression and purification of Dps and IHF ... The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Generated:

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. The first fragment containing the SnoopTag-BLA component was amplified from SpyTag-BLA-SpyCatcher using primers 5′- ATTACATATGGGAAAACTGGGGGACATCGAATTCATCAAAGTAAACAAAGGTTCAGGGGGTTCCGGTCACC and 5′- CTAAACACGGCACCACGCAGCGGCTTTCCACTGCCACCACTCCCCCAATGC.

    other:

    Article Title: Site-specific incorporation of 3-nitrotyrosine as a probe of pKa perturbation of redox-active tyrosines in ribonucleotide reductase
    Article Snippet: Nco I, Xho I, Sal I, Bgl II, Nde I and Pst I were from New England Biolabs.

    DNA Sequencing:

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. Digested vector and amplicons were ligated and electroporated into E. coli DH5α.

    Sequencing:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Based on phage SETP3 genomic sequence available at NCBI database (reference sequence: NC_009232.2), primers (Invitrogen) were designed to amplify the putative endolysin gene by PCR from the isolated phage phi68 genomic DNA template, using Phusion High-Fidelity DNA Polymerase (NEB, UK). .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG. .. A . vitis strain S4 (kindly provided by T. Burr, Cornell, NY) was grown on solid 523 medium [ ] at room temperature for 48 hours.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence. .. The SV40 early polyadenylation signal sequence present in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with NotI and AflII (New England Biolabs, Ipswich, Massachusetts) and replaced by the SV40 late polyadenylation signal sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: The standard PCR protocol included the primers p1 (5′-GTATACCATATGGGTGCCCGG-3′) and p2 (5′-CGGATCCTCAATCCATGGCAGC-3′). .. The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag. .. The resulting pET16b_His-Survivin plasmid was transformed into E. coli BL 21 CodonPlus RIPL (Agilent Technologies, Santa Clara, CA, USA) cells for heterologous protein expression.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Plasmids were purified using QIAprep Minispin kit (Qiagen).

    Recombinant:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. E. coli BL21(DE3) harboring the endolysin vector was grown in 600 mL Luria Broth (LB) supplemented with 50 µg/mL kanamycin to an optical density (OD600 nm ) of 0.6 (4 h, 120 rpm at 37°C).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: The recombinant plasmid for the expression of UK114 in E. coli was obtained by cloning the Nde I/Xho I-digested DNA fragment encoding goat UK114 into the corresponding sites of the pET15b expression vector (Novagen). .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The recombinant M. haemofelis DnaK ( M. haemofelis rDnaK) gene was obtained in two steps: first, the M. haemofelis DnaK gene was amplified as two overlapping fragments from DNA extracted from blood of cat QLA5 (using primer pairs F1-35Mp/R934-956Mhf and F666-691Mhf/R1750-1783Mhf; Table ). .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ).

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Paragraph title: Construction of recombinant plasmids ... The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC).

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: Paragraph title: 4.4. Expression and Purification of Recombinant Survivin ... The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: Paragraph title: Production of recombinant Rv2346c protein ... The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    Molecular Weight:

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Molecular Cloning:

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Paragraph title: Gene construction and molecular cloning. ... The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ).

    Mutagenesis:

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs).

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The catalytically inactive variants of the ribozyme and of the selected twister-based riboswitches were prepared performing site direct mutagenesis by PCR using the suitable pET16b_eGFP containing the aptazyme active form as template. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: Paragraph title: Site-directed mutagenesis of GST, ubiquitin, subtiligase, and PTEN ... The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc3 and mutant variants thereof were cloned into pETM-30 vector using NcoI and NotI restriction enzyme cleavage sites. .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Isolation:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Based on phage SETP3 genomic sequence available at NCBI database (reference sequence: NC_009232.2), primers (Invitrogen) were designed to amplify the putative endolysin gene by PCR from the isolated phage phi68 genomic DNA template, using Phusion High-Fidelity DNA Polymerase (NEB, UK). .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag.

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: Thermoanaerobacterium polysaccharolyticum (ATCC strain no. BAA-17) was originally isolated from the waste pile of a canning factory in Hoopeston, Illinois ( ). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Size-exclusion Chromatography:

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Labeling:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Purification:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB). .. The gel-purified PCR band and the linearized vector were ligated (Quick Ligation Kit, NEB) and transformed into E. coli DH5α cells.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The purified products were blunt end ligated (Quick Ligase, NEB) and afterwards transformed into E. coli BL21(DE3) gold (Stratagene) by electroporation. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. IPTG-induction (0.5 mM IPTG final concentration) of late-log ER2566 cells (OD590 = 0.5 to 0.6) harboring appropriate plasmids was carried out at 16 °C to 18 °C overnight for protein production.

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: Paragraph title: 4.4. Expression and Purification of Recombinant Survivin ... The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Each PCR product was purified using the QIAquick PCR purification kit (Qiagen). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. Digested vector and amplicons were ligated and electroporated into E. coli DH5α.

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Paragraph title: Constructs, expression and purification ... Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Polymerase Chain Reaction:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB). .. The gel-purified PCR band and the linearized vector were ligated (Quick Ligation Kit, NEB) and transformed into E. coli DH5α cells.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence. .. The SV40 early polyadenylation signal sequence present in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with NotI and AflII (New England Biolabs, Ipswich, Massachusetts) and replaced by the SV40 late polyadenylation signal sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Those primers also inserted NdeI and XhoI cleavage sites at the 5′ and 3′ ends of the gene, respectively. .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The catalytically inactive variants of the ribozyme and of the selected twister-based riboswitches were prepared performing site direct mutagenesis by PCR using the suitable pET16b_eGFP containing the aptazyme active form as template. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: The standard PCR protocol included the primers p1 (5′-GTATACCATATGGGTGCCCGG-3′) and p2 (5′-CGGATCCTCAATCCATGGCAGC-3′). .. The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag. .. The resulting pET16b_His-Survivin plasmid was transformed into E. coli BL 21 CodonPlus RIPL (Agilent Technologies, Santa Clara, CA, USA) cells for heterologous protein expression.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Each PCR product was purified using the QIAquick PCR purification kit (Qiagen). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: Escherichia coli JM109 and BL21-CodonPlus(DE3) RIL competent cells and the PicoMaxx high-fidelity PCR system were purchased from Stratagene (La Jolla, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Spectroscopy:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Gel Extraction:

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Plasmid Preparation:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG. .. A . vitis strain S4 (kindly provided by T. Burr, Cornell, NY) was grown on solid 523 medium [ ] at room temperature for 48 hours.

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs). .. The gRNA-expression vector pUC57-gRNA was described previously ( ). gRNA sequences (Table S1 in File S1 ) were synthesized as two complementary oligonucleotides, annealed, and inserted into the pUC57-gRNA plasmid after Bbs I digestion.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence. .. The SV40 early polyadenylation signal sequence present in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with NotI and AflII (New England Biolabs, Ipswich, Massachusetts) and replaced by the SV40 late polyadenylation signal sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Those primers also inserted NdeI and XhoI cleavage sites at the 5′ and 3′ ends of the gene, respectively. .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: All constructs contained an N-terminal His6 tag encoded in the pET28a plasmid (Novagen). .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: Paragraph title: Expression systems and plasmid construction ... The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: GST was cloned out of the pGEX-6P-1 vector. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Paragraph title: Plasmid construction ... For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Each PCR product was purified using the QIAquick PCR purification kit (Qiagen). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. Digested vector and amplicons were ligated and electroporated into E. coli DH5α.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pET-28a vector and the pET-46b EK/LIC cloning kit were obtained from Novagen (San Diego, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc1 constructs were cloned using the NcoI and NotI sites of a pACYC-DUET vector for co-expression with Scc3, or into vectors containing the cognate Smc head domain in their second ORF for Smc/kleisin complexes (see below). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Positron Emission Tomography:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB). .. The gel-purified PCR band and the linearized vector were ligated (Quick Ligation Kit, NEB) and transformed into E. coli DH5α cells.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pET-28a vector and the pET-46b EK/LIC cloning kit were obtained from Novagen (San Diego, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Agarose Gel Electrophoresis:

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Those primers also inserted NdeI and XhoI cleavage sites at the 5′ and 3′ ends of the gene, respectively. .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Transgenic Assay:

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The vectors pXOP-SCFP3A-N1, pXOP-SYFP2-N1, and pXOP-SYFP2-SCFP3A were constructed for use in the generation of transgenic Xenopus laevis . .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Ethanol Precipitation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Nuclear Magnetic Resonance:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Produced:

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc1 constructs were cloned using the NcoI and NotI sites of a pACYC-DUET vector for co-expression with Scc3, or into vectors containing the cognate Smc head domain in their second ORF for Smc/kleisin complexes (see below). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB). .. Pds5 and Wapl were cloned and expressed as described previously ( ).

    Concentration Assay:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. E. coli BL21(DE3) harboring the endolysin vector was grown in 600 mL Luria Broth (LB) supplemented with 50 µg/mL kanamycin to an optical density (OD600 nm ) of 0.6 (4 h, 120 rpm at 37°C).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. After isolation of plasmids containing the correct size inserts, the inserts were sequenced to confirm the correct sequences were present coding for the wild-type REase.

    DNA Purification:

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Genomic DNA was purified from mid-log-phase cultures using the Wizard DNA Purification kit (Promega, Madison, WI). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Lysis:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. Recombinant protein expression was induced for 18 h at 16°C by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ndei
    Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and <t>Nt.BsmAI</t> and <t>NdeI</t> represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.
    Ndei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 290 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ndei/product/New England Biolabs
    Average 99 stars, based on 290 article reviews
    Price from $9.99 to $1999.99
    ndei - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.

    Journal: Nucleic Acids Research

    Article Title: Structure-based functional identification of Helicobacter pylori HP0268 as a nuclease with both DNA nicking and RNase activities

    doi: 10.1093/nar/gkv348

    Figure Lengend Snippet: Nicking endonuclease activity of HP0268. (A) The nicking endonuclease activity at various protein concentrations (1, 2, 4 and 8 μM) after incubation at 37ºC for 30 min. OC, RC and linear are abbreviations for the nicked open-circular, relaxed circular and linear DNA, respectively. (B) The pH dependence of the DNA nicking activity. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min under various pH conditions (pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5). (C) Effect of metal ions on the DNA nicking activity of HP0268. The substrate plasmid DNA was incubated with 4 μM HP0268 at 37ºC for 30 min in the presence and absence of 1 mM metal ion (Ca 2+ , Co 2+ , Ni 2+ , Fe 3+ , Mn 2+ , Mg 2+ and Cu 2+ ). Increasing concentrations (0.2, 0.4 and 1 μM) of Mn 2+ ion were used. Excess EDTA was used to remove the residual metal ions during the protein preparation. (D) The percentages of the resulting DNA conformations were plotted with regard to metal ion used. Cont. represents the substrate plasmid pET-21a(+) without HP0268, and Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. Commonly, 10 units of control enzyme were used in a final volume of 30 μl.

    Article Snippet: The commercial enzymes Nt.BsmAI and NdeI (NEB, Inc.) were used as references to validate the DNA nicking and double-cutting activity of HP0268, respectively.

    Techniques: Activity Assay, Incubation, Plasmid Preparation, Positron Emission Tomography

    Nuclease activity of HP0268 mutants. (A) Nicking endonuclease assay of wild-type and mutant HP0268 using gel electrophoresis. The substrate plasmid DNA was incubated with the wild-type and mutants (2 μM) at 37ºC for 30 min. Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. (B) Graph of the nicking endonuclease activities of wild-type and mutant HP0268. The DNA nicking activities of the mutants are normalized by that of the wild-type. (C) Fluorometric ribonuclease activities of wild-type and mutant HP0268. The protein concentrations were maintained at 6 μM. The fluorescence spectra are shown in a color-coded mode. In every figure, Cont. and WT indicate the reference condition of having only a buffer and the wild-type protein, respectively. The reaction buffer consisted of 20 mM Tris (pH 8.0) and 150 mM NaCl.

    Journal: Nucleic Acids Research

    Article Title: Structure-based functional identification of Helicobacter pylori HP0268 as a nuclease with both DNA nicking and RNase activities

    doi: 10.1093/nar/gkv348

    Figure Lengend Snippet: Nuclease activity of HP0268 mutants. (A) Nicking endonuclease assay of wild-type and mutant HP0268 using gel electrophoresis. The substrate plasmid DNA was incubated with the wild-type and mutants (2 μM) at 37ºC for 30 min. Nt.BsmAI and NdeI represent the positive controls for the nicked and linear DNA, respectively. (B) Graph of the nicking endonuclease activities of wild-type and mutant HP0268. The DNA nicking activities of the mutants are normalized by that of the wild-type. (C) Fluorometric ribonuclease activities of wild-type and mutant HP0268. The protein concentrations were maintained at 6 μM. The fluorescence spectra are shown in a color-coded mode. In every figure, Cont. and WT indicate the reference condition of having only a buffer and the wild-type protein, respectively. The reaction buffer consisted of 20 mM Tris (pH 8.0) and 150 mM NaCl.

    Article Snippet: The commercial enzymes Nt.BsmAI and NdeI (NEB, Inc.) were used as references to validate the DNA nicking and double-cutting activity of HP0268, respectively.

    Techniques: Activity Assay, Mutagenesis, Nucleic Acid Electrophoresis, Plasmid Preparation, Incubation, Fluorescence

    Various substrates used for studying CcrM processivity. ( A ) Substrate used by Berdis et al. ( 14 ) to study CcrM processivity, referred to as N 6 60/66-mer. Two GANTC target sites are present, hemimethylated on the upper strand. HindII target sites (GTYRAC) coupled to CcrM target sites were used to screen for methylation on the lower strand. However, only one of the two HindII sites is present, making it impossible to probe the methylation state of the second site. ( B ) The distribution of GANTC sequences (shown as HinfI target sequences) throughout the pUC19 plasmid. The position of each sequence is indicated relative to the plasmid's replication origin. The vector contains a single NdeI target site, which was used in conjunction with HinfI for vector linearization, to facilitate viewing of the progression toward fully methylated state. ( C ) 129-mer substrate containing two CcrM target sites. The expected size of the fragments obtained after HinfI digestion of completely unmethylated, partially methylated and fully methylated substrates are indicated. ( D ) 129-mer_HM substrate used to probe CcrM activity over hemimethylated GANTC sites. A M.TaqI methylation site (TCGA), as well as a HincII restriction site (GTYRAC) were linked to the GANTC site. M.TaqI-established methylation occurs as shown earlier, creating two GANTC sites hemimethylated on the lower strand. CcrM-catalyzed methylation of the upper strand was probed through protection from HincII digestion, which is blocked by hemimethylation.

    Journal: Nucleic Acids Research

    Article Title: The Caulobacter crescentus DNA-(adenine-N6)-methyltransferase CcrM methylates DNA in a distributive manner

    doi: 10.1093/nar/gkr768

    Figure Lengend Snippet: Various substrates used for studying CcrM processivity. ( A ) Substrate used by Berdis et al. ( 14 ) to study CcrM processivity, referred to as N 6 60/66-mer. Two GANTC target sites are present, hemimethylated on the upper strand. HindII target sites (GTYRAC) coupled to CcrM target sites were used to screen for methylation on the lower strand. However, only one of the two HindII sites is present, making it impossible to probe the methylation state of the second site. ( B ) The distribution of GANTC sequences (shown as HinfI target sequences) throughout the pUC19 plasmid. The position of each sequence is indicated relative to the plasmid's replication origin. The vector contains a single NdeI target site, which was used in conjunction with HinfI for vector linearization, to facilitate viewing of the progression toward fully methylated state. ( C ) 129-mer substrate containing two CcrM target sites. The expected size of the fragments obtained after HinfI digestion of completely unmethylated, partially methylated and fully methylated substrates are indicated. ( D ) 129-mer_HM substrate used to probe CcrM activity over hemimethylated GANTC sites. A M.TaqI methylation site (TCGA), as well as a HincII restriction site (GTYRAC) were linked to the GANTC site. M.TaqI-established methylation occurs as shown earlier, creating two GANTC sites hemimethylated on the lower strand. CcrM-catalyzed methylation of the upper strand was probed through protection from HincII digestion, which is blocked by hemimethylation.

    Article Snippet: To assess the methylation state of the pUC19 vector, a double digestion was carried out using HinfI and NdeI (New England Biolabs), the latter being used for linearization of the vector.

    Techniques: Methylation, Plasmid Preparation, Sequencing, Activity Assay

    CcrM processivity assayed using pUC19 ( Figure 1 B) as substrate. A double digestion with HinfI and NdeI was performed to assess the methylation state of the plasmid. pUC19 plasmid linearized by NdeI digestion was used as a control (lane marked C). A large number of incompletely methylated intermediates are formed throughout the duration of the experiment, supporting the conclusion that CcrM is a distributive, rather than a processive methyltransferase. The marker lane (lane marked M) contains the GeneRuler molecular weight marker, provided by Fermentas. The sizes of the major bands are indicated on the left.

    Journal: Nucleic Acids Research

    Article Title: The Caulobacter crescentus DNA-(adenine-N6)-methyltransferase CcrM methylates DNA in a distributive manner

    doi: 10.1093/nar/gkr768

    Figure Lengend Snippet: CcrM processivity assayed using pUC19 ( Figure 1 B) as substrate. A double digestion with HinfI and NdeI was performed to assess the methylation state of the plasmid. pUC19 plasmid linearized by NdeI digestion was used as a control (lane marked C). A large number of incompletely methylated intermediates are formed throughout the duration of the experiment, supporting the conclusion that CcrM is a distributive, rather than a processive methyltransferase. The marker lane (lane marked M) contains the GeneRuler molecular weight marker, provided by Fermentas. The sizes of the major bands are indicated on the left.

    Article Snippet: To assess the methylation state of the pUC19 vector, a double digestion was carried out using HinfI and NdeI (New England Biolabs), the latter being used for linearization of the vector.

    Techniques: Methylation, Plasmid Preparation, Marker, Molecular Weight