Structured Review

PEQLAB gold nanorod characterization
( A ) A gold <t>nanorod</t> (AuNR) coated with an adsorbed CTAB (Molecule 1) bilayer is functionalized with MUTAB (Molecule 2) to create a monolayer of cationic ligands covalently bound to the nanorod surface via gold-thiol bonds (top row). Alternatively, MUTAB was complemented with a rhodamine-PEG-thiol derivative (RH-PEG-SH, n = 77, Molecule 3) as a fluorescent label. Negative-stained TEM images of ( B ) CTAB-coated and ( C ) MUTAB-functionalized AuNRs.
Gold Nanorod Characterization, supplied by PEQLAB, used in various techniques. Bioz Stars score: 84/100, based on 603 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gold nanorod characterization/product/PEQLAB
Average 84 stars, based on 603 article reviews
Price from $9.99 to $1999.99
gold nanorod characterization - by Bioz Stars, 2020-07
84/100 stars

Images

1) Product Images from "Polycationic gold nanorods as multipurpose in vitro microtubule markers"

Article Title: Polycationic gold nanorods as multipurpose in vitro microtubule markers

Journal: bioRxiv

doi: 10.1101/2020.04.25.061127

( A ) A gold nanorod (AuNR) coated with an adsorbed CTAB (Molecule 1) bilayer is functionalized with MUTAB (Molecule 2) to create a monolayer of cationic ligands covalently bound to the nanorod surface via gold-thiol bonds (top row). Alternatively, MUTAB was complemented with a rhodamine-PEG-thiol derivative (RH-PEG-SH, n = 77, Molecule 3) as a fluorescent label. Negative-stained TEM images of ( B ) CTAB-coated and ( C ) MUTAB-functionalized AuNRs.
Figure Legend Snippet: ( A ) A gold nanorod (AuNR) coated with an adsorbed CTAB (Molecule 1) bilayer is functionalized with MUTAB (Molecule 2) to create a monolayer of cationic ligands covalently bound to the nanorod surface via gold-thiol bonds (top row). Alternatively, MUTAB was complemented with a rhodamine-PEG-thiol derivative (RH-PEG-SH, n = 77, Molecule 3) as a fluorescent label. Negative-stained TEM images of ( B ) CTAB-coated and ( C ) MUTAB-functionalized AuNRs.

Techniques Used: Staining, Transmission Electron Microscopy

2) Product Images from "Comparative analyses of the major royal jelly protein gene cluster in three Apis species with long amplicon sequencing"

Article Title: Comparative analyses of the major royal jelly protein gene cluster in three Apis species with long amplicon sequencing

Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

doi: 10.1093/dnares/dsw064

Schematic organization of the major royal jelly protein gene cluster across three species of the genus Apis. To emphasize the structural organization of mrjps , exons are illustrated in black. Grey arrows refer to putative mrjps based on draft genome sequences. Black destructed arrows illustrate pseudogenized genes. Location of the respective amplicons (adAmp 1–7; afAmp 1–6; amAmp 1–6) within the cluster is also illustrated; with dashed lines referring to fragments deviating from expected product sizes. ad, A. dorsata ; am, A. mellifera ; af, A. florea . Gene names are the corrected ones after the phylogenetic analysis.
Figure Legend Snippet: Schematic organization of the major royal jelly protein gene cluster across three species of the genus Apis. To emphasize the structural organization of mrjps , exons are illustrated in black. Grey arrows refer to putative mrjps based on draft genome sequences. Black destructed arrows illustrate pseudogenized genes. Location of the respective amplicons (adAmp 1–7; afAmp 1–6; amAmp 1–6) within the cluster is also illustrated; with dashed lines referring to fragments deviating from expected product sizes. ad, A. dorsata ; am, A. mellifera ; af, A. florea . Gene names are the corrected ones after the phylogenetic analysis.

Techniques Used:

3) Product Images from "Polycationic gold nanorods as multipurpose in vitro microtubule markers"

Article Title: Polycationic gold nanorods as multipurpose in vitro microtubule markers

Journal: bioRxiv

doi: 10.1101/2020.04.25.061127

( A ) AuNRs for plasmonic excitation and photoluminescence emission (magenta). AuNRs were only coated with MUTAB (blue, positively charged) interacting with a microtubule (MT, red, negatively charged) attached to an APTES (dark cyan, positively charged) coated surface (gray). ( B ) IRM, ( C ) TIRF, and ( D ) IRM-pseudocolor–TIRF overlay image of AuNRs bound to a single microtubule (green/cyan indicating different microtubule-surface distances, see Materials and Methods for details on the pseudocolor overlay). Note that no fluorophores were present and that AuNR markers did not blink or bleach.
Figure Legend Snippet: ( A ) AuNRs for plasmonic excitation and photoluminescence emission (magenta). AuNRs were only coated with MUTAB (blue, positively charged) interacting with a microtubule (MT, red, negatively charged) attached to an APTES (dark cyan, positively charged) coated surface (gray). ( B ) IRM, ( C ) TIRF, and ( D ) IRM-pseudocolor–TIRF overlay image of AuNRs bound to a single microtubule (green/cyan indicating different microtubule-surface distances, see Materials and Methods for details on the pseudocolor overlay). Note that no fluorophores were present and that AuNR markers did not blink or bleach.

Techniques Used:

4) Product Images from "MicroRNA Profiling during Cardiomyocyte-Specific Differentiation of Murine Embryonic Stem Cells Based on Two Different miRNA Array Platforms"

Article Title: MicroRNA Profiling during Cardiomyocyte-Specific Differentiation of Murine Embryonic Stem Cells Based on Two Different miRNA Array Platforms

Journal: PLoS ONE

doi: 10.1371/journal.pone.0025809

Embryonic marker genes are down regulated at day 12 of cardiomyocyte-specific differentiation. mRNA levels were measured at indicated timepoints using RT-qPCR. Relative gene expression of ES cell markers Klf4, Pou5F and Sox2 normalized to the expression of the reference gene GAPDH is shown. The results are expressed as fold change over day 0 values (undifferentiated ES cells). The y-axis represents log 2 fold change relative to day 0.
Figure Legend Snippet: Embryonic marker genes are down regulated at day 12 of cardiomyocyte-specific differentiation. mRNA levels were measured at indicated timepoints using RT-qPCR. Relative gene expression of ES cell markers Klf4, Pou5F and Sox2 normalized to the expression of the reference gene GAPDH is shown. The results are expressed as fold change over day 0 values (undifferentiated ES cells). The y-axis represents log 2 fold change relative to day 0.

Techniques Used: Marker, Quantitative RT-PCR, Expressing

5) Product Images from "Polycationic gold nanorods as multipurpose in vitro microtubule markers"

Article Title: Polycationic gold nanorods as multipurpose in vitro microtubule markers

Journal: bioRxiv

doi: 10.1101/2020.04.25.061127

( A ) AuNRs for plasmonic excitation and photoluminescence emission (magenta). AuNRs were only coated with MUTAB (blue, positively charged) interacting with a microtubule (MT, red, negatively charged) attached to an APTES (dark cyan, positively charged) coated surface (gray). ( B ) IRM, ( C ) TIRF, and ( D ) IRM-pseudocolor–TIRF overlay image of AuNRs bound to a single microtubule (green/cyan indicating different microtubule-surface distances, see Materials and Methods for details on the pseudocolor overlay). Note that no fluorophores were present and that AuNR markers did not blink or bleach.
Figure Legend Snippet: ( A ) AuNRs for plasmonic excitation and photoluminescence emission (magenta). AuNRs were only coated with MUTAB (blue, positively charged) interacting with a microtubule (MT, red, negatively charged) attached to an APTES (dark cyan, positively charged) coated surface (gray). ( B ) IRM, ( C ) TIRF, and ( D ) IRM-pseudocolor–TIRF overlay image of AuNRs bound to a single microtubule (green/cyan indicating different microtubule-surface distances, see Materials and Methods for details on the pseudocolor overlay). Note that no fluorophores were present and that AuNR markers did not blink or bleach.

Techniques Used:

Related Articles

RNA Extraction:

Article Title: Adenomatous Polyposis Coli and Hypoxia-inducible Factor-1? Have an Antagonistic Connection
Article Snippet: .. RNA, cDNA, and Quantitative (q)PCR Total RNA was extracted using Invisorb spin cell RNA (Invitek, Hayward, CA) or PeqLab Gold RNA extraction kit, according to the manufacturer's directions. .. RNA was converted to cDNA using Quantitect reverse transcription kit (QIAGEN).

Isolation:

Article Title: Type I Interferon Production Induced by Streptococcus pyogenes-Derived Nucleic Acids Is Required for Host Protection
Article Snippet: .. Isolation of DNA and RNA from mammalian cells For isolation of DNA, RAW 267.4 cells were lysed in direct PCR tail lysis buffer (Peqlab) at 55°C over night. .. DNA was then isolated using Phenol:Chloroform:Isoamylalcohol (Sigma-Aldrich).

Article Title: An Upstream Open Reading Frame Regulates LST1 Expression during Monocyte Differentiation
Article Snippet: .. RT-PCR and qPCR procedures U-937 and THP-1 cells were either treated with 80 nM TPA (12-O-Tetradecanoylphorbol-13-Acetate, from CellSignaling) or medium for 72 h. RNA was isolated using the Trifast reagent (Peqlab) and tested for integrity on agarose gels. cDNA synthesis was performed using M-MuLV Reverse Transcriptase (New England Biolabs) and an oligo-dT primer. .. LST1 transcripts containing either the exon 1B or 1C sequence were detected via PCR using the following primers: 5-LST1B ( TGGCCAGTTTGGAGTCTGTC ), 5-LST1C ( GAAGCAGCTCTCCACACCAG ) and 3-LST1-Ex2 ( TAGGCGAAATGATCAGGGGC ).

Article Title: Polymerase Read-Through at the First Transcription Termination Site Contributes to Regulation of Borna Disease Virus Gene Expression ▿
Article Snippet: .. RNA was isolated from infected Vero cells or from infected brain material with peqGOLD TriFast (PeqLab Biotechnologie, Erlangen, Germany) as recommended by the manufacturer. .. Northern blot analysis using 5-μg samples of total RNA was performed as described previously ( ).

Article Title: An RpoHI-Dependent Response Promotes Outgrowth after Extended Stationary Phase in the Alphaproteobacterium Rhodobacter sphaeroides
Article Snippet: .. For quantitative real-time RT-PCR, RNA was isolated using the peqGOLD TriFast kit (Peqlab), as described by the manufacturer. .. After DNA digestion, RNA was purified using a mixture of phenol-chloroform–isoamyl alcohol and chloroform-isoamyl alcohol (for RT-PCR) or RNeasy MinElute spin columns (Qiagen) (for microarray and RNA-seq).

Infection:

Article Title: Polymerase Read-Through at the First Transcription Termination Site Contributes to Regulation of Borna Disease Virus Gene Expression ▿
Article Snippet: .. RNA was isolated from infected Vero cells or from infected brain material with peqGOLD TriFast (PeqLab Biotechnologie, Erlangen, Germany) as recommended by the manufacturer. .. Northern blot analysis using 5-μg samples of total RNA was performed as described previously ( ).

Real-time Polymerase Chain Reaction:

Article Title: An Upstream Open Reading Frame Regulates LST1 Expression during Monocyte Differentiation
Article Snippet: .. RT-PCR and qPCR procedures U-937 and THP-1 cells were either treated with 80 nM TPA (12-O-Tetradecanoylphorbol-13-Acetate, from CellSignaling) or medium for 72 h. RNA was isolated using the Trifast reagent (Peqlab) and tested for integrity on agarose gels. cDNA synthesis was performed using M-MuLV Reverse Transcriptase (New England Biolabs) and an oligo-dT primer. .. LST1 transcripts containing either the exon 1B or 1C sequence were detected via PCR using the following primers: 5-LST1B ( TGGCCAGTTTGGAGTCTGTC ), 5-LST1C ( GAAGCAGCTCTCCACACCAG ) and 3-LST1-Ex2 ( TAGGCGAAATGATCAGGGGC ).

Polymerase Chain Reaction:

Article Title: Type I Interferon Production Induced by Streptococcus pyogenes-Derived Nucleic Acids Is Required for Host Protection
Article Snippet: .. Isolation of DNA and RNA from mammalian cells For isolation of DNA, RAW 267.4 cells were lysed in direct PCR tail lysis buffer (Peqlab) at 55°C over night. .. DNA was then isolated using Phenol:Chloroform:Isoamylalcohol (Sigma-Aldrich).

other:

Article Title: Polycationic gold nanorods as multipurpose in vitro microtubule markers
Article Snippet: Gold nanorod characterization To determine the longitudinal plasmonic resonance, size, and surface potential of AuNRs, we used a Peqlab (Erlangen, Germany) Nanodrop ND-1000 spectrofluorometer (UV/Vis function) and a Malvern (Worcestershire, United Kingdom) Zetasizer Nano ZS for dynamic light scattering and zeta potential measurements.

Quantitative RT-PCR:

Article Title: An RpoHI-Dependent Response Promotes Outgrowth after Extended Stationary Phase in the Alphaproteobacterium Rhodobacter sphaeroides
Article Snippet: .. For quantitative real-time RT-PCR, RNA was isolated using the peqGOLD TriFast kit (Peqlab), as described by the manufacturer. .. After DNA digestion, RNA was purified using a mixture of phenol-chloroform–isoamyl alcohol and chloroform-isoamyl alcohol (for RT-PCR) or RNeasy MinElute spin columns (Qiagen) (for microarray and RNA-seq).

Western Blot:

Article Title: KDM2 Family Members are Regulated by HIF-1 in Hypoxia
Article Snippet: .. SDS-PAGE and immunoblots were carried out using standard protocols. mRNA analysis: RNA was extracted using peqGOLD total RNA kit (Peqlab, Erlangen, Germany) or Direct-Zol RNA kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions, and reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). .. For quantitative PCR, Brilliant II Sybr Green kit (Statagene/Agilent, Santa Clara, CA, USA), including specific MX3005P 96-well semi-skirted plates, were used to analyse samples on the MX3005P qPCR platform (Stratagene/Agilent).

Reverse Transcription Polymerase Chain Reaction:

Article Title: An Upstream Open Reading Frame Regulates LST1 Expression during Monocyte Differentiation
Article Snippet: .. RT-PCR and qPCR procedures U-937 and THP-1 cells were either treated with 80 nM TPA (12-O-Tetradecanoylphorbol-13-Acetate, from CellSignaling) or medium for 72 h. RNA was isolated using the Trifast reagent (Peqlab) and tested for integrity on agarose gels. cDNA synthesis was performed using M-MuLV Reverse Transcriptase (New England Biolabs) and an oligo-dT primer. .. LST1 transcripts containing either the exon 1B or 1C sequence were detected via PCR using the following primers: 5-LST1B ( TGGCCAGTTTGGAGTCTGTC ), 5-LST1C ( GAAGCAGCTCTCCACACCAG ) and 3-LST1-Ex2 ( TAGGCGAAATGATCAGGGGC ).

Lysis:

Article Title: Type I Interferon Production Induced by Streptococcus pyogenes-Derived Nucleic Acids Is Required for Host Protection
Article Snippet: .. Isolation of DNA and RNA from mammalian cells For isolation of DNA, RAW 267.4 cells were lysed in direct PCR tail lysis buffer (Peqlab) at 55°C over night. .. DNA was then isolated using Phenol:Chloroform:Isoamylalcohol (Sigma-Aldrich).

SDS Page:

Article Title: KDM2 Family Members are Regulated by HIF-1 in Hypoxia
Article Snippet: .. SDS-PAGE and immunoblots were carried out using standard protocols. mRNA analysis: RNA was extracted using peqGOLD total RNA kit (Peqlab, Erlangen, Germany) or Direct-Zol RNA kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions, and reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). .. For quantitative PCR, Brilliant II Sybr Green kit (Statagene/Agilent, Santa Clara, CA, USA), including specific MX3005P 96-well semi-skirted plates, were used to analyse samples on the MX3005P qPCR platform (Stratagene/Agilent).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    PEQLAB nanodrop nd 1000 system
    Nanodrop Nd 1000 System, supplied by PEQLAB, used in various techniques. Bioz Stars score: 89/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nanodrop nd 1000 system/product/PEQLAB
    Average 89 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    nanodrop nd 1000 system - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    94
    PEQLAB nanodrop nd 1000 spectrophotometer
    Nanodrop Nd 1000 Spectrophotometer, supplied by PEQLAB, used in various techniques. Bioz Stars score: 94/100, based on 324 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nanodrop nd 1000 spectrophotometer/product/PEQLAB
    Average 94 stars, based on 324 article reviews
    Price from $9.99 to $1999.99
    nanodrop nd 1000 spectrophotometer - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results