Structured Review

Toyobo ncoi
Ncoi, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ncoi/product/Toyobo
Average 92 stars, based on 4 article reviews
Price from $9.99 to $1999.99
ncoi - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Plasmid Preparation:

Article Title: Vibrio parahaemolyticus Chromosomal qnr Homologue VPA0095: Demonstration by Transformation with a Mutated Gene of Its Potential To Reduce Quinolone Susceptibility in Escherichia coli
Article Snippet: .. It was next ligated into a plasmid vector, pTV118N (pUC118 derivative; Takara Bio Inc.), which was previously treated with NcoI, KOD DNA polymerase (TOYOBO, Osaka, Japan) for blunting, and then SalI, followed by introduction into E. coli strain MC1061 ( ). ..

Construct:

Article Title: Co-blockade of mecR1/blaR1 signal pathway to restore antibiotic susceptibility in clinical isolates of methicillin-resistant Staphylococcus aureus
Article Snippet: .. The two constructed plasmids were linearized by NcoI (Toyobo, Japan). .. The RiboMAX large scale production system (Promega, Madison, WI, USA) was used for the transcription under the guide of the manufacturer’s instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • ncoi  (Toyobo)
    92
    Toyobo ncoi
    Ncoi, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncoi/product/Toyobo
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ncoi - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    93
    Toyobo asb2tpr ncoi gggccatggtttgcaaactgcaaacag
    Asb2tpr Ncoi Gggccatggtttgcaaactgcaaacag, supplied by Toyobo, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/asb2tpr ncoi gggccatggtttgcaaactgcaaacag/product/Toyobo
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    asb2tpr ncoi gggccatggtttgcaaactgcaaacag - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results