ncoi  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    Nco I
    Description:

    Catalog Number:
    ncoi-ro
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore ncoi
    Domain architecture of <t>Rdh54</t> and rdh54 truncation mutants. A , schematic overview depicting the conserved regions of Rdh54, a 924-amino acid DNA translocase with a Rad51-binding domain of ∼100 amino acid ( aa ). The boxed regions represent the seven helicase-like Swi2/Snf2 motifs in Rdh54. The N-terminal truncations of Rdh54 used in this study are represented below. B , domain architecture of the Rad54-Rdh54 hybrid construct. The arrow represents an <t>NcoI</t> site used to fuse the Rad54 N-terminal domain with the C terminus of Rdh54.

    https://www.bioz.com/result/ncoi/product/Millipore
    Average 96 stars, based on 208 article reviews
    Price from $9.99 to $1999.99
    ncoi - by Bioz Stars, 2020-07
    96/100 stars

    Images

    1) Product Images from "Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54"

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.480475

    Domain architecture of Rdh54 and rdh54 truncation mutants. A , schematic overview depicting the conserved regions of Rdh54, a 924-amino acid DNA translocase with a Rad51-binding domain of ∼100 amino acid ( aa ). The boxed regions represent the seven helicase-like Swi2/Snf2 motifs in Rdh54. The N-terminal truncations of Rdh54 used in this study are represented below. B , domain architecture of the Rad54-Rdh54 hybrid construct. The arrow represents an NcoI site used to fuse the Rad54 N-terminal domain with the C terminus of Rdh54.
    Figure Legend Snippet: Domain architecture of Rdh54 and rdh54 truncation mutants. A , schematic overview depicting the conserved regions of Rdh54, a 924-amino acid DNA translocase with a Rad51-binding domain of ∼100 amino acid ( aa ). The boxed regions represent the seven helicase-like Swi2/Snf2 motifs in Rdh54. The N-terminal truncations of Rdh54 used in this study are represented below. B , domain architecture of the Rad54-Rdh54 hybrid construct. The arrow represents an NcoI site used to fuse the Rad54 N-terminal domain with the C terminus of Rdh54.

    Techniques Used: Binding Assay, Construct

    2) Product Images from "A fully automated procedure for the parallel, multidimensional purification and nucleotide loading of the human GTPases KRas, Rac1 and RalB"

    Article Title: A fully automated procedure for the parallel, multidimensional purification and nucleotide loading of the human GTPases KRas, Rac1 and RalB

    Journal: Protein Expression and Purification

    doi: 10.1016/j.pep.2017.01.010

    The pBDDP-SPR3 expression vector . (A) General structure of the recombinant protein produced from pBDDP-SPR3 showing two N-terminal His 8 tags separated by a 28 amino acid linker followed by a TEV cleavage site. (B) The sequence and features of the pBDDP-SPR3 tag and multiple cloning site: This cassette was designed with flanking NcoI and XhoI sites to allow cloning into pET28a. This resulted in the removal of the entire pET28a tag and MCS region and replacement with the BDDP-SPR3 insert.
    Figure Legend Snippet: The pBDDP-SPR3 expression vector . (A) General structure of the recombinant protein produced from pBDDP-SPR3 showing two N-terminal His 8 tags separated by a 28 amino acid linker followed by a TEV cleavage site. (B) The sequence and features of the pBDDP-SPR3 tag and multiple cloning site: This cassette was designed with flanking NcoI and XhoI sites to allow cloning into pET28a. This resulted in the removal of the entire pET28a tag and MCS region and replacement with the BDDP-SPR3 insert.

    Techniques Used: Expressing, Plasmid Preparation, Recombinant, Produced, Sequencing, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: A fully automated procedure for the parallel, multidimensional purification and nucleotide loading of the human GTPases KRas, Rac1 and RalB
    Article Snippet: .. The cassette sequence, including a bespoke multiple cloning site, was gene synthesized (Genewiz Inc) and cloned into the NcoI and XhoI sites of pET28a (Novagen) ( b) to create pBDDP-SPR3. .. Three cDNAs encoding the G-domains of human KRas 4B (1–169), Rac1 (2–177) and RalB (12–186) were synthesized with codon optimisation for E. coli expression and each cloned to the BamHI and XhoI sites of pBDDP-SPR3 to generate three expression constructs.

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Minimal requirements for inhibition of MraY by lysis protein E from bacteriophage ?X174
    Article Snippet: .. PCR product was digested with NcoI and XhoI and ligated into the multiple cloning site of pRSFDuet (Novagen) that was modified to introduce FLAG-tag at the C-terminus of the inserted gene. .. Mutants were generated by the Quickchange method (Qiagen).

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Article Title: Solution Structure of the Apo C-Terminal Domain of the Lethocerus F1 Troponin C Isoform
    Article Snippet: .. The product was cloned into the NcoI and NotI sites of a modified pET24d (M11) expression vector (Novagen) containing an N-terminal hexahistidine (His6 ) tag followed by a tobacco-etch-virus (TEV) protease cleavage site ( ). ..

    Article Title: Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan ▿
    Article Snippet: .. The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). .. The 5′ primer (TT CCATGG CAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 ( ) ( ) and create an in-frame fusion behind the affinity purification tags of pET 41.

    Amplification:

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Article Title: Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan ▿
    Article Snippet: .. The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). .. The 5′ primer (TT CCATGG CAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 ( ) ( ) and create an in-frame fusion behind the affinity purification tags of pET 41.

    Synthesized:

    Article Title: A fully automated procedure for the parallel, multidimensional purification and nucleotide loading of the human GTPases KRas, Rac1 and RalB
    Article Snippet: .. The cassette sequence, including a bespoke multiple cloning site, was gene synthesized (Genewiz Inc) and cloned into the NcoI and XhoI sites of pET28a (Novagen) ( b) to create pBDDP-SPR3. .. Three cDNAs encoding the G-domains of human KRas 4B (1–169), Rac1 (2–177) and RalB (12–186) were synthesized with codon optimisation for E. coli expression and each cloned to the BamHI and XhoI sites of pBDDP-SPR3 to generate three expression constructs.

    Sequencing:

    Article Title: A fully automated procedure for the parallel, multidimensional purification and nucleotide loading of the human GTPases KRas, Rac1 and RalB
    Article Snippet: .. The cassette sequence, including a bespoke multiple cloning site, was gene synthesized (Genewiz Inc) and cloned into the NcoI and XhoI sites of pET28a (Novagen) ( b) to create pBDDP-SPR3. .. Three cDNAs encoding the G-domains of human KRas 4B (1–169), Rac1 (2–177) and RalB (12–186) were synthesized with codon optimisation for E. coli expression and each cloned to the BamHI and XhoI sites of pBDDP-SPR3 to generate three expression constructs.

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Introduce:

    Article Title: Minimal requirements for inhibition of MraY by lysis protein E from bacteriophage ?X174
    Article Snippet: .. PCR product was digested with NcoI and XhoI and ligated into the multiple cloning site of pRSFDuet (Novagen) that was modified to introduce FLAG-tag at the C-terminus of the inserted gene. .. Mutants were generated by the Quickchange method (Qiagen).

    Protein Purification:

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Polymerase Chain Reaction:

    Article Title: SpyA is a membrane-bound ADP-ribosyltransferase of Streptococcus pyogenes which modifies a streptococcal peptide, SpyB
    Article Snippet: .. The PCR product was digested with NcoI and XhoI and ligated into NcoI/XhoI-digested pET21d (Novagen). .. The resulting plasmid, pETSpyBA contains spyA fused at the C-terminus with His6 .

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Minimal requirements for inhibition of MraY by lysis protein E from bacteriophage ?X174
    Article Snippet: .. PCR product was digested with NcoI and XhoI and ligated into the multiple cloning site of pRSFDuet (Novagen) that was modified to introduce FLAG-tag at the C-terminus of the inserted gene. .. Mutants were generated by the Quickchange method (Qiagen).

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Article Title: Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan ▿
    Article Snippet: .. The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). .. The 5′ primer (TT CCATGG CAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 ( ) ( ) and create an in-frame fusion behind the affinity purification tags of pET 41.

    Generated:

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Positron Emission Tomography:

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan ▿
    Article Snippet: .. The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). .. The 5′ primer (TT CCATGG CAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 ( ) ( ) and create an in-frame fusion behind the affinity purification tags of pET 41.

    Expressing:

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Article Title: Solution Structure of the Apo C-Terminal Domain of the Lethocerus F1 Troponin C Isoform
    Article Snippet: .. The product was cloned into the NcoI and NotI sites of a modified pET24d (M11) expression vector (Novagen) containing an N-terminal hexahistidine (His6 ) tag followed by a tobacco-etch-virus (TEV) protease cleavage site ( ). ..

    Article Title: Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan ▿
    Article Snippet: .. The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). .. The 5′ primer (TT CCATGG CAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 ( ) ( ) and create an in-frame fusion behind the affinity purification tags of pET 41.

    FLAG-tag:

    Article Title: Minimal requirements for inhibition of MraY by lysis protein E from bacteriophage ?X174
    Article Snippet: .. PCR product was digested with NcoI and XhoI and ligated into the multiple cloning site of pRSFDuet (Novagen) that was modified to introduce FLAG-tag at the C-terminus of the inserted gene. .. Mutants were generated by the Quickchange method (Qiagen).

    Modification:

    Article Title: Minimal requirements for inhibition of MraY by lysis protein E from bacteriophage ?X174
    Article Snippet: .. PCR product was digested with NcoI and XhoI and ligated into the multiple cloning site of pRSFDuet (Novagen) that was modified to introduce FLAG-tag at the C-terminus of the inserted gene. .. Mutants were generated by the Quickchange method (Qiagen).

    Article Title: Solution Structure of the Apo C-Terminal Domain of the Lethocerus F1 Troponin C Isoform
    Article Snippet: .. The product was cloned into the NcoI and NotI sites of a modified pET24d (M11) expression vector (Novagen) containing an N-terminal hexahistidine (His6 ) tag followed by a tobacco-etch-virus (TEV) protease cleavage site ( ). ..

    Transformation Assay:

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Plasmid Preparation:

    Article Title: Drosomycin, an Innate Immunity Peptide of Drosophila melanogaster, Interacts with the Fly Voltage-gated Sodium Channel *
    Article Snippet: .. Briefly, the sequence encoding the mature drosomycin was amplified via PCR from D. melanogaster genomic DNA and cloned into the NcoI and BamHI sites of a pET-32b expression vector derivative used for transformation of Escherichia coli strain Rosetta-gami (Novagen). .. The recombinant DRS, fused to thioredoxin and a His6 tag, was purified on a HisTrap® affinity column (GE Healthcare), and the tag and thioredoxin were cleaved with thrombin.

    Article Title: Characterization of the Interaction between the Saccharomyces cerevisiae Rad51 Recombinase and the DNA Translocase Rdh54
    Article Snippet: .. DNA plasmids for bacterial expression and protein purification were generated by PCR amplification and cloning of wild-type RDH54 , rdh54 truncation alleles, and RAD54-RDH54 hybrid sequence into the NcoI and XhoI sites of the pET32a vector (Novagen) to add thioredoxin and His6 tags to the N terminus of each protein. .. The DNA templates for these PCRs were plasmid pHK489 (full-length RDH54 with its endogenous promoter in vector pRS314) and plasmid pHK471 (the N-terminal 600 bp of RAD54 fused to C-terminal RDH54 with an NdeI linker in between and the endogenous RDH54 promoter into vector pRS414).

    Article Title: Solution Structure of the Apo C-Terminal Domain of the Lethocerus F1 Troponin C Isoform
    Article Snippet: .. The product was cloned into the NcoI and NotI sites of a modified pET24d (M11) expression vector (Novagen) containing an N-terminal hexahistidine (His6 ) tag followed by a tobacco-etch-virus (TEV) protease cleavage site ( ). ..

    Article Title: Characterization of XynC from Bacillus subtilis subsp. subtilis Strain 168 and Analysis of Its Role in Depolymerization of Glucuronoxylan ▿
    Article Snippet: .. The ynfF gene was amplified using the ProofStart DNA polymerase PCR kit (QIAGEN) for directional cloning into the NcoI and XhoI restriction sites (highlighted by underlined regions in primer sequences, respectively) of the pET 41 expression vector (EMD Biosciences). .. The 5′ primer (TT CCATGG CAGCAAGTGATGTAACAGTTAATG) was designed to truncate the XynC secretion signal sequence as predicted using SignalP 3.0 ( ) ( ) and create an in-frame fusion behind the affinity purification tags of pET 41.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Millipore ncoi xhoi sites
    Ncoi Xhoi Sites, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncoi xhoi sites/product/Millipore
    Average 88 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    ncoi xhoi sites - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    85
    Millipore ncoi bamhi digested ptriex 1 1 vector
    Ncoi Bamhi Digested Ptriex 1 1 Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncoi bamhi digested ptriex 1 1 vector/product/Millipore
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ncoi bamhi digested ptriex 1 1 vector - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    91
    Millipore restriction enzymes bsphi ncoi
    Restriction Enzymes Bsphi Ncoi, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes bsphi ncoi/product/Millipore
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes bsphi ncoi - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    88
    Millipore ncoi bamhi sites
    Ncoi Bamhi Sites, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncoi bamhi sites/product/Millipore
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ncoi bamhi sites - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results