binding protein 1 53bp1  (Bio-Techne corporation)

Journal: Cells

Article Title: CHRDL1 Regulates Stemness in Glioma Stem-like Cells

doi: 10.3390/cells11233917

Figure Lengend Snippet: CHRDL1-depletion radiosensitizes GSCs. ( A ) 53BP1 foci assay 24 h after irradiation of NCH644 shCtrl or NCH644 shCHRDL1 GSCs with the indicated doses. ( B ) Sphere formation of NCH644 shCtrl or shCHRDL1 cells 7 days after seeding of single cells and irradiation as indicated. ( C ) Representative microphotographs of NCH644 shCtrl or NCH644 shCRHDL1 without irradiation (0 Gy) or after irradiation with 6 Gy; scale bar: 200 µm. * p < 0.05; ** p < 0.01; **** p < 0.0001; two-way-ANOVA with Sidak’s multiple comparison tests. ( D ) Sphere formation of NCH644 treated with solvent or recombinant human BMP4 (25 ng/mL) immediately prior to irradiation with a dose of 4 or 6 Gy. Sphere area was determined 7 days after treatment. * p < 0.05; **** p < 0.0001; Kruskal—Wallis test with Dunn’s multiple comparisons test.

Article Snippet: The following primary and secondary antibodies were used: 53BP1 (NP-100-304, Bio-Techne GmbH, Wiesbaden, Germany), 1:1000; Alexa Fluor ® 488 F(ab’)2 fragment goat anti-rabbit IgG (H + L) (Thermo Fisher); 1:500.

Techniques: Irradiation, Comparison, Solvent, Recombinant

Journal: bioRxiv

Article Title: RNF168-mediated localization of BARD1 recruits the BRCA1-PALB2 complex to DNA damage

doi: 10.1101/2021.06.25.449923

Figure Lengend Snippet: (A) Cartoon showing RNF168-mediated and H2A-associated ubiquitin modifications, as well as the influence of 53BP1, BRCA1-A (ABRAXAS-RAP80) and -P (PALB2-BRCA2-RAD51) complexes on HR. (B) Brca1 +/CC , Rnf168 +/- mice were intercrossed and the numbers of expected and observed live births are shown. P value are obtained from chi-square goodness of fit tests for the binomial of each genotype. (C) Left ; representative photograph. Right ; weights of individual 4 to 6-month-old mice with the indicated genotypes, red bar - median. (D) Kaplan-Meier survival analysis of mice born with the indicated genotypes. (E) Brca1 +/+ , Brca1 +/CC , and Brca1 CC/CC MEFs with GFP (-) or Rnf168 (+) targeting sgRNA were subsequently incubated with increasing concentrations of the PARPi rucaparib and colony formation assessed. Mean and S.E.M. rucaparib IC50 values are shown for n=4 biological replicates. (F) Cells from E were subject to 10 Gy γ-irradiation (IR) and foci formation measured by immunofluorescence. Endogenous Brca1 and Rad51 foci, and ectopic HA-PALB2 foci formation was assessed using cell lines expressing HA-PALB2. Foci positive cells were determined to be ≥10 Brca1 and Palb2 foci/nuclei, or ≥5 Rad51 foci/nuclei. The mean and S.E.M. percentage foci positive cells are shown for n=3 biological replicates. See for representative images of cells. *** p < 0.001, ** p < 0.01, * p < 0.05, ns not significant (unpaired, two-tailed t-tests).

Article Snippet: The following primary antibodies were used: Brca1 (gift from A. Nussenzweig), BRCA1 (Millipore, 07-434), RAD51 (Genetex, GTX100469), RAD51 (Abcam, ab133534), HA (Covance, MMS-101R), BARD1 (Santa Cruz Biotechnology, sc-74559), 53BP1 (Novus Biologicals, NB100), 53BP1 (Millipore, MAB3802), RPA32 (Cell Signaling, 2208), RPA32 (Sigma-Aldrich, NA18), RAP80 (Bethyl Laboratories, A300-763A), FLAG (Sigma-Aldrich, F1804), FLAG (Cell Signaling, 14793), CtIP (Millipore, MABE1060).

Techniques: Ubiquitin Proteomics, Incubation, Irradiation, Immunofluorescence, Expressing, Two Tailed Test

Journal: bioRxiv

Article Title: RNF168-mediated localization of BARD1 recruits the BRCA1-PALB2 complex to DNA damage

doi: 10.1101/2021.06.25.449923

Figure Lengend Snippet: (A) Electropherogram showing Rnf168 wild-type (+/+) and mutant (-/-) alleles. The Rnf168 - allele has a deletion of CTGTCGTCGCCGGGTCTCTTCG and insertion A at c.165. (B) Cartoon showing the impact of the above Rnf168 - mutation on the Rnf168 protein. Rnf168 - generates an in-frame deletion of amino acids (aa) 55-62 plus an insertion of an L. (C) Rnf168 protein expression was assessed in Rnf168 +/+ and Rnf168 -/- MEFs using an antibody recognizing an epitope spanning aa 423-565. Despite the Rnf168 - allele generating an in-frame deletion no protein was detected by Western blotting, likely from protein destabilizing effects of the deletion mutation that is proximal to the Ring domain. (D) 53bp1 and Rpa32 IRIF were measured in Rnf168 +/+ and Rnf168 -/- derived MEFs. Left ; representative images (scale bar, 10 μm). Right ; mean and S.E M. percentage (≥10) foci positive cells, n=3 biological replicates. *** p < 0.001, ** p < 0.01, (unpaired, two-tailed t-tests). (E) Live embryos from Brca1 +/CC , Rnf168 +/- x Brca1 +/CC , Rnf168 +/- crosses were collected and genotyped at E12.5. The numbers of expected and observed live embryos is shown. P value are obtained from chi-square goodness of fit tests for the binomial of each genotype. (F) Mice with the indicated genotypes were recorded for the number born with tail kinks and white spots and expressed as a percentage of the number of mice evaluated for each of the indicated genotypes. Right ; photograph of representative mice. (G) Table describing age and available pathology at time of death associated with Brca1 +/CC , Rnf168 -/- mice. (H) The indicated organs and tissues were H&E stained and subject to pathological inspection. Images are shown from a representative healthy Brca1 +/+ , Rnf168 -/- mouse and Brca1 +/CC , Rnf168 -/- mouse with lymphoma detected in multiple organs (scale bars, 200 μm). CD3 immunohistochemical staining of the lymphocytic infiltration of the kidney (bottom right) indicates T-cell lymphoma.

Article Snippet: The following primary antibodies were used: Brca1 (gift from A. Nussenzweig), BRCA1 (Millipore, 07-434), RAD51 (Genetex, GTX100469), RAD51 (Abcam, ab133534), HA (Covance, MMS-101R), BARD1 (Santa Cruz Biotechnology, sc-74559), 53BP1 (Novus Biologicals, NB100), 53BP1 (Millipore, MAB3802), RPA32 (Cell Signaling, 2208), RPA32 (Sigma-Aldrich, NA18), RAP80 (Bethyl Laboratories, A300-763A), FLAG (Sigma-Aldrich, F1804), FLAG (Cell Signaling, 14793), CtIP (Millipore, MABE1060).

Techniques: Mutagenesis, Expressing, Western Blot, Derivative Assay, Two Tailed Test, Staining, Immunohistochemical staining

Journal: bioRxiv

Article Title: RNF168-mediated localization of BARD1 recruits the BRCA1-PALB2 complex to DNA damage

doi: 10.1101/2021.06.25.449923

Figure Lengend Snippet: (A) Brca1 +/+ , Brca1 +/CC , and Brca1 CC/CC MEFs were incubated with lentivirus expressing sgRNA targeting GFP (control) or Rnf168 and cells collected for Western blotting to confirm loss of Rnf168 expression. Below ; representative pictures of cells from (scale bar, 10 μm). 53bp1 IRIF were quantified as described in . (B) To confirm that differences in foci formation were not caused by significant changes in cell cycle distribution, cells from A were assessed for cell cycle fractions using propidium iodide (PI) staining and flow cytometry. (C) MEFs were subject to sgRNA targeting Rnf168, Rap80 or GFP (WT), clones established with frameshifting mutations and assessed for Brca1 and Rad51 IRIF. Above ; Electropherograms and frameshift mutations are shown for Rap80 -/- and Rnf168 -/- clones. Below ; representative pictures (scale bar, 10 μm) and mean and S.E.M. percentage BRCA1 (≥10) foci and RAD51 (≥5) foci positive cells. MEFs n=3 biological replicates. *** p < 0.001, * p < 0.05, ns not significant compared to WT MEFs (unpaired, two-tailed t-tests). (D) Left ; cartoon showing BRCA1 protein domains and truncations with aa numbers indicated. Below ; HA Western blot of MDA-MB-436 cells expressing BFP control, HA-BRCA1-full-length (FL), HA-BRCA1-ΔRING with aa start at M128 and M297. Right ; mean and S.E.M. percentage foci positive cells; foci positive cells were assessed for the number of foci present in a single nucleus, red line: median value; foci positive cells were also assessed for the mean size of foci present per nuclei, n=3 biological replicates. Foci positive cells were determined to be those with ≥10 foci/nuclei. *** p < 0.001, ** p < 0.01, * p < 0.05, ns not significant compared to FL (percentage positive cells: unpaired, two-tailed t-tests size; number and size per nucleus: nonparametric Mann-Whitney tests). Below ; representative images (scale bar, 10 μm).

Article Snippet: The following primary antibodies were used: Brca1 (gift from A. Nussenzweig), BRCA1 (Millipore, 07-434), RAD51 (Genetex, GTX100469), RAD51 (Abcam, ab133534), HA (Covance, MMS-101R), BARD1 (Santa Cruz Biotechnology, sc-74559), 53BP1 (Novus Biologicals, NB100), 53BP1 (Millipore, MAB3802), RPA32 (Cell Signaling, 2208), RPA32 (Sigma-Aldrich, NA18), RAP80 (Bethyl Laboratories, A300-763A), FLAG (Sigma-Aldrich, F1804), FLAG (Cell Signaling, 14793), CtIP (Millipore, MABE1060).

Techniques: Incubation, Expressing, Control, Western Blot, Staining, Flow Cytometry, Clone Assay, Two Tailed Test, MANN-WHITNEY

Journal: bioRxiv

Article Title: RNF168-mediated localization of BARD1 recruits the BRCA1-PALB2 complex to DNA damage

doi: 10.1101/2021.06.25.449923

Figure Lengend Snippet: (A) MCF7 BARD1 -/- cells expressing GFP-BARD1-WT, GFP-BARD1-ΔBRCT, or GFP-BARD1-BUDR (R705A+D712A+Q715R) were assessed for GFP and BRCA1 expression by Western blotting. (B) Representative foci images from (scale bars, 10 μm). (C) Electropherograms of RNF168 DNA sequences from MDA-MB-231 WT and RNF168 -/- cell lines are shown. The RNF168 -/- cell line contains two alleles with frameshifting deletions. Right ; Western blot showing loss of RNF168 expression. (D) Cells from C were assessed for 53BP1 IRIF. Representative images of cells are shown. Mean and S.E.M. percentage foci positive cells are shown from n=3 biological replicates. *** p < 0.001 (unpaired, two-tailed t-tests). (E) Cells from C were assessed for BRCA1 and geminin or RAD51 and geminin staining in the absence of pre-extraction by immunofluorescence. Representative images are shown. Mean and S.E.M. percentage foci positive cells as well as foci positive cells that were also geminin positive are shown from n=3 biological replicates. Geminin indicates S/G2 cell cycle fractions. *** p < 0.001, ** p < 0.01, * p < 0.05, ns not significant (unpaired, two-tailed t-tests). (F) RNF168 ectopic UBC promoter constructs were assessed for Flag mRNA and protein expression by qRT-PCR ( left ) and Western blotting ( right ), respectively. (G) Representative images from as well as Flag-RNF168 and 53BP1 IRIF analyses as described in . *** p < 0.001, ** p < 0.01, * p < 0.05, ns not significant compared to GFP expressing cells for all panels (unpaired, two-tailed t-tests). Scale bars, 10 μm for all panels.

Article Snippet: The following primary antibodies were used: Brca1 (gift from A. Nussenzweig), BRCA1 (Millipore, 07-434), RAD51 (Genetex, GTX100469), RAD51 (Abcam, ab133534), HA (Covance, MMS-101R), BARD1 (Santa Cruz Biotechnology, sc-74559), 53BP1 (Novus Biologicals, NB100), 53BP1 (Millipore, MAB3802), RPA32 (Cell Signaling, 2208), RPA32 (Sigma-Aldrich, NA18), RAP80 (Bethyl Laboratories, A300-763A), FLAG (Sigma-Aldrich, F1804), FLAG (Cell Signaling, 14793), CtIP (Millipore, MABE1060).

Techniques: Expressing, Western Blot, Two Tailed Test, Staining, Extraction, Immunofluorescence, Construct, Quantitative RT-PCR

Journal: bioRxiv

Article Title: RNF168-mediated localization of BARD1 recruits the BRCA1-PALB2 complex to DNA damage

doi: 10.1101/2021.06.25.449923

Figure Lengend Snippet: (A) MCF7 BARD1 -/- cells expressing GFP-BARD1-WT, GFP-BARD1-ΔBRCT, or GFP-BARD1-BUDR (R705A+D712A+Q715R) were assessed for BARD1 and BRCA1 foci size, number per nucleus, as well percentage foci positive cells post IR by immunofluorescence. See for representative images. Left ; mean and S.E.M. percentage foci positive cells; middle , foci positive cells were assessed for the number of foci present in a single nucleus, red line: median value; right , foci positive cells were assessed for the mean size of foci present per nuclei, n=3 biological replicates. Foci positive cells were determined to be those with ≥10 foci/nuclei. *** p < 0.001, ** p < 0.01, * p < 0.05, ns not significant compared to WT (percentage positive cells: unpaired, two-tailed t-tests size; number and size per nucleus: nonparametric Mann-Whitney tests). (B) Cells from A were assessed for RAD51 foci 8 hours post IR by immunofluorescence. Mean and S.E M. percentage (≥5) foci positive cells, n=3 biological replicates. ** p < 0.01 compared to WT (unpaired, two-tailed t-tests). See for representative images. (C) Cells from A were incubated with increasing concentrations of rucaparib for 2 weeks and colony formation assessed. Mean and S.E.M. colony formation as well as mean IC50 values, n=3 biological replicates. (D) Cartoon of RNF168 protein domains and mutations analyzed. Below ; expression of ectopic FLAG-RNF168 proteins by Western blotting in MDA-MB-231 RNF168 -/- cells. (E) Cells from D were assessed for BARD1 and BRCA1 foci as described in A with statistical comparisons to cells expressing GFP. See for representative images. (F) Cells from D were assessed for RAD51 IRIF as described in B with statistical comparisons to cells expressing GFP. See for representative images. (G) MDA-MB-436 cells with sgRNA targeting GFP or 53BP1 were infected with virus expressing HA-RING, HA-PALB2, or HA-RING-PALB2 and assessed for HA (≥10), RPA32 (≥10), and RAD51 (≥5) IRIF positive cells. Mean and S.E M. percentage foci positive cells, n=3 biological replicates. *** p < 0.001 compared to HA alone (unpaired, two-tailed t-tests). See for western blots and representative images. (H) Cells from G were incubated with increasing concentrations of rucaparib for 2 weeks and colony formation assessed. Mean and S.E.M. colony formation as well as mean IC50 values are shown from n=3 biological replicates. (I) MDA-MB-436 cells with sgRNA targeting 53BP1 expressing HA-RING-PALB2 were subject to scrambled (Sc) or RNF168 siRNA and HA and RAD51 IRIF measured. Mean and S.E M. percentage foci positive cells, n=3 biological replicates. *** p < 0.001 and ** p < 0.01 compared to Sc (unpaired, two-tailed t-tests). See for Western blots and representative images.

Article Snippet: The following primary antibodies were used: Brca1 (gift from A. Nussenzweig), BRCA1 (Millipore, 07-434), RAD51 (Genetex, GTX100469), RAD51 (Abcam, ab133534), HA (Covance, MMS-101R), BARD1 (Santa Cruz Biotechnology, sc-74559), 53BP1 (Novus Biologicals, NB100), 53BP1 (Millipore, MAB3802), RPA32 (Cell Signaling, 2208), RPA32 (Sigma-Aldrich, NA18), RAP80 (Bethyl Laboratories, A300-763A), FLAG (Sigma-Aldrich, F1804), FLAG (Cell Signaling, 14793), CtIP (Millipore, MABE1060).

Techniques: Expressing, Immunofluorescence, Two Tailed Test, MANN-WHITNEY, Incubation, Western Blot, Infection, Virus

Journal: bioRxiv

Article Title: RNF168-mediated localization of BARD1 recruits the BRCA1-PALB2 complex to DNA damage

doi: 10.1101/2021.06.25.449923

Figure Lengend Snippet: (A) Associated with : Left , MDA-MB-436 cells expressing HA-empty vector (HA), HA-BRCA1 RING domain (R), HA-PALB2 (P2), or -HA-BRCA1 RING domain-PALB2 (R-P2) were subject to sgRNA targeting GFP or 53BP1 and assessed for the indicated protein expression by Western botting. To determine the relative effects of RING constructs on BARD1 expression, protein levels were compared to MCF7 as well as MDA-MB-436 expressing ectopic BFP and full-length BRCA1. Middle , Western blots showing the effects of sg53BP1 on 53BP1 protein expression in the indicated cell lines. Right , Two sets of additional cell lysates were generated for 53BP1 wild-type cells to assess whether 53BP1 protein levels were similar between cell lines. (B) Representative images from . (C) Representative images and western blot associated with . (D) Representative images associated with . (E) Representative images and western blot associated with . (F) Representative images and western blot associated with . (G) Model for impact of Brca1 CC and Rnf168 - alleles and the supporting role of Rap80-Abraxas on Palb2 and Rad51 loading and development in mice. The Mendelian birth ratios of live mice are indicated above.

Article Snippet: The following primary antibodies were used: Brca1 (gift from A. Nussenzweig), BRCA1 (Millipore, 07-434), RAD51 (Genetex, GTX100469), RAD51 (Abcam, ab133534), HA (Covance, MMS-101R), BARD1 (Santa Cruz Biotechnology, sc-74559), 53BP1 (Novus Biologicals, NB100), 53BP1 (Millipore, MAB3802), RPA32 (Cell Signaling, 2208), RPA32 (Sigma-Aldrich, NA18), RAP80 (Bethyl Laboratories, A300-763A), FLAG (Sigma-Aldrich, F1804), FLAG (Cell Signaling, 14793), CtIP (Millipore, MABE1060).

Techniques: Expressing, Plasmid Preparation, Western Blot, Construct, Generated

Journal: Frontiers in Oncology

Article Title: Inhibition of HSP90 as a Strategy to Radiosensitize Glioblastoma: Targeting the DNA Damage Response and Beyond

doi: 10.3389/fonc.2021.612354

Figure Lengend Snippet: HSP90i by NW457 leads to downregulation of DNA damage response factors, impaired DNA damage repair, and reduced clonogenic survival in response to ionizing irradiation in human glioblastoma cells. (A) Transcriptomic profiling of regulators of the DNA damage response (DDR) in LN229 and T98G cells. mRNA expression levels were determined by qRT-PCR, normalized to a matrix of 3 reference genes (18S rRNA, δ-amino-laevulinate-synthase, and β2-microglobulin), and calibrated to the results of untransformed human astrocytes. For both cell lines, three replicates were analyzed and are displayed as x-fold log2-values. (B) Time course analysis of DDR regulator protein expression in LN229 and T98G cells upon HSP90i by 10 nM NW457. Arrowheads indicate the bands that were used for quantification. Protein levels were normalized to a matrix comprising vinculin and α-tubulin and are depicted as x-fold log2-values compared to the 0 h controls. (C) Immunofluorescence microscopy of γH2AX and 53BP1 DNA damage repair foci in LN229 and T98G cells upon irradiation at 2 Gy ± HSP90i by NW457. Cells were treated with NW457 (10 nM) or DMSO for 24 h, irradiated, and fixed at the indicated times. Cells were stained for γH2AX, 53BP1, and DNA and subjected to deconvolution immunofluorescence microscopy. Scale bar depicts 10 µm. (D) Quantification of DNA damage repair kinetics from (C) . γH2AX and 53BP1 double-positive foci in at least 20 randomly picked nuclei were counted by hand. Individual data points with superimposed means ± 95% confidence intervals are displayed, and overall curve comparison was performed by two-way ANOVA. (E) Clonogenic survival of LN229 and T98G cells upon irradiation at 0–8 Gy ± HSP90i by NW457. Cells were pre-treated with 10 nM NW457 or DMSO for 24 h followed by irradiation at the indicated doses, and colony formation was allowed for 13 d ± continuous NW457 treatment. Individual data points of 4 independent experiments are shown, linear-quadratic regression lines are superimposed, and overall curve comparison was performed by two-way ANOVA.

Article Snippet: Cells were stained with monoclonal mouse anti-γH2AX (Merck Millipore) and polyclonal rabbit anti-53BP1 (Bio-Techne, Wiesbaden, Germany) antibodies diluted in 3% isotonic bovine serum albumin and 0.1% Triton X-100 for 2 h at room temperature.

Techniques: Irradiation, Expressing, Quantitative RT-PCR, Immunofluorescence, Microscopy, Staining, Comparison