Structured Review

PEQLAB nano drop spectrophotometer nd 1000
Nano Drop Spectrophotometer Nd 1000, supplied by PEQLAB, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nano drop spectrophotometer nd 1000/product/PEQLAB
Average 91 stars, based on 2 article reviews
Price from $9.99 to $1999.99
nano drop spectrophotometer nd 1000 - by Bioz Stars, 2020-08
91/100 stars

Images

Related Articles

Concentration Assay:

Article Title: Single-Component Biohybrid Light-Emitting Diodes Using a White-Emitting Fused Protein
Article Snippet: .. The concentration of the recombinant proteins was determined by measuring the absorption at 280 nm using a Nano-Drop Spectrophotometer ND-1000 (Peqlab) and taking into account the specific molar extinction coefficients of the proteins. .. If needed, proteins were concentrated using Amicon Ultra centrifugal filter units with 10 kDa MWCO (Merck, Millipore).

Article Title: A One Pot, One Step, Precision Cloning Method with High Throughput Capability
Article Snippet: .. Plasmid DNA concentration was measured using a Nano Drop® Spectrophotometer ND-1000 (Peqlab, Erlangen). .. Constructs A GFP gene was flanked by BsaI restriction sites using PCR amplification of a GFP coding sequence using primers bsgfp3 ( ttt ggtctc a aggt atggtgagcaagggcgaggag ) and bsgfp2 ( ttt ggtctc a aagc ttacttgtacagctcgtcc ).

Article Title: Modular Protein Expression Toolbox (MoPET), a standardized assembly system for defined expression constructs and expression optimization libraries
Article Snippet: .. Plasmid DNA concentration was measured using a Nano Drop® Spectrophotometer ND-1000 (Peqlab, Erlangen, Germany). .. Vector construction Level 0 functional modules of the SP, N-tag, C-tag, N-Link, and C-Link types were designed and ordered at Life Technologies™ (Carlsbad, CA) as human codon optimized DNA constructs in plasmids conferring kanamycin resistance and lacking BsaI restriction sites.

Recombinant:

Article Title: Single-Component Biohybrid Light-Emitting Diodes Using a White-Emitting Fused Protein
Article Snippet: .. The concentration of the recombinant proteins was determined by measuring the absorption at 280 nm using a Nano-Drop Spectrophotometer ND-1000 (Peqlab) and taking into account the specific molar extinction coefficients of the proteins. .. If needed, proteins were concentrated using Amicon Ultra centrifugal filter units with 10 kDa MWCO (Merck, Millipore).

Spectrophotometry:

Article Title: Single-Component Biohybrid Light-Emitting Diodes Using a White-Emitting Fused Protein
Article Snippet: .. The concentration of the recombinant proteins was determined by measuring the absorption at 280 nm using a Nano-Drop Spectrophotometer ND-1000 (Peqlab) and taking into account the specific molar extinction coefficients of the proteins. .. If needed, proteins were concentrated using Amicon Ultra centrifugal filter units with 10 kDa MWCO (Merck, Millipore).

Article Title: A One Pot, One Step, Precision Cloning Method with High Throughput Capability
Article Snippet: .. Plasmid DNA concentration was measured using a Nano Drop® Spectrophotometer ND-1000 (Peqlab, Erlangen). .. Constructs A GFP gene was flanked by BsaI restriction sites using PCR amplification of a GFP coding sequence using primers bsgfp3 ( ttt ggtctc a aggt atggtgagcaagggcgaggag ) and bsgfp2 ( ttt ggtctc a aagc ttacttgtacagctcgtcc ).

Article Title: Modular Protein Expression Toolbox (MoPET), a standardized assembly system for defined expression constructs and expression optimization libraries
Article Snippet: .. Plasmid DNA concentration was measured using a Nano Drop® Spectrophotometer ND-1000 (Peqlab, Erlangen, Germany). .. Vector construction Level 0 functional modules of the SP, N-tag, C-tag, N-Link, and C-Link types were designed and ordered at Life Technologies™ (Carlsbad, CA) as human codon optimized DNA constructs in plasmids conferring kanamycin resistance and lacking BsaI restriction sites.

Plasmid Preparation:

Article Title: A One Pot, One Step, Precision Cloning Method with High Throughput Capability
Article Snippet: .. Plasmid DNA concentration was measured using a Nano Drop® Spectrophotometer ND-1000 (Peqlab, Erlangen). .. Constructs A GFP gene was flanked by BsaI restriction sites using PCR amplification of a GFP coding sequence using primers bsgfp3 ( ttt ggtctc a aggt atggtgagcaagggcgaggag ) and bsgfp2 ( ttt ggtctc a aagc ttacttgtacagctcgtcc ).

Article Title: Modular Protein Expression Toolbox (MoPET), a standardized assembly system for defined expression constructs and expression optimization libraries
Article Snippet: .. Plasmid DNA concentration was measured using a Nano Drop® Spectrophotometer ND-1000 (Peqlab, Erlangen, Germany). .. Vector construction Level 0 functional modules of the SP, N-tag, C-tag, N-Link, and C-Link types were designed and ordered at Life Technologies™ (Carlsbad, CA) as human codon optimized DNA constructs in plasmids conferring kanamycin resistance and lacking BsaI restriction sites.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    PEQLAB nano drop nd 1000 spectrometer
    Nano Drop Nd 1000 Spectrometer, supplied by PEQLAB, used in various techniques. Bioz Stars score: 80/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nano drop nd 1000 spectrometer/product/PEQLAB
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nano drop nd 1000 spectrometer - by Bioz Stars, 2020-08
    80/100 stars
      Buy from Supplier

    94
    PEQLAB nanodrop nd 1000 spectrophotometer
    Nanodrop Nd 1000 Spectrophotometer, supplied by PEQLAB, used in various techniques. Bioz Stars score: 94/100, based on 324 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nanodrop nd 1000 spectrophotometer/product/PEQLAB
    Average 94 stars, based on 324 article reviews
    Price from $9.99 to $1999.99
    nanodrop nd 1000 spectrophotometer - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results