monarch nucleic acid purification kit  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Monarch DNA Gel Extraction Kit
    Monarch DNA Gel Extraction Kit 250 preps
    Catalog Number:
    250 preps
    DNA Fragment Purification from Gels
    Buy from Supplier

    Structured Review

    New England Biolabs monarch nucleic acid purification kit
    Monarch DNA Gel Extraction Kit
    Monarch DNA Gel Extraction Kit 250 preps nucleic acid purification kit/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    monarch nucleic acid purification kit - by Bioz Stars, 2019-12
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Paragraph title: Isolation and cloning of NtEGY1 and NtEGY2 cDNA ... Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA).

    Article Title: Identification and biosynthesis of thymidine hypermodifications in the genomic DNA of widespread bacterial viruses
    Article Snippet: After heat inactivation at 80 °C for 20 min, the digest was purified using a Monarch nucleic acid purification kit (NEB). .. After cooling the reaction to room temperature, the biotinylated DNA was purified using a QIAquick nucleotide removal kit (Qiagen).

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: 2.2 The recombinant plasmid for the expression of VC1-His-Strep in P. pastoris was obtained by cloning a Xho I-digested DNA fragment encoding the protein of interest into the corresponding sites of pHIL-S1 vector (Invitrogen). .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Colony PCR was performed using the commercially available AOX1 forward (5′-GACTGGTTCCAATTGACA­AGC-3′) and reverse (5′-GGCAAATGGCATTCTGACAT­CCT-3′) primers from Invitrogen. pPpT4α_S clones containing the TvTS inserts were amplified overnight in LB medium supplemented with 2% glucose and 50 µg ml−1 Zeocin (shaking at 200 rev min−1 at 310 K) and the plasmids were extracted as described above. .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).


    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: The coding regions of Yb candidate genes were amplified by PCR from first-strand cDNA from K326 and TN90 using the primers cYb-F and cYb-R (Additional file ). .. Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA).

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Subsequently, a panel of primers designed for amplification of the CanineCV genome was used to further analyze samples which were CanineCV positive (Supplementary Table ). .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics).

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The resulting PCR products were analyzed by agarose gel-electrophoresis on a 1% gel, stained with ethidium bromide and recorded using the Gel Doc EQ quantification analysis software (Bio-Rad, Image Lab Software Version 4.1). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. For each CPER assembly, 0.06 pmol of each viral cDNA fragment was added to the PCR reaction using the PrimeSTAR GXL DNA Polymerase kit (Clontech, Mountain View, CA, USA) in a 50 μL reaction volume.

    Article Title: Metagenomics of pigmented and cholesterol gallstones: the putative role of bacteria
    Article Snippet: The amplification involved 13–15 cycles. .. Gel electrophoresis (2 wt%, 50 min, 120 V) was performed with 10 uL of the concentrated libraries and gel fragments (200–500 bp) were excised and gel purified with the Monarch DNA Gel Extraction Kit (New England BioLabs Inc).

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: CanineCV genomes were obtained by PCR amplification using degenerated primers designed from various strains of published CanineCV genome in GenBank (Supplementary Table ). .. The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: After that, cDNA was ligated to an Illumina PE adapter oligo mix by the Quick ligation kit (Qiagen). .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction. .. Finally, the library products were sequenced using the Illumina GA2 sequencing machine.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: PCR was carried out using as a template pET-15b-VC1243, harbouring the cDNA encoding the precursor of hRAGE, and primers amplified a portion corresponding to the V and C1 domains (amino acid residues 23–243). .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN). .. The PCR product and the pHIL-S1 vector were digested with Xho I (NEB), gel-purified and ligated (Quick Ligation Kit, NEB).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Plasmids of each variant were further amplified and purified (as described above) in order to yield high amounts for transfection into the yeast P. pastoris . .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols. .. One μL of this library was amplified by 35 cycles of PCR using Promega GoTaq G2 Polymerase and cycling conditions of 95C × 3 min; then 35 cycles of 95C × 30 sec, 60C × 30 sec, and 72C × 1 min, and then 72C × 5 min. One PCR primer is denoted LP2 and is identical to Illumina's “TruSeq PCR Primer 2” (see ), and the other primer is denoted TG1 and is directed at sequences within the 5′ end of the transgene.

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs). .. The mix was incubated at room temperature for 20 min. After another MinElute purification step (elution volume 20 µL), adapter fill-in was performed in a 40-µL volume containing 1× ThermoPol buffer (Thermo Fisher Scientific), 125 µM dNTPs and 16 U BSM DNA Polymerase (Thermo Fisher Scientific).

    Positive Control:

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: Nuclease free water was used as negative control and female tsetse fly DNA (Glossina fuscipes fuscipes ) obtained from the field in Uganda was used as a positive control. .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.).


    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: RNA was extracted from leaf tissue of 6-week old plants of K326 and TN90 plants using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized using the SuperScript First-Strand Synthesis System for RT-PCR with oligo(dT) (Invitrogen, Carlsbad, CA). .. Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA).

    Article Title: Identification and biosynthesis of thymidine hypermodifications in the genomic DNA of widespread bacterial viruses
    Article Snippet: After heat inactivation at 80 °C for 20 min, the digest was purified using a Monarch nucleic acid purification kit (NEB). .. After cooling the reaction to room temperature, the biotinylated DNA was purified using a QIAquick nucleotide removal kit (Qiagen).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: The first-strand cDNA was synthesized with oligo-dT primer by Superscripts II reverse transcriptase (Invitrogen), and second strand cDNA synthesis was followed according to the standard protocol. .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction.


    Article Title: Analysis of spinal and muscle pathology in transgenic mice overexpressing wild-type and ALS-linked mutant MATR3
    Article Snippet: RNA was isolated from quadriceps and spinal cord using Trizol (Invitrogen, catalog #15596026) per manufacturer protocol. .. A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S). .. This probe for the blots was labeled with α-32 P-dCTP using Rediprime II DNA Labeling System (GE Healthcare Amersham, catalog #RPN1633) and purified using ProbeQuant™ G-50 Micro Columns (GE Healthcare, catalog #28903408), both per manufacturer protocol.


    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. The CPER reaction was transfected into HEK293 cells seeded in a 6 well plate using Lipofectamine LTX Plus reagent (Invitrogen).

    Article Title: Analysis of spinal and muscle pathology in transgenic mice overexpressing wild-type and ALS-linked mutant MATR3
    Article Snippet: A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S). .. A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S).

    Article Title: A System for Dosage-Based Functional Genomics in Poplar
    Article Snippet: The mixture was incubated for 45 min at 37°C before 5 μL of 0.5 M EDTA was added to terminate the reaction. .. End repair and “A”-base addition were performed using the Next DNA Sample Prep kit (New England Biolabs) according to the manufacturer’s recommendations, except that half of the recommended volumes were used for the end-repair reactions.

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: First library: UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 3 U USER enzyme (Uracil-Specific Excision Reagent, New England Biolabs). .. The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs). .. Both library preparations were continued as follows: After purification with the MinElute PCR Purification Kit (Qiagen) (elution volume 18 µL), adapter ligation was done in a 40-µL volume containing 18 µL DNA, 1× Quick Ligase buffer (New England Biolabs), 2.5 µM adapter mix (Solexa) and 0.5 U Quick Ligase (New England Biolabs).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics).

    Cell Culture:

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Genomic DNA was isolated from faecal and larynx samples (infected and non-infected, each n = 4) and cultured B. pseudohinzii (n = 1) with the ISOLATE Faecal DNA Kit (Bioline, Luckenwalde, Germany) according to the manufacturer’s protocol. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer.

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.


    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: Paragraph title: Construction of the expression plasmid ... PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Paragraph title: 2.1. Construction of the expression vectors and transfection in Pichia pastoris ... 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).


    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: For each sample, two double-stranded DNA sequencing libraries were prepared according to an established, but slightly modified protocol for multiplex high-throughput sequencing . .. The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs).

    Transformation Assay:

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN). .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: The transformed cells were then selected on LB plates containing 50 µg ml−1 Zeocin (Invitrogen) according to the manufacturer’s instructions. .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).

    Derivative Assay:

    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA). .. Fragments were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and transformed into NEB 5-alpha competent E. coli cells (New England Biolabs, Ipswich, MA).


    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. For each CPER assembly, 0.06 pmol of each viral cDNA fragment was added to the PCR reaction using the PrimeSTAR GXL DNA Polymerase kit (Clontech, Mountain View, CA, USA) in a 50 μL reaction volume.

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Paragraph title: 2.1. Construction of the expression vectors and transfection in Pichia pastoris ... 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).


    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: After that, cDNA was ligated to an Illumina PE adapter oligo mix by the Quick ligation kit (Qiagen). .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction.

    Article Title: A System for Dosage-Based Functional Genomics in Poplar
    Article Snippet: End repair and “A”-base addition were performed using the Next DNA Sample Prep kit (New England Biolabs) according to the manufacturer’s recommendations, except that half of the recommended volumes were used for the end-repair reactions. .. Reactions were purified using AMPure beads and a 1:1 ratio of beads to sample volumes, with a final elution volume of 13 µL.

    Northern Blot:

    Article Title: Analysis of spinal and muscle pathology in transgenic mice overexpressing wild-type and ALS-linked mutant MATR3
    Article Snippet: Paragraph title: Northern blotting ... A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S).


    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Genomic DNA was isolated from faecal and larynx samples (infected and non-infected, each n = 4) and cultured B. pseudohinzii (n = 1) with the ISOLATE Faecal DNA Kit (Bioline, Luckenwalde, Germany) according to the manufacturer’s protocol. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer.

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: RNA was extracted from leaf tissue of 6-week old plants of K326 and TN90 plants using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized using the SuperScript First-Strand Synthesis System for RT-PCR with oligo(dT) (Invitrogen, Carlsbad, CA). .. Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA).

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. For each CPER assembly, 0.06 pmol of each viral cDNA fragment was added to the PCR reaction using the PrimeSTAR GXL DNA Polymerase kit (Clontech, Mountain View, CA, USA) in a 50 μL reaction volume.


    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: The sequence of the primers used for the amplification of the DNA fragment were VCXhoIFOR (5′-agcatattcgactgactcgagctcaaaacatcacagcccg −3′) and VC1-233His-StrepREV (5′-atcgtcgggctcactcgagCTA accaccgaactgcgggtgacgcca agcgctaccaccgctaccaccaccgctaccaccaccgtgatggtgatggtgatg ggcgctcacaggctcccagacacg −3′) where the XhoI site is underlined, the stop codon is in capitol letter, the sequence encoding the Strep tag (AWRHPQFGG) is in bold, the sequence encoding the 6x His tag is in italic and bold, the CDS of VC1 is in italic. .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    DNA Sequencing:

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. Transformed cells were cultured and recombinant plasmid was extracted using the QIAprep Spin Miniprep Kit (Qiagen, Valencia CA).

    Article Title: Characterization of Unique Modification of Flagellar Rod Protein FlgG by Campylobacter jejun
    Article Snippet: Enzymes, DNA purification kits, and primers were purchased from New England Biolabs, Qiagen, Stratagene, and Invitrogen. .. Enzymes, DNA purification kits, and primers were purchased from New England Biolabs, Qiagen, Stratagene, and Invitrogen.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN). .. Recombinant plasmid DNA, named pHIL-S1-VC1-His-Strep, was purified.

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Paragraph title: Generation of DNA sequencing library and next-generation sequencing ... The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols.

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: For each sample, two double-stranded DNA sequencing libraries were prepared according to an established, but slightly modified protocol for multiplex high-throughput sequencing . .. The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs).


    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA). .. Fragments were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and transformed into NEB 5-alpha competent E. coli cells (New England Biolabs, Ipswich, MA).

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Cycling conditions were 12 min 95 °C, 40 cycles with 30 s at 95 °C, 30 s at 62 °C, 30 s at 72 °C, and a final extension at 72 °C for 7 min. PCR products were analysed on a 2% agarose gel. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer. .. Mice were sacrificed by cervical dislocation and the lungs were removed after ligation of the trachea to avoid alveolar collapse as described .

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: The PCR reaction consisted of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5x Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of cDNA. .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. CanineCV sequences from all positive samples were aligned using MAFFT alignment version 7 ( and MEGA 7 based on nucleotide sequences of the nearly complete genome (nt 49 to 1949), replicase, and capsid genes.

    Article Title: Metagenomics of pigmented and cholesterol gallstones: the putative role of bacteria
    Article Snippet: Paragraph title: Metagenomic library preparation and sequencing ... Gel electrophoresis (2 wt%, 50 min, 120 V) was performed with 10 uL of the concentrated libraries and gel fragments (200–500 bp) were excised and gel purified with the Monarch DNA Gel Extraction Kit (New England BioLabs Inc).

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Paragraph title: Genome sequencing and CanineCV-specific PCR ... The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany).

    Article Title: Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
    Article Snippet: Paragraph title: Illumina sequencing and data analysis ... Libraries were gel purified on agarose gels stained with SYBR safe (Life Technologies), visualised using a blue light source and purified using Monarch DNA Gel Extraction kits (NEB).

    Article Title: Proteogenomic Identification of a Novel Protein-Encoding Gene in Bovine Herpesvirus 1 That Is Expressed during Productive Infection
    Article Snippet: Paragraph title: 2.6. DNA Gel Electrophoresis, Purification, and Sequencing ... Bands for the 5′ RACE and or other amplicons were excised with a clean scalpel and purified using the Monarch nucleic acid purification kit (#T1020, New England Biolabs).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: Paragraph title: Paired-End cDNA Library Construction for Illumina Genome Analyzer 2 (GA2) Sequencing ... The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: The two tags are separated in the product by a linker of sequence GGGSGGGSGGSA. .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    Article Title: A System for Dosage-Based Functional Genomics in Poplar
    Article Snippet: Paragraph title: Sequencing Library Preparation ... End repair and “A”-base addition were performed using the Next DNA Sample Prep kit (New England Biolabs) according to the manufacturer’s recommendations, except that half of the recommended volumes were used for the end-repair reactions.

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: For each sample, two double-stranded DNA sequencing libraries were prepared according to an established, but slightly modified protocol for multiplex high-throughput sequencing . .. The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs).


    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.

    Article Title: Characterization of Unique Modification of Flagellar Rod Protein FlgG by Campylobacter jejun
    Article Snippet: Paragraph title: General Recombinant DNA Techniques ... Enzymes, DNA purification kits, and primers were purchased from New England Biolabs, Qiagen, Stratagene, and Invitrogen.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: In this vector, the expression of the recombinant protein is under the control of the inducible AOX1 promoter and the sequence encoding VC1 is in-frame with the secretion signal of P. pastoris PHO1 encoding an extracellular acid phosphatase. .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    Nucleic Acid Purification:

    Article Title: Identification and biosynthesis of thymidine hypermodifications in the genomic DNA of widespread bacterial viruses
    Article Snippet: SP8 genomic DNA was digested to completion with restriction endonuclease HpyCH4IV according to the manufacturer's guidelines. .. After heat inactivation at 80 °C for 20 min, the digest was purified using a Monarch nucleic acid purification kit (NEB). .. Fragmented SP8 genomic DNA at a final concentration of 200 ng/µL was biotinlylated by incubating 1 U/µL of Taq DNA polymerase containing 50 µM biotin-16-dCTP at 68 °C for 3 h in 1× ThermoPol buffer (NEB).

    Article Title: Proteogenomic Identification of a Novel Protein-Encoding Gene in Bovine Herpesvirus 1 That Is Expressed during Productive Infection
    Article Snippet: PCR amplicons were visualized using a 1% agarose gel in TAE buffer (40 mM Tris (pH 7.6), 20 mM acetic acid, and 1 mM EDTA). .. Bands for the 5′ RACE and or other amplicons were excised with a clean scalpel and purified using the Monarch nucleic acid purification kit (#T1020, New England Biolabs). .. The purified DNA was quantified using NanoDrop, sent to Eurofins for sequencing, and compared to the full BoHV-1 Cooper sequence (accession: ).

    DNA Gel Electrophoresis:

    Article Title: Proteogenomic Identification of a Novel Protein-Encoding Gene in Bovine Herpesvirus 1 That Is Expressed during Productive Infection
    Article Snippet: Paragraph title: 2.6. DNA Gel Electrophoresis, Purification, and Sequencing ... Bands for the 5′ RACE and or other amplicons were excised with a clean scalpel and purified using the Monarch nucleic acid purification kit (#T1020, New England Biolabs).

    DNA Extraction:

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Paragraph title: DNA isolation and PCR ... For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer.

    Nucleic Acid Electrophoresis:

    Article Title: Metagenomics of pigmented and cholesterol gallstones: the putative role of bacteria
    Article Snippet: The resulting libraries were concentrated to a volume of 20 uL using Amicon Ultra centrifugal filer units Ultra-0.5 MWCO 30KDa. .. Gel electrophoresis (2 wt%, 50 min, 120 V) was performed with 10 uL of the concentrated libraries and gel fragments (200–500 bp) were excised and gel purified with the Monarch DNA Gel Extraction Kit (New England BioLabs Inc). .. The final volume after gel purification for each barcoded library (n = 8) was 20 uL and were sent to the Australian Genomic Research Facility (AGRF) in Perth, Western Australia for final quality checking and sequencing.


    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: With Trizol reagent (Invirtrogen), 5 µg total RNA was extracted from testes of 0-1 day old nsr mutant and WT flies, respectively. .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction.


    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Paragraph title: Isolation and cloning of NtEGY1 and NtEGY2 cDNA ... Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA).

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Genomic DNA was isolated from faecal and larynx samples (infected and non-infected, each n = 4) and cultured B. pseudohinzii (n = 1) with the ISOLATE Faecal DNA Kit (Bioline, Luckenwalde, Germany) according to the manufacturer’s protocol. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer.

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C.

    Article Title: Analysis of spinal and muscle pathology in transgenic mice overexpressing wild-type and ALS-linked mutant MATR3
    Article Snippet: RNA was isolated from quadriceps and spinal cord using Trizol (Invitrogen, catalog #15596026) per manufacturer protocol. .. A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: After that, cDNA was ligated to an Illumina PE adapter oligo mix by the Quick ligation kit (Qiagen). .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction. .. Finally, the library products were sequenced using the Illumina GA2 sequencing machine.

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Briefly, the DNA was sheared using the Covaris S2 system, and fragments of approximately 550 bp were isolated by agarose gel electrophoresis, excision, and purification. .. The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols.

    Negative Control:

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: Nuclease free water was used as negative control and female tsetse fly DNA (Glossina fuscipes fuscipes ) obtained from the field in Uganda was used as a positive control. .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.).


    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Because few nucleotide differences existed between NtEGY1 and NtEGY2 at either the 5’ or 3’ ends, it was not possible to design primers specific to either homeolog. .. Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA). .. Fragments were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and transformed into NEB 5-alpha competent E. coli cells (New England Biolabs, Ipswich, MA).

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Cycling conditions were 12 min 95 °C, 40 cycles with 30 s at 95 °C, 30 s at 62 °C, 30 s at 72 °C, and a final extension at 72 °C for 7 min. PCR products were analysed on a 2% agarose gel. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer. .. Mice were sacrificed by cervical dislocation and the lungs were removed after ligation of the trachea to avoid alveolar collapse as described .

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: The PCR reaction consisted of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5x Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of cDNA. .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. CanineCV sequences from all positive samples were aligned using MAFFT alignment version 7 ( and MEGA 7 based on nucleotide sequences of the nearly complete genome (nt 49 to 1949), replicase, and capsid genes.

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.).

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. For each CPER assembly, 0.06 pmol of each viral cDNA fragment was added to the PCR reaction using the PrimeSTAR GXL DNA Polymerase kit (Clontech, Mountain View, CA, USA) in a 50 μL reaction volume.

    Article Title: Metagenomics of pigmented and cholesterol gallstones: the putative role of bacteria
    Article Snippet: The resulting libraries were concentrated to a volume of 20 uL using Amicon Ultra centrifugal filer units Ultra-0.5 MWCO 30KDa. .. Gel electrophoresis (2 wt%, 50 min, 120 V) was performed with 10 uL of the concentrated libraries and gel fragments (200–500 bp) were excised and gel purified with the Monarch DNA Gel Extraction Kit (New England BioLabs Inc). .. The final volume after gel purification for each barcoded library (n = 8) was 20 uL and were sent to the Australian Genomic Research Facility (AGRF) in Perth, Western Australia for final quality checking and sequencing.

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Briefly, PCR reactions comprised of a mixture of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5× Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of template. .. The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany). .. All the purified PCR products were subjected to Sanger sequencing in order to determine the complete nucleotide sequences of detected CanineCV.

    Article Title: Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
    Article Snippet: Libraries were prepared by PCR using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore) to append barcodes and sequencing primers. .. Libraries were gel purified on agarose gels stained with SYBR safe (Life Technologies), visualised using a blue light source and purified using Monarch DNA Gel Extraction kits (NEB). .. Libraries were then quantified using a Qubit Fluorometer (Thermo Fisher Scientifc).

    Article Title: Identification and biosynthesis of thymidine hypermodifications in the genomic DNA of widespread bacterial viruses
    Article Snippet: SP8 genomic DNA was digested to completion with restriction endonuclease HpyCH4IV according to the manufacturer's guidelines. .. After heat inactivation at 80 °C for 20 min, the digest was purified using a Monarch nucleic acid purification kit (NEB). .. Fragmented SP8 genomic DNA at a final concentration of 200 ng/µL was biotinlylated by incubating 1 U/µL of Taq DNA polymerase containing 50 µM biotin-16-dCTP at 68 °C for 3 h in 1× ThermoPol buffer (NEB).

    Article Title: Proteogenomic Identification of a Novel Protein-Encoding Gene in Bovine Herpesvirus 1 That Is Expressed during Productive Infection
    Article Snippet: PCR amplicons were visualized using a 1% agarose gel in TAE buffer (40 mM Tris (pH 7.6), 20 mM acetic acid, and 1 mM EDTA). .. Bands for the 5′ RACE and or other amplicons were excised with a clean scalpel and purified using the Monarch nucleic acid purification kit (#T1020, New England Biolabs). .. The purified DNA was quantified using NanoDrop, sent to Eurofins for sequencing, and compared to the full BoHV-1 Cooper sequence (accession: ).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: Then, the double-stranded cDNA was purified with the Qiaquick PCR purification kit (Qiagen) and fragmented with a nebulizer (Invirtrogen), resulting in an average size of 150–250-bp. .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: PCR was carried out using as a template pET-15b-VC1243, harbouring the cDNA encoding the precursor of hRAGE, and primers amplified a portion corresponding to the V and C1 domains (amino acid residues 23–243). .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN). .. The PCR product and the pHIL-S1 vector were digested with Xho I (NEB), gel-purified and ligated (Quick Ligation Kit, NEB).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Plasmids of each variant were further amplified and purified (as described above) in order to yield high amounts for transfection into the yeast P. pastoris . .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water). .. Complete linearization of the vector was assessed by loading the digestion mixture onto an agarose gel.

    Article Title: A System for Dosage-Based Functional Genomics in Poplar
    Article Snippet: The fragmented DNA was purified using AMPure beads (Beckman Coulter) and a 1:1 ratio of beads to sample volumes. .. End repair and “A”-base addition were performed using the Next DNA Sample Prep kit (New England Biolabs) according to the manufacturer’s recommendations, except that half of the recommended volumes were used for the end-repair reactions.

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Briefly, the DNA was sheared using the Covaris S2 system, and fragments of approximately 550 bp were isolated by agarose gel electrophoresis, excision, and purification. .. The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols. .. One μL of this library was amplified by 35 cycles of PCR using Promega GoTaq G2 Polymerase and cycling conditions of 95C × 3 min; then 35 cycles of 95C × 30 sec, 60C × 30 sec, and 72C × 1 min, and then 72C × 5 min. One PCR primer is denoted LP2 and is identical to Illumina's “TruSeq PCR Primer 2” (see ), and the other primer is denoted TG1 and is directed at sequences within the 5′ end of the transgene.

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs). .. Both library preparations were continued as follows: After purification with the MinElute PCR Purification Kit (Qiagen) (elution volume 18 µL), adapter ligation was done in a 40-µL volume containing 18 µL DNA, 1× Quick Ligase buffer (New England Biolabs), 2.5 µM adapter mix (Solexa) and 0.5 U Quick Ligase (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: The coding regions of Yb candidate genes were amplified by PCR from first-strand cDNA from K326 and TN90 using the primers cYb-F and cYb-R (Additional file ). .. Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA).

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Cycling conditions were 12 min 95 °C, 40 cycles with 30 s at 95 °C, 30 s at 62 °C, 30 s at 72 °C, and a final extension at 72 °C for 7 min. PCR products were analysed on a 2% agarose gel. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer. .. Mice were sacrificed by cervical dislocation and the lungs were removed after ligation of the trachea to avoid alveolar collapse as described .

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: The PCR reaction consisted of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5x Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of cDNA. .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. CanineCV sequences from all positive samples were aligned using MAFFT alignment version 7 ( and MEGA 7 based on nucleotide sequences of the nearly complete genome (nt 49 to 1949), replicase, and capsid genes.

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The resulting PCR products were analyzed by agarose gel-electrophoresis on a 1% gel, stained with ethidium bromide and recorded using the Gel Doc EQ quantification analysis software (Bio-Rad, Image Lab Software Version 4.1). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.).

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C.

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Briefly, PCR reactions comprised of a mixture of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5× Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of template. .. The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany). .. All the purified PCR products were subjected to Sanger sequencing in order to determine the complete nucleotide sequences of detected CanineCV.

    Article Title: Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
    Article Snippet: Libraries were prepared by PCR using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore) to append barcodes and sequencing primers. .. Libraries were gel purified on agarose gels stained with SYBR safe (Life Technologies), visualised using a blue light source and purified using Monarch DNA Gel Extraction kits (NEB).

    Article Title: Proteogenomic Identification of a Novel Protein-Encoding Gene in Bovine Herpesvirus 1 That Is Expressed during Productive Infection
    Article Snippet: PCR amplicons were visualized using a 1% agarose gel in TAE buffer (40 mM Tris (pH 7.6), 20 mM acetic acid, and 1 mM EDTA). .. Bands for the 5′ RACE and or other amplicons were excised with a clean scalpel and purified using the Monarch nucleic acid purification kit (#T1020, New England Biolabs).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: After that, cDNA was ligated to an Illumina PE adapter oligo mix by the Quick ligation kit (Qiagen). .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction. .. Finally, the library products were sequenced using the Illumina GA2 sequencing machine.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: PCR was carried out using as a template pET-15b-VC1243, harbouring the cDNA encoding the precursor of hRAGE, and primers amplified a portion corresponding to the V and C1 domains (amino acid residues 23–243). .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN). .. The PCR product and the pHIL-S1 vector were digested with Xho I (NEB), gel-purified and ligated (Quick Ligation Kit, NEB).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Colony PCR was performed using the commercially available AOX1 forward (5′-GACTGGTTCCAATTGACA­AGC-3′) and reverse (5′-GGCAAATGGCATTCTGACAT­CCT-3′) primers from Invitrogen. pPpT4α_S clones containing the TvTS inserts were amplified overnight in LB medium supplemented with 2% glucose and 50 µg ml−1 Zeocin (shaking at 200 rev min−1 at 310 K) and the plasmids were extracted as described above. .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols. .. Only when the gene-specific (TG1, in this case) primer also is present will exponential amplification be possible.

    Positron Emission Tomography:

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: PCR was carried out using as a template pET-15b-VC1243, harbouring the cDNA encoding the precursor of hRAGE, and primers amplified a portion corresponding to the V and C1 domains (amino acid residues 23–243). .. PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).


    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The resulting PCR products were analyzed by agarose gel-electrophoresis on a 1% gel, stained with ethidium bromide and recorded using the Gel Doc EQ quantification analysis software (Bio-Rad, Image Lab Software Version 4.1). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.).

    Article Title: Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
    Article Snippet: Libraries were prepared by PCR using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore) to append barcodes and sequencing primers. .. Libraries were gel purified on agarose gels stained with SYBR safe (Life Technologies), visualised using a blue light source and purified using Monarch DNA Gel Extraction kits (NEB). .. Libraries were then quantified using a Qubit Fluorometer (Thermo Fisher Scientifc).

    cDNA Library Assay:

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: Paragraph title: Paired-End cDNA Library Construction for Illumina Genome Analyzer 2 (GA2) Sequencing ... The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction.

    Agarose Gel Electrophoresis:

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer.

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: The PCR reaction consisted of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5x Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of cDNA. .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. CanineCV sequences from all positive samples were aligned using MAFFT alignment version 7 ( and MEGA 7 based on nucleotide sequences of the nearly complete genome (nt 49 to 1949), replicase, and capsid genes.

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The resulting PCR products were analyzed by agarose gel-electrophoresis on a 1% gel, stained with ethidium bromide and recorded using the Gel Doc EQ quantification analysis software (Bio-Rad, Image Lab Software Version 4.1). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Briefly, PCR reactions comprised of a mixture of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5× Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of template. .. The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany). .. All the purified PCR products were subjected to Sanger sequencing in order to determine the complete nucleotide sequences of detected CanineCV.

    Article Title: Proteogenomic Identification of a Novel Protein-Encoding Gene in Bovine Herpesvirus 1 That Is Expressed during Productive Infection
    Article Snippet: PCR amplicons were visualized using a 1% agarose gel in TAE buffer (40 mM Tris (pH 7.6), 20 mM acetic acid, and 1 mM EDTA). .. Bands for the 5′ RACE and or other amplicons were excised with a clean scalpel and purified using the Monarch nucleic acid purification kit (#T1020, New England Biolabs).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: After that, cDNA was ligated to an Illumina PE adapter oligo mix by the Quick ligation kit (Qiagen). .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction. .. Finally, the library products were sequenced using the Illumina GA2 sequencing machine.

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Briefly, the DNA was sheared using the Covaris S2 system, and fragments of approximately 550 bp were isolated by agarose gel electrophoresis, excision, and purification. .. The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols.

    In Situ Hybridization:

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. To confirm the presence of CanineCV, in situ -hybridization (ISH) was performed on FFPE tissues, including lymph nodes, tonsils, thymus, spleen, pancreas, small intestine, kidney, urinary bladder, heart, trachea and lungs.

    Plasmid Preparation:

    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA). .. Fragments were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and transformed into NEB 5-alpha competent E. coli cells (New England Biolabs, Ipswich, MA).

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.

    Article Title: Analysis of spinal and muscle pathology in transgenic mice overexpressing wild-type and ALS-linked mutant MATR3
    Article Snippet: RNA was isolated from quadriceps and spinal cord using Trizol (Invitrogen, catalog #15596026) per manufacturer protocol. .. A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S). .. This probe for the blots was labeled with α-32 P-dCTP using Rediprime II DNA Labeling System (GE Healthcare Amersham, catalog #RPN1633) and purified using ProbeQuant™ G-50 Micro Columns (GE Healthcare, catalog #28903408), both per manufacturer protocol.

    Article Title: A capture method based on the VC1 domain reveals new binding properties of the human receptor for advanced glycation end products (RAGE)
    Article Snippet: Paragraph title: Construction of the expression plasmid ... PCR amplification was carried out using the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB) and the DNA fragment was purified using Geneclean Turbo for PCR kit (QIAGEN).

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Plasmids of each variant were further amplified and purified (as described above) in order to yield high amounts for transfection into the yeast P. pastoris . .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water). .. Complete linearization of the vector was assessed by loading the digestion mixture onto an agarose gel.


    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The resulting PCR products were analyzed by agarose gel-electrophoresis on a 1% gel, stained with ethidium bromide and recorded using the Gel Doc EQ quantification analysis software (Bio-Rad, Image Lab Software Version 4.1). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.).

    Article Title: Metagenomics of pigmented and cholesterol gallstones: the putative role of bacteria
    Article Snippet: Gel electrophoresis (2 wt%, 50 min, 120 V) was performed with 10 uL of the concentrated libraries and gel fragments (200–500 bp) were excised and gel purified with the Monarch DNA Gel Extraction Kit (New England BioLabs Inc). .. 2500 platform was used to generate 2 × 100-bp pair-end sequencing reads.

    Multiplex Assay:

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: For each sample, two double-stranded DNA sequencing libraries were prepared according to an established, but slightly modified protocol for multiplex high-throughput sequencing . .. The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs).


    Article Title: A System for Dosage-Based Functional Genomics in Poplar
    Article Snippet: End repair and “A”-base addition were performed using the Next DNA Sample Prep kit (New England Biolabs) according to the manufacturer’s recommendations, except that half of the recommended volumes were used for the end-repair reactions. .. Adaptors containing 6-bp index sequences (Bioo Scientific) or 8-bp index sequences (in-house design) were used.

    Sample Prep:

    Article Title: A System for Dosage-Based Functional Genomics in Poplar
    Article Snippet: The fragmented DNA was purified using AMPure beads (Beckman Coulter) and a 1:1 ratio of beads to sample volumes. .. End repair and “A”-base addition were performed using the Next DNA Sample Prep kit (New England Biolabs) according to the manufacturer’s recommendations, except that half of the recommended volumes were used for the end-repair reactions. .. Reactions were purified using AMPure beads and a 1:1 ratio of beads to sample volumes, with a final elution volume of 13 µL.

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Briefly, the DNA was sheared using the Covaris S2 system, and fragments of approximately 550 bp were isolated by agarose gel electrophoresis, excision, and purification. .. The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols. .. One μL of this library was amplified by 35 cycles of PCR using Promega GoTaq G2 Polymerase and cycling conditions of 95C × 3 min; then 35 cycles of 95C × 30 sec, 60C × 30 sec, and 72C × 1 min, and then 72C × 5 min. One PCR primer is denoted LP2 and is identical to Illumina's “TruSeq PCR Primer 2” (see ), and the other primer is denoted TG1 and is directed at sequences within the 5′ end of the transgene.

    Next-Generation Sequencing:

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Paragraph title: Generation of DNA sequencing library and next-generation sequencing ... The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols.


    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C.

    Concentration Assay:

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: The PCR reaction consisted of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5x Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of cDNA. .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics).

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Briefly, PCR reactions comprised of a mixture of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5× Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of template. .. The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany).

    DNA Purification:

    Article Title: Characterization of Unique Modification of Flagellar Rod Protein FlgG by Campylobacter jejun
    Article Snippet: EptC stands out among members of this large family of mostly uncharacterized proteins in that it catalyzes the addition of pEtN to two periplasmic targets: a membrane lipid and a flagellar protein ( ). .. Enzymes, DNA purification kits, and primers were purchased from New England Biolabs, Qiagen, Stratagene, and Invitrogen. .. All of the DNA-modifying enzymes and kits were used according to the manufacturers' instructions.

    Article Title: Identification of the Genomic Insertion Site of the Thyroid Peroxidase Promoter–Cre Recombinase Transgene Using a Novel, Efficient, Next-Generation DNA Sequencing Method
    Article Snippet: Liver DNA from a hemizygous or homozygous TPO-Cre mouse was prepared using a Promega Wizard Genomic DNA Purification Kit. .. The purified DNA was converted to a sequencer-ready library using the NEB-Next DNA Sample Prep Kit (New England Biolabs), according to the manufacturer's recommended protocols.

    High Throughput Screening Assay:

    Article Title: Ancient DNA study reveals HLA susceptibility locus for leprosy in medieval Europeans
    Article Snippet: For each sample, two double-stranded DNA sequencing libraries were prepared according to an established, but slightly modified protocol for multiplex high-throughput sequencing . .. The reaction mix was incubated at 37 °C for 3 h. Subsequently, 6 U T4 DNA Polymerase (Thermo Fisher Scientific) were added and the reaction mix was incubated at 25 °C for 30 min and at 10 °C for 5 min. Second library: non-UDG-treated libraries were prepared in a 50-µL volume containing 20 µL of DNA extract, 1× NEB buffer 2 (New England Biolabs), 300 µM dNTPs (each), 0.005 mg/mL BSA, 1mM ATP, 20 U T4 Polynucleotide Kinase (Thermo Fisher Scientific) and 1.2 U T4 Polymerase (New England Biolabs).

    Gel Extraction:

    Article Title: A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency
    Article Snippet: Because few nucleotide differences existed between NtEGY1 and NtEGY2 at either the 5’ or 3’ ends, it was not possible to design primers specific to either homeolog. .. Bands were therefore excised from agarose gels and purified with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA). .. Fragments were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and transformed into NEB 5-alpha competent E. coli cells (New England Biolabs, Ipswich, MA).

    Article Title: Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice
    Article Snippet: Cycling conditions were 12 min 95 °C, 40 cycles with 30 s at 95 °C, 30 s at 62 °C, 30 s at 72 °C, and a final extension at 72 °C for 7 min. PCR products were analysed on a 2% agarose gel. .. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer. .. Mice were sacrificed by cervical dislocation and the lungs were removed after ligation of the trachea to avoid alveolar collapse as described .

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: The PCR reaction consisted of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5x Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of cDNA. .. CanineCV positive PCR products were visualized on 1% Agarose gel and then purified by Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany) prior to Sanger sequencing (Eurofins Genomics). .. CanineCV sequences from all positive samples were aligned using MAFFT alignment version 7 ( and MEGA 7 based on nucleotide sequences of the nearly complete genome (nt 49 to 1949), replicase, and capsid genes.

    Article Title: Investigation of Wolbachia spp. and Spiroplasma spp. in Phlebotomus species by molecular methods
    Article Snippet: The resulting PCR products were analyzed by agarose gel-electrophoresis on a 1% gel, stained with ethidium bromide and recorded using the Gel Doc EQ quantification analysis software (Bio-Rad, Image Lab Software Version 4.1). .. The amplified DNA fragments of the correct size were excised from the agarose gel and extracted using the Monarch DNA Gel Extraction Kit (New England Biolabs, Inc.). .. The purified PCR products were ligated into pGEM-T Vector (Promega, Madison, WI) and recombinant plasmids were used to transform competent Escherichia coli strain DH5α.

    Article Title: Helicase Domain of West Nile Virus NS3 Protein Plays a Role in Inhibition of Type I Interferon Signalling
    Article Snippet: details the list of primers used for generating NY99 and NSW2011 cDNA libraries. cDNA fragments for NY99 isolate 4132 were prepared by PCR amplification from the full-length cDNA template ligated from two plasmids [ ]. cDNA fragments for NSW2011 were prepared by RT-PCR of viral RNA purified from NSW2011 virus isolated originally from the brain of an infected horse and then passaged once in C6/36 cells [ ]. .. After RT-PCR amplification, the cDNA fragments were purified by gel extraction using the Monarch DNA Gel Extraction Kit (NEB, Ipswich, MA, USA), quantified using the Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA, USA) and stored at −20 °C. .. For each CPER assembly, 0.06 pmol of each viral cDNA fragment was added to the PCR reaction using the PrimeSTAR GXL DNA Polymerase kit (Clontech, Mountain View, CA, USA) in a 50 μL reaction volume.

    Article Title: Metagenomics of pigmented and cholesterol gallstones: the putative role of bacteria
    Article Snippet: The resulting libraries were concentrated to a volume of 20 uL using Amicon Ultra centrifugal filer units Ultra-0.5 MWCO 30KDa. .. Gel electrophoresis (2 wt%, 50 min, 120 V) was performed with 10 uL of the concentrated libraries and gel fragments (200–500 bp) were excised and gel purified with the Monarch DNA Gel Extraction Kit (New England BioLabs Inc). .. The final volume after gel purification for each barcoded library (n = 8) was 20 uL and were sent to the Australian Genomic Research Facility (AGRF) in Perth, Western Australia for final quality checking and sequencing.

    Article Title: Novel canine circovirus strains from Thailand: Evidence for genetic recombination
    Article Snippet: Briefly, PCR reactions comprised of a mixture of 1 U of Phusion DNA polymerase (New England Biolab, UK), 10 mM of dNTP in 5× Phusion HF Buffer, 10 µ M final concentration of each primer and 2 µl of template. .. The PCR product was run on a 1% agarose gel and then purified using Monarch DNA Gel extraction kit (New England Biolab, Frankfurt, Germany). .. All the purified PCR products were subjected to Sanger sequencing in order to determine the complete nucleotide sequences of detected CanineCV.

    Article Title: Analysis of spinal and muscle pathology in transgenic mice overexpressing wild-type and ALS-linked mutant MATR3
    Article Snippet: RNA was isolated from quadriceps and spinal cord using Trizol (Invitrogen, catalog #15596026) per manufacturer protocol. .. A DNA probe was made by digesting the PrP vector with Eco RI and Xho I, isolating a 450 bp fragment, which encompassed sequences in the 3′ untranslated segment of the transgene construct, and purifying it with Monarch Gel Extraction kit (New England BioLabs catalog #T1020S). .. This probe for the blots was labeled with α-32 P-dCTP using Rediprime II DNA Labeling System (GE Healthcare Amersham, catalog #RPN1633) and purified using ProbeQuant™ G-50 Micro Columns (GE Healthcare, catalog #28903408), both per manufacturer protocol.

    Article Title: Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
    Article Snippet: Libraries were prepared by PCR using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore) to append barcodes and sequencing primers. .. Libraries were gel purified on agarose gels stained with SYBR safe (Life Technologies), visualised using a blue light source and purified using Monarch DNA Gel Extraction kits (NEB). .. Libraries were then quantified using a Qubit Fluorometer (Thermo Fisher Scientifc).

    Article Title: A Young Drosophila Duplicate Gene Plays Essential Roles in Spermatogenesis by Regulating Several Y-Linked Male Fertility Genes
    Article Snippet: After that, cDNA was ligated to an Illumina PE adapter oligo mix by the Quick ligation kit (Qiagen). .. The adapter-modified cDNA within 200-bp was isolated by agarose gel, extracted with the QIAquick Gel Extraction Kit (NEB), and amplified by PCR reaction. .. Finally, the library products were sequenced using the Illumina GA2 sequencing machine.

    Variant Assay:

    Article Title: Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax
    Article Snippet: Plasmids of each variant were further amplified and purified (as described above) in order to yield high amounts for transfection into the yeast P. pastoris . .. 10 µg of each pPpT4_αS_TvTS vector was digested with a threefold excess of New England Biolabs (NEB) PmeI restriction enzyme for 3 h in a water bath at 310 K. The linearized vector was purified according to the manufacturer’s instructions using an NEB NucleoSpin Extract II Kit (eluted in 20 µl ultrapure water).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs rna
    ATP- and <t>RNA-Dependent</t> SAF-A Oligomerization Cycle (A) Left: Western blot for endogenous SAF-A protein extracted from <t>293T</t> cells treated with or without α-amanitin and stabilized by cross-linking with different concentrations of 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). Proteins were resolved by SDS-PAGE to reveal different SAF-A species (oligomer; D-dimer; M-monomer). Right: Quantification of data in left panel. (B) Left: Western blot for FLAG-tagged SAF-A AAA + /RGG protein expressed in 293T cells and stabilized with different concentrations of disuccinimidyl suberate (DSS). Extracted proteins were resolved by SDS-PAGE. Right: SAF-A wild-type, Walker A, or Walker B mutants expressed in 293T cells, treated with ATP or ATPγS and cross-linked with 0.3 mM BM(PEG)2, extracted, and resolved by SDS-PAGE. (C) 293T cells expressing full-length FLAG-tagged SAF-A pulse-labeled with 5-ethynyl uridine (5-EU) and stabilized with BM(PEG)2. SAF-A was extracted, immuno-purified and resolved by native PAGE. Left: Western blot for SAF-A. Right: RNA detection in SAF-A oligomers. Samples were fractionated by native gel electrophoresis, transferred to membrane, and RNA was labeled by conjugating biotin to pre-incorporated 5-EU using click chemistry and detection using avidin-HRP. (D) Western blot for endogenous SAF-A to analyze protein oligomerization. 293T cells pre-treated with RNaseA, then incubated in the presence or absence of total RNA or apyrase and stabilized by cross-linking with BM(PEG)2. Proteins were extracted and resolved by SDS-PAGE (oligomer; D-dimer; M-monomer). (E) Western blot for FLAG-SAF-A to analyze protein de-oligomerization. Cells were cross-linked with dithio-bis-maleimidoethan (DTME) and stabilized SAF-A was immuno-purified. Cross-links were reversed with DTT, then incubated in the presence of RNase, apyrase, or nucleotides and fractionated by native PAGE. (F) Model for the ATP- and RNA-dependent SAF-A (purple) oligomerization cycle. See also Figure S4 .
    Rna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more England Biolabs
    Average 98 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2019-12
    98/100 stars
      Buy from Supplier

    New England Biolabs monarch nucleic acid purification kit
    ATP- and <t>RNA-Dependent</t> SAF-A Oligomerization Cycle (A) Left: Western blot for endogenous SAF-A protein extracted from <t>293T</t> cells treated with or without α-amanitin and stabilized by cross-linking with different concentrations of 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). Proteins were resolved by SDS-PAGE to reveal different SAF-A species (oligomer; D-dimer; M-monomer). Right: Quantification of data in left panel. (B) Left: Western blot for FLAG-tagged SAF-A AAA + /RGG protein expressed in 293T cells and stabilized with different concentrations of disuccinimidyl suberate (DSS). Extracted proteins were resolved by SDS-PAGE. Right: SAF-A wild-type, Walker A, or Walker B mutants expressed in 293T cells, treated with ATP or ATPγS and cross-linked with 0.3 mM BM(PEG)2, extracted, and resolved by SDS-PAGE. (C) 293T cells expressing full-length FLAG-tagged SAF-A pulse-labeled with 5-ethynyl uridine (5-EU) and stabilized with BM(PEG)2. SAF-A was extracted, immuno-purified and resolved by native PAGE. Left: Western blot for SAF-A. Right: RNA detection in SAF-A oligomers. Samples were fractionated by native gel electrophoresis, transferred to membrane, and RNA was labeled by conjugating biotin to pre-incorporated 5-EU using click chemistry and detection using avidin-HRP. (D) Western blot for endogenous SAF-A to analyze protein oligomerization. 293T cells pre-treated with RNaseA, then incubated in the presence or absence of total RNA or apyrase and stabilized by cross-linking with BM(PEG)2. Proteins were extracted and resolved by SDS-PAGE (oligomer; D-dimer; M-monomer). (E) Western blot for FLAG-SAF-A to analyze protein de-oligomerization. Cells were cross-linked with dithio-bis-maleimidoethan (DTME) and stabilized SAF-A was immuno-purified. Cross-links were reversed with DTT, then incubated in the presence of RNase, apyrase, or nucleotides and fractionated by native PAGE. (F) Model for the ATP- and RNA-dependent SAF-A (purple) oligomerization cycle. See also Figure S4 .
    Monarch Nucleic Acid Purification Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more nucleic acid purification kit/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    monarch nucleic acid purification kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results

    ATP- and RNA-Dependent SAF-A Oligomerization Cycle (A) Left: Western blot for endogenous SAF-A protein extracted from 293T cells treated with or without α-amanitin and stabilized by cross-linking with different concentrations of 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). Proteins were resolved by SDS-PAGE to reveal different SAF-A species (oligomer; D-dimer; M-monomer). Right: Quantification of data in left panel. (B) Left: Western blot for FLAG-tagged SAF-A AAA + /RGG protein expressed in 293T cells and stabilized with different concentrations of disuccinimidyl suberate (DSS). Extracted proteins were resolved by SDS-PAGE. Right: SAF-A wild-type, Walker A, or Walker B mutants expressed in 293T cells, treated with ATP or ATPγS and cross-linked with 0.3 mM BM(PEG)2, extracted, and resolved by SDS-PAGE. (C) 293T cells expressing full-length FLAG-tagged SAF-A pulse-labeled with 5-ethynyl uridine (5-EU) and stabilized with BM(PEG)2. SAF-A was extracted, immuno-purified and resolved by native PAGE. Left: Western blot for SAF-A. Right: RNA detection in SAF-A oligomers. Samples were fractionated by native gel electrophoresis, transferred to membrane, and RNA was labeled by conjugating biotin to pre-incorporated 5-EU using click chemistry and detection using avidin-HRP. (D) Western blot for endogenous SAF-A to analyze protein oligomerization. 293T cells pre-treated with RNaseA, then incubated in the presence or absence of total RNA or apyrase and stabilized by cross-linking with BM(PEG)2. Proteins were extracted and resolved by SDS-PAGE (oligomer; D-dimer; M-monomer). (E) Western blot for FLAG-SAF-A to analyze protein de-oligomerization. Cells were cross-linked with dithio-bis-maleimidoethan (DTME) and stabilized SAF-A was immuno-purified. Cross-links were reversed with DTT, then incubated in the presence of RNase, apyrase, or nucleotides and fractionated by native PAGE. (F) Model for the ATP- and RNA-dependent SAF-A (purple) oligomerization cycle. See also Figure S4 .

    Journal: Cell

    Article Title: SAF-A Regulates Interphase Chromosome Structure through Oligomerization with Chromatin-Associated RNAs

    doi: 10.1016/j.cell.2017.05.029

    Figure Lengend Snippet: ATP- and RNA-Dependent SAF-A Oligomerization Cycle (A) Left: Western blot for endogenous SAF-A protein extracted from 293T cells treated with or without α-amanitin and stabilized by cross-linking with different concentrations of 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). Proteins were resolved by SDS-PAGE to reveal different SAF-A species (oligomer; D-dimer; M-monomer). Right: Quantification of data in left panel. (B) Left: Western blot for FLAG-tagged SAF-A AAA + /RGG protein expressed in 293T cells and stabilized with different concentrations of disuccinimidyl suberate (DSS). Extracted proteins were resolved by SDS-PAGE. Right: SAF-A wild-type, Walker A, or Walker B mutants expressed in 293T cells, treated with ATP or ATPγS and cross-linked with 0.3 mM BM(PEG)2, extracted, and resolved by SDS-PAGE. (C) 293T cells expressing full-length FLAG-tagged SAF-A pulse-labeled with 5-ethynyl uridine (5-EU) and stabilized with BM(PEG)2. SAF-A was extracted, immuno-purified and resolved by native PAGE. Left: Western blot for SAF-A. Right: RNA detection in SAF-A oligomers. Samples were fractionated by native gel electrophoresis, transferred to membrane, and RNA was labeled by conjugating biotin to pre-incorporated 5-EU using click chemistry and detection using avidin-HRP. (D) Western blot for endogenous SAF-A to analyze protein oligomerization. 293T cells pre-treated with RNaseA, then incubated in the presence or absence of total RNA or apyrase and stabilized by cross-linking with BM(PEG)2. Proteins were extracted and resolved by SDS-PAGE (oligomer; D-dimer; M-monomer). (E) Western blot for FLAG-SAF-A to analyze protein de-oligomerization. Cells were cross-linked with dithio-bis-maleimidoethan (DTME) and stabilized SAF-A was immuno-purified. Cross-links were reversed with DTT, then incubated in the presence of RNase, apyrase, or nucleotides and fractionated by native PAGE. (F) Model for the ATP- and RNA-dependent SAF-A (purple) oligomerization cycle. See also Figure S4 .

    Article Snippet: For D, after pre-treatment with 3 μ PureLink RNaseA (ThermoFisher) in reaction buffer at 37°C for 10 min, 293T cell lysates were incubated in the presence or absence of 30 μ total RNA from 293T cells and 5 Apyrase (NEB) at 37°C for 10 min, following by crosslinking.

    Techniques: Western Blot, SDS Page, Expressing, Labeling, Purification, Clear Native PAGE, RNA Detection, Nucleic Acid Electrophoresis, Avidin-Biotin Assay, Incubation