molony murine leukaemia virus reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Thermo Fisher molony murine leukaemia virus reverse transcriptase
    Molony Murine Leukaemia Virus Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/molony murine leukaemia virus reverse transcriptase/product/Thermo Fisher
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    molony murine leukaemia virus reverse transcriptase - by Bioz Stars, 2020-05
    88/100 stars

    Images

    Related Articles

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Stable Expression of mtlD Gene Imparts Multiple Stress Tolerance in Finger Millet
    Article Snippet: .. RT-PCR Total RNA was extracted according to the protocol described by Datta et al. (1989) and first strand cDNA was synthesized by oligo (dT) primers using Molony Murine Leukaemia Virus reverse transcriptase (MMLV-RT; MBI Fermentas, Hanover, MD, USA) according to manufacturer's instructions. .. The cDNA pool was used as a template to perform RT- PCR analysis using the following primers Actin-F tccataatgaagtgtgatgt , Actin-R ggacctgactcgtcatactc .and mtlD F- caagcatgcggcgtacatcc, mtlD R- gcggatcatcttcactgcggaa.

    Expressing:

    Article Title: Overexpression of EcbHLH57 Transcription Factor from Eleusine coracana L. in Tobacco Confers Tolerance to Salt, Oxidative and Drought Stress
    Article Snippet: .. Gene expression analysis Total RNA was extracted according to the protocol described by Datta et al. [ ] and first strand cDNA was synthesized by oligo (dT) primers using Molony Murine Leukaemia Virus reverse transcriptase (MMLV-RT; MBI Fermentas, Hanover, MD, USA) according to manufacturer’s instructions. .. The cDNA pool was used as a template to perform RT- PCR analysis.

    Synthesized:

    Article Title: Transcriptome Analysis of Sunflower Genotypes with Contrasting Oxidative Stress Tolerance Reveals Individual- and Combined- Biotic and Abiotic Stress Tolerance Mechanisms
    Article Snippet: .. First strand cDNA was synthesized by oligo (18 mer dT) primers using Molony murine leukaemia virus reverse transcriptase (MMLV-RT; MBI Fermentas, Hanover, MD, USA) according to manufacturer’s instructions. .. The cDNA pool was used as a template to perform RT-qPCR analysis.

    Article Title: Overexpression of EcbHLH57 Transcription Factor from Eleusine coracana L. in Tobacco Confers Tolerance to Salt, Oxidative and Drought Stress
    Article Snippet: .. Gene expression analysis Total RNA was extracted according to the protocol described by Datta et al. [ ] and first strand cDNA was synthesized by oligo (dT) primers using Molony Murine Leukaemia Virus reverse transcriptase (MMLV-RT; MBI Fermentas, Hanover, MD, USA) according to manufacturer’s instructions. .. The cDNA pool was used as a template to perform RT- PCR analysis.

    Article Title: Stable Expression of mtlD Gene Imparts Multiple Stress Tolerance in Finger Millet
    Article Snippet: .. RT-PCR Total RNA was extracted according to the protocol described by Datta et al. (1989) and first strand cDNA was synthesized by oligo (dT) primers using Molony Murine Leukaemia Virus reverse transcriptase (MMLV-RT; MBI Fermentas, Hanover, MD, USA) according to manufacturer's instructions. .. The cDNA pool was used as a template to perform RT- PCR analysis using the following primers Actin-F tccataatgaagtgtgatgt , Actin-R ggacctgactcgtcatactc .and mtlD F- caagcatgcggcgtacatcc, mtlD R- gcggatcatcttcactgcggaa.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher molony murine leukemia virus reverse transcriptase
    Molony Murine Leukemia Virus Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/molony murine leukemia virus reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    molony murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    85
    Thermo Fisher molony murine leukemia virus reverse transcriptase enzyme
    Molony Murine Leukemia Virus Reverse Transcriptase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/molony murine leukemia virus reverse transcriptase enzyme/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    molony murine leukemia virus reverse transcriptase enzyme - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    Image Search Results