molony murine leukaemia virus reverse transcriptase  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Reverse Transcription System
    Description:
    Transcribes cDNA from RNA in as little as 15 minutes
    Catalog Number:
    a3500
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR RT PCR
    Buy from Supplier


    Structured Review

    Promega molony murine leukaemia virus reverse transcriptase
    Transcribes cDNA from RNA in as little as 15 minutes
    https://www.bioz.com/result/molony murine leukaemia virus reverse transcriptase/product/Promega
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    molony murine leukaemia virus reverse transcriptase - by Bioz Stars, 2020-11
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Transcriptome Analysis of PPAR? Target Genes Reveals the Involvement of Lysyl Oxidase in Human Placental Cytotrophoblast Invasion
    Article Snippet: .. Absolute quantitative RT-qPCR Absolute RT-qPCR was used to estimate the LOX isoform RNA copy number in 48-h primary EVCT cultures, using specific primers ( ). cDNAs of LOX and LOXL1 were obtained by reverse transcription of total RNA extracted from placental villi and amplification by Go Taq DNA polymerase (Promega, Madison, WI). ..

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: .. For reverse transcription-PCR (RT-PCR), first-strand cDNA was produced with an oligo (dT) primer from 1.0 μg of total RNA using avian myeloblastosis virus reverse transcriptase (Promega) at 42°C for 60 min. A 1.0 μl aliquot of the resultant cDNA was amplified using primers specific for β-actin (Fwd - 5′-CGAGGTATCCTCACCCTCAA-3′; Rev - 5′-GCGACTCGCAACTCATTGTA-3′) and Ov-apr-1 (Fwd - 5′-CATAGGAACACCGCCTCAGT -3′; Rev - 5′-GTGATGCAGCCAACAAGCTA-3′) based on the following conditions: 30 sec denaturation at 94°C, 30 sec annealing at 55°C, and 30 sec extension at 72°C for 30 cycles. .. Control RT-PCR reactions were performed without reverse transcriptase to ensure that amplified products were derived from cDNA and not contaminating genomic DNA.

    Isolation:

    Article Title: Zebrafish nephrogenesis involves dynamic spatiotemporal expression changes in renal progenitors and essential signals from retinoic acid and irx3b
    Article Snippet: .. A panel of 239 CA simple sequence length polymorphisms (SSLP) markers were used to scan chromosomes and establish linkage as described ( ). aldh1a2 transcripts were isolated from wild-types and lib by reverse transcription PCR, using the following primers: forward ATGACCTCCAGTG-AAGTTGAACTG and reverse, TTAAGACGTCTTGCCTGACATCTT, and subcloned into pGEMT-easy (Promega) for sequence analysis. .. For lib rescues (and aldh1a2 expression studies, see below), full-length wild-type aldh1a2 was subcloned into the pCS2 expression vector using the EcoRI and XhoI sites.

    Article Title: Type IV Pilus Biogenesis, Twitching Motility, and DNA Uptake in Thermus thermophilus: Discrete Roles of Antagonistic ATPases PilF, PilT1, and PilT2
    Article Snippet: .. Briefly, for reverse transcription-PCR (RT-PCR), total Thermus RNA was isolated from cells harvested in the exponential growth phase by use of a NucleoSpin RNA cleanup kit and treated with RQ1 RNase-free DNase (Promega, Mannheim, Germany) to remove genomic DNA. ..

    Size-exclusion Chromatography:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: .. For reverse transcription-PCR (RT-PCR), first-strand cDNA was produced with an oligo (dT) primer from 1.0 μg of total RNA using avian myeloblastosis virus reverse transcriptase (Promega) at 42°C for 60 min. A 1.0 μl aliquot of the resultant cDNA was amplified using primers specific for β-actin (Fwd - 5′-CGAGGTATCCTCACCCTCAA-3′; Rev - 5′-GCGACTCGCAACTCATTGTA-3′) and Ov-apr-1 (Fwd - 5′-CATAGGAACACCGCCTCAGT -3′; Rev - 5′-GTGATGCAGCCAACAAGCTA-3′) based on the following conditions: 30 sec denaturation at 94°C, 30 sec annealing at 55°C, and 30 sec extension at 72°C for 30 cycles. .. Control RT-PCR reactions were performed without reverse transcriptase to ensure that amplified products were derived from cDNA and not contaminating genomic DNA.

    Quantitative RT-PCR:

    Article Title: Transcriptome Analysis of PPAR? Target Genes Reveals the Involvement of Lysyl Oxidase in Human Placental Cytotrophoblast Invasion
    Article Snippet: .. Absolute quantitative RT-qPCR Absolute RT-qPCR was used to estimate the LOX isoform RNA copy number in 48-h primary EVCT cultures, using specific primers ( ). cDNAs of LOX and LOXL1 were obtained by reverse transcription of total RNA extracted from placental villi and amplification by Go Taq DNA polymerase (Promega, Madison, WI). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Aspergillus fumigatus Survival in Alkaline and Extreme Zinc-Limiting Environments Relies on the Induction of a Zinc Homeostasis System Encoded by the zrfC and aspf2 Genes ▿ Genes ▿ †
    Article Snippet: .. The cDNA of zrfC was obtained by reverse transcription (RT)-PCR using oligonucleotides JA299 (for retrotranscription) and JA60 and JA54 (both for PCR), and a 1.6-kb cDNA fragment was subcloned into pGEM-T Easy (Promega) to generate plasmid pZRF30 and sequenced. .. The cDNA of aspf2 was obtained by RT-PCR using oligonucleotides JA8 (for retrotranscription) and JA166 and JA167 (both for PCR), and a 0.96-kb cDNA fragment was subcloned into pGEM-T Easy to generate plasmid pASPF23 and sequenced.

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: .. For reverse transcription-PCR (RT-PCR), first-strand cDNA was produced with an oligo (dT) primer from 1.0 μg of total RNA using avian myeloblastosis virus reverse transcriptase (Promega) at 42°C for 60 min. A 1.0 μl aliquot of the resultant cDNA was amplified using primers specific for β-actin (Fwd - 5′-CGAGGTATCCTCACCCTCAA-3′; Rev - 5′-GCGACTCGCAACTCATTGTA-3′) and Ov-apr-1 (Fwd - 5′-CATAGGAACACCGCCTCAGT -3′; Rev - 5′-GTGATGCAGCCAACAAGCTA-3′) based on the following conditions: 30 sec denaturation at 94°C, 30 sec annealing at 55°C, and 30 sec extension at 72°C for 30 cycles. .. Control RT-PCR reactions were performed without reverse transcriptase to ensure that amplified products were derived from cDNA and not contaminating genomic DNA.

    Article Title: Locus-Specific Ribosomal RNA Gene Silencing in Nucleolar Dominance
    Article Snippet: .. Total RNA to be used in reverse transcription (RT) PCR was digested with RQ1 DNase (Promega) to eliminate contaminating genomic DNA. .. RT reactions contained 1–2.5 ug RNA, 120 ng random hexamers, 0.5 mM dNTPs, and 200 units of reverse transcriptase (Superscript II, Invitrogen) in a 10–20 ul reaction.

    Article Title: Analysis of Transcription of the Staphylococcus aureus Aerobic Class Ib and Anaerobic Class III Ribonucleotide Reductase Genes in Response to Oxygen
    Article Snippet: .. For reverse transcription (RT)-PCR and primer extension, residual DNA was removed by treatment with RQ1 RNase-free DNase (Promega). .. RNA concentrations were determined by A 260 measurements, and RNA integrity was analyzed by agarose/formaldehyde gel electrophoresis ( ).

    Article Title: Contributions of MexAB-OprM and an EmrE Homolog to Intrinsic Resistance of Pseudomonas aeruginosa to Aminoglycosides and Dyes
    Article Snippet: .. After treatment of the RNA samples with RNase-free DNase (Promega; 2 U of enzyme/μg RNA for 60 min at 37°C), the DNase was inactivated at 65°C for 20 min. A 0.1-μg sample of DNase-treated RNA was used as a template for reverse transcription-PCR (RT-PCR) with the Promega access RT-PCR system according to the protocol supplied by the manufacturer. .. A pair of primers specific for and internal to emrE (paemre8xz, 5′-CCGCCATGACCAACTATCTC-3′ [forward]; and paemre9xz, 5′-GCTGGCCGTAGACGAACATC-3′ [reverse]) was used to amplify mRNA as a measure of emrE Pae expression.

    Article Title: Type IV Pilus Biogenesis, Twitching Motility, and DNA Uptake in Thermus thermophilus: Discrete Roles of Antagonistic ATPases PilF, PilT1, and PilT2
    Article Snippet: .. Briefly, for reverse transcription-PCR (RT-PCR), total Thermus RNA was isolated from cells harvested in the exponential growth phase by use of a NucleoSpin RNA cleanup kit and treated with RQ1 RNase-free DNase (Promega, Mannheim, Germany) to remove genomic DNA. ..

    Produced:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: .. For reverse transcription-PCR (RT-PCR), first-strand cDNA was produced with an oligo (dT) primer from 1.0 μg of total RNA using avian myeloblastosis virus reverse transcriptase (Promega) at 42°C for 60 min. A 1.0 μl aliquot of the resultant cDNA was amplified using primers specific for β-actin (Fwd - 5′-CGAGGTATCCTCACCCTCAA-3′; Rev - 5′-GCGACTCGCAACTCATTGTA-3′) and Ov-apr-1 (Fwd - 5′-CATAGGAACACCGCCTCAGT -3′; Rev - 5′-GTGATGCAGCCAACAAGCTA-3′) based on the following conditions: 30 sec denaturation at 94°C, 30 sec annealing at 55°C, and 30 sec extension at 72°C for 30 cycles. .. Control RT-PCR reactions were performed without reverse transcriptase to ensure that amplified products were derived from cDNA and not contaminating genomic DNA.

    Polymerase Chain Reaction:

    Article Title: Aspergillus fumigatus Survival in Alkaline and Extreme Zinc-Limiting Environments Relies on the Induction of a Zinc Homeostasis System Encoded by the zrfC and aspf2 Genes ▿ Genes ▿ †
    Article Snippet: .. The cDNA of zrfC was obtained by reverse transcription (RT)-PCR using oligonucleotides JA299 (for retrotranscription) and JA60 and JA54 (both for PCR), and a 1.6-kb cDNA fragment was subcloned into pGEM-T Easy (Promega) to generate plasmid pZRF30 and sequenced. .. The cDNA of aspf2 was obtained by RT-PCR using oligonucleotides JA8 (for retrotranscription) and JA166 and JA167 (both for PCR), and a 0.96-kb cDNA fragment was subcloned into pGEM-T Easy to generate plasmid pASPF23 and sequenced.

    Article Title: Zebrafish nephrogenesis involves dynamic spatiotemporal expression changes in renal progenitors and essential signals from retinoic acid and irx3b
    Article Snippet: .. A panel of 239 CA simple sequence length polymorphisms (SSLP) markers were used to scan chromosomes and establish linkage as described ( ). aldh1a2 transcripts were isolated from wild-types and lib by reverse transcription PCR, using the following primers: forward ATGACCTCCAGTG-AAGTTGAACTG and reverse, TTAAGACGTCTTGCCTGACATCTT, and subcloned into pGEMT-easy (Promega) for sequence analysis. .. For lib rescues (and aldh1a2 expression studies, see below), full-length wild-type aldh1a2 was subcloned into the pCS2 expression vector using the EcoRI and XhoI sites.

    Sequencing:

    Article Title: Zebrafish nephrogenesis involves dynamic spatiotemporal expression changes in renal progenitors and essential signals from retinoic acid and irx3b
    Article Snippet: .. A panel of 239 CA simple sequence length polymorphisms (SSLP) markers were used to scan chromosomes and establish linkage as described ( ). aldh1a2 transcripts were isolated from wild-types and lib by reverse transcription PCR, using the following primers: forward ATGACCTCCAGTG-AAGTTGAACTG and reverse, TTAAGACGTCTTGCCTGACATCTT, and subcloned into pGEMT-easy (Promega) for sequence analysis. .. For lib rescues (and aldh1a2 expression studies, see below), full-length wild-type aldh1a2 was subcloned into the pCS2 expression vector using the EcoRI and XhoI sites.

    Plasmid Preparation:

    Article Title: Aspergillus fumigatus Survival in Alkaline and Extreme Zinc-Limiting Environments Relies on the Induction of a Zinc Homeostasis System Encoded by the zrfC and aspf2 Genes ▿ Genes ▿ †
    Article Snippet: .. The cDNA of zrfC was obtained by reverse transcription (RT)-PCR using oligonucleotides JA299 (for retrotranscription) and JA60 and JA54 (both for PCR), and a 1.6-kb cDNA fragment was subcloned into pGEM-T Easy (Promega) to generate plasmid pZRF30 and sequenced. .. The cDNA of aspf2 was obtained by RT-PCR using oligonucleotides JA8 (for retrotranscription) and JA166 and JA167 (both for PCR), and a 0.96-kb cDNA fragment was subcloned into pGEM-T Easy to generate plasmid pASPF23 and sequenced.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega molony murine leukemia virus reverse transcriptase
    Molony Murine Leukemia Virus Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/molony murine leukemia virus reverse transcriptase/product/Promega
    Average 99 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    molony murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    Image Search Results