moloney murine leukemia virus  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher moloney murine leukemia virus
    Moloney Murine Leukemia Virus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 158 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more murine leukemia virus/product/Thermo Fisher
    Average 99 stars, based on 158 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus - by Bioz Stars, 2020-12
    99/100 stars


    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.


    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.


    Article Title: Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene
    Article Snippet: .. Total RNA was isolated using Trizol (Invitrogen) and analyzed for splice products using reverse transcriptase–PCR. cDNAs were transcribed from RNA by Thermoscript reverse transcriptase (Invitrogen) using random hexamers as primers. .. PCR reactions were performed using 30 amplification cycles, the PCR products were extracted, separated by electrophoresis on 1.5% agarose gels, and visualized by ethidium bromide staining and under UV light.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Digital PCR:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Quantitation Assay:

    Article Title: Development of live attenuated Enterovirus 71 vaccine strains that confer protection against lethal challenge in mice
    Article Snippet: .. The real-time reverse transcriptase PCR was performed with the TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems, Calif., USA) utilizing the primers and the TaqMan probe designed for the quantitation of viral RNA copy number determination. ..

    Polymerase Chain Reaction:

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Nucleocytosolic Depletion of the Energy Metabolite Acetyl-Coenzyme A Stimulates Autophagy and Prolongs Lifespan
    Article Snippet: .. Quantitative Reverse-Transcriptase PCR Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method with 18S rRNA as an internal standard was performed on an ABI StepOnePlus using SYBR Select Master Mix (Life Tech, Invitrogen) ΔΔCt-method. .. Drosophila Lifespan Analyses and Brain Immunofluorescence UAS-RNAi lines for acetyl-CoA Synthetase (P{TRiP.HMS02314}attP2) and EGFP (P{VALIUM20-EGFP.shRNA.1}attP2) serving as a background-matched control were obtained from Bloomington Drosophila Stock Center.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Development of live attenuated Enterovirus 71 vaccine strains that confer protection against lethal challenge in mice
    Article Snippet: .. The real-time reverse transcriptase PCR was performed with the TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems, Calif., USA) utilizing the primers and the TaqMan probe designed for the quantitation of viral RNA copy number determination. ..

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.


    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher m mulv rt
    M Mulv Rt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more mulv rt/product/Thermo Fisher
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    m mulv rt - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    Thermo Fisher m mulv reverse transcriptase
    M Mulv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 167 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more mulv reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 167 article reviews
    Price from $9.99 to $1999.99
    m mulv reverse transcriptase - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    Image Search Results