moloney murine leukemia virus reverse transcriptase  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    M MLV Reverse Transcriptase 200 U µL
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    Catalog Number:
    PCR & Real-Time PCR|Reverse Transcription
    Proteins Enzymes Peptides
    Buy from Supplier

    Structured Review

    Thermo Fisher moloney murine leukemia virus reverse transcriptase
    Quantification of MHC class I and class II mRNA by RT-PCR. Increasing amounts (7.5 to 60 ng, quantified by OD, as indicated under the lanes) of total RNA extracted from human monocytes were employed in reverse transcription with <t>Moloney</t> murine leukemia virus reverse transcriptase for 1 h, followed by PCR in the same tube (100-μl final volume, 25 cycles). RT-PCR was performed in duplicate with each of the indicated total RNA amounts. Specific primers for conserved regions in MHC class I and class II genes were utilized to obtain PCR products of 118 and 81 bp, respectively. PCR products were separated on a 3% agarose gel and stained with ethidium bromide. DNA size standards are indicated on the right.
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C murine leukemia virus reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 871 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-08
    99/100 stars


    1) Product Images from "Phagocytosis of the Malarial Pigment, Hemozoin, Impairs Expression of Major Histocompatibility Complex Class II Antigen, CD54, and CD11c in Human Monocytes"

    Article Title: Phagocytosis of the Malarial Pigment, Hemozoin, Impairs Expression of Major Histocompatibility Complex Class II Antigen, CD54, and CD11c in Human Monocytes

    Journal: Infection and Immunity


    Quantification of MHC class I and class II mRNA by RT-PCR. Increasing amounts (7.5 to 60 ng, quantified by OD, as indicated under the lanes) of total RNA extracted from human monocytes were employed in reverse transcription with Moloney murine leukemia virus reverse transcriptase for 1 h, followed by PCR in the same tube (100-μl final volume, 25 cycles). RT-PCR was performed in duplicate with each of the indicated total RNA amounts. Specific primers for conserved regions in MHC class I and class II genes were utilized to obtain PCR products of 118 and 81 bp, respectively. PCR products were separated on a 3% agarose gel and stained with ethidium bromide. DNA size standards are indicated on the right.
    Figure Legend Snippet: Quantification of MHC class I and class II mRNA by RT-PCR. Increasing amounts (7.5 to 60 ng, quantified by OD, as indicated under the lanes) of total RNA extracted from human monocytes were employed in reverse transcription with Moloney murine leukemia virus reverse transcriptase for 1 h, followed by PCR in the same tube (100-μl final volume, 25 cycles). RT-PCR was performed in duplicate with each of the indicated total RNA amounts. Specific primers for conserved regions in MHC class I and class II genes were utilized to obtain PCR products of 118 and 81 bp, respectively. PCR products were separated on a 3% agarose gel and stained with ethidium bromide. DNA size standards are indicated on the right.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    2) Product Images from "Expression of the Open Reading Frame 74 (G-Protein-Coupled Receptor) Gene of Kaposi's Sarcoma (KS)-Associated Herpesvirus: Implications for KS Pathogenesis"

    Article Title: Expression of the Open Reading Frame 74 (G-Protein-Coupled Receptor) Gene of Kaposi's Sarcoma (KS)-Associated Herpesvirus: Implications for KS Pathogenesis

    Journal: Journal of Virology


    RT-PCR analysis of K14 and GCR to search for alternatively spliced GCR RNAs. (A) PCR products resulting from reverse transcription and subsequent amplification of BCBL-1 TPA-treated RNA (lanes 2 and 3). RNA was annealed to primer GCRcR (B), and cDNA synthesis was undertaken in the presence (lane 2) or absence (lane 3) of Moloney murine leukemia virus reverse transcriptase (RT). PCR amplification of this cDNA with the primers K9 and GCR1 (B) was performed; the products were electrophoresed on a 1% agarose gel and stained with ethidium bromide. Molecular weight standards are shown in lane 1. (B) Diagram of the K14-GCR region and the primers used in the experiment represented in panel A.
    Figure Legend Snippet: RT-PCR analysis of K14 and GCR to search for alternatively spliced GCR RNAs. (A) PCR products resulting from reverse transcription and subsequent amplification of BCBL-1 TPA-treated RNA (lanes 2 and 3). RNA was annealed to primer GCRcR (B), and cDNA synthesis was undertaken in the presence (lane 2) or absence (lane 3) of Moloney murine leukemia virus reverse transcriptase (RT). PCR amplification of this cDNA with the primers K9 and GCR1 (B) was performed; the products were electrophoresed on a 1% agarose gel and stained with ethidium bromide. Molecular weight standards are shown in lane 1. (B) Diagram of the K14-GCR region and the primers used in the experiment represented in panel A.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining, Molecular Weight

    3) Product Images from "Expression and alteration of insulin-like growth factor II-messenger RNA in hepatoma tissues and peripheral blood of patients with hepatocellular carcinoma"

    Article Title: Expression and alteration of insulin-like growth factor II-messenger RNA in hepatoma tissues and peripheral blood of patients with hepatocellular carcinoma

    Journal: World Journal of Gastroenterology : WJG

    doi: 10.3748/wjg.v11.i30.4655

    Amplification of IGF-II genomes from human hepatoma tissues or circulating blood samples of patients with hepatocellular carcinoma. IGF-II mRNAs were synthesized according to IGF-II cDNA with random hexamers and moloney murine leukemia virus reverse-transcriptase, and detected with different primer pairs by nested PCR (170 bp). The positive fragments of IGF-II genome were found distinctly in hepatoma tissues or in peripheral blood of patients with hepatocellular carcinoma. A: the sensitive limitation of our detection system (2 ng/L), using total RNA with 10 -2 -10 -8 fold dilution and then amplified by nested PCR; B: the amplified fragments (452 bp) of glyceraldehyde-3-phosphate dehydrogenase genome from liver tissues or peripheral blood as controls; C: the amplification of IGF-II genomes in liver tissues (No. 1-4) or circulating blood (No. 5-6). No. 1-2, the positively amplified fragments of IGF-II mRNA from cancerous tissues of patients with hepatocellular carcinoma; No. 3, the positively amplified fragments of IGF-II mRNA from para-cancerous tissue of patients with hepatocellular carcinoma; No. 4, no positively amplified fragment from non-cancerous tissue of patients with hepatocellular carcinoma; No. 5, no positively amplified fragment from circulating blood of patients with liver cirrhosis, and No. 6, the positively amplified fragment from peripheral blood of patients with hepatocellular carcinoma. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. M: DNA molecular weight marker.
    Figure Legend Snippet: Amplification of IGF-II genomes from human hepatoma tissues or circulating blood samples of patients with hepatocellular carcinoma. IGF-II mRNAs were synthesized according to IGF-II cDNA with random hexamers and moloney murine leukemia virus reverse-transcriptase, and detected with different primer pairs by nested PCR (170 bp). The positive fragments of IGF-II genome were found distinctly in hepatoma tissues or in peripheral blood of patients with hepatocellular carcinoma. A: the sensitive limitation of our detection system (2 ng/L), using total RNA with 10 -2 -10 -8 fold dilution and then amplified by nested PCR; B: the amplified fragments (452 bp) of glyceraldehyde-3-phosphate dehydrogenase genome from liver tissues or peripheral blood as controls; C: the amplification of IGF-II genomes in liver tissues (No. 1-4) or circulating blood (No. 5-6). No. 1-2, the positively amplified fragments of IGF-II mRNA from cancerous tissues of patients with hepatocellular carcinoma; No. 3, the positively amplified fragments of IGF-II mRNA from para-cancerous tissue of patients with hepatocellular carcinoma; No. 4, no positively amplified fragment from non-cancerous tissue of patients with hepatocellular carcinoma; No. 5, no positively amplified fragment from circulating blood of patients with liver cirrhosis, and No. 6, the positively amplified fragment from peripheral blood of patients with hepatocellular carcinoma. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. M: DNA molecular weight marker.

    Techniques Used: Amplification, Synthesized, Nested PCR, Molecular Weight, Marker

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.


    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.


    Article Title: Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene
    Article Snippet: .. Total RNA was isolated using Trizol (Invitrogen) and analyzed for splice products using reverse transcriptase–PCR. cDNAs were transcribed from RNA by Thermoscript reverse transcriptase (Invitrogen) using random hexamers as primers. .. PCR reactions were performed using 30 amplification cycles, the PCR products were extracted, separated by electrophoresis on 1.5% agarose gels, and visualized by ethidium bromide staining and under UV light.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Digital PCR:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Polymerase Chain Reaction:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Article Title: Expression and activity of eIF6 trigger Malignant Pleural Mesothelioma growth in vivo
    Article Snippet: .. Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method using Taqman Universal PCR Master Mix (4304437; Life Technologies) was performed on an ABIPRISM 7900HT Sequence Detection System (Applied Biosystems). .. Cell proliferation, cell cycle and cell death analysis Proliferation rate of MPM cells was analysed by MTT test: briefly, cells were plated in 96 wells plates at different concentrations, and assayed after 24, 48 and 72 hours.

    Article Title: Nucleocytosolic Depletion of the Energy Metabolite Acetyl-Coenzyme A Stimulates Autophagy and Prolongs Lifespan
    Article Snippet: .. Quantitative Reverse-Transcriptase PCR Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method with 18S rRNA as an internal standard was performed on an ABI StepOnePlus using SYBR Select Master Mix (Life Tech, Invitrogen) ΔΔCt-method. .. Drosophila Lifespan Analyses and Brain Immunofluorescence UAS-RNAi lines for acetyl-CoA Synthetase (P{TRiP.HMS02314}attP2) and EGFP (P{VALIUM20-EGFP.shRNA.1}attP2) serving as a background-matched control were obtained from Bloomington Drosophila Stock Center.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.


    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.


    Article Title: Expression and activity of eIF6 trigger Malignant Pleural Mesothelioma growth in vivo
    Article Snippet: .. Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method using Taqman Universal PCR Master Mix (4304437; Life Technologies) was performed on an ABIPRISM 7900HT Sequence Detection System (Applied Biosystems). .. Cell proliferation, cell cycle and cell death analysis Proliferation rate of MPM cells was analysed by MTT test: briefly, cells were plated in 96 wells plates at different concentrations, and assayed after 24, 48 and 72 hours.


    Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
    Article Snippet: .. Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. Binding reactions were performed in RNA binding buffer (10 mM Tris-HCl (pH 7.4), 10 mM KCl, 1 mM MgCl2 ).


    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher moloney murine leukaemia virus reverse transcriptase
    Moloney Murine Leukaemia Virus Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more murine leukaemia virus reverse transcriptase/product/Thermo Fisher
    Average 93 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukaemia virus reverse transcriptase - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Thermo Fisher moloney murine leukemia virus mmlv reverse transcriptase
    Moloney Murine Leukemia Virus Mmlv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 874 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more murine leukemia virus mmlv reverse transcriptase/product/Thermo Fisher
    Average 88 stars, based on 874 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus mmlv reverse transcriptase - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Thermo Fisher recombinant moloney murine leukemia virus reverse transcriptase
    Recombinant Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more moloney murine leukemia virus reverse transcriptase/product/Thermo Fisher
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Image Search Results