moloney murine leukemia virus reverse transcriptase  (Roche)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Roche moloney murine leukemia virus reverse transcriptase
    Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase/product/Roche
    Average 92 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-08
    92/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: 7α-Hydroxycholesterol induces monocyte/macrophage cell expression of interleukin-8 via C5a receptor
    Article Snippet: .. Reverse transcription (RT)-polymerase chain reaction (PCR) After reverse-transcription of total RNAs for 1 h at 42°C with Moloney Murine Leukemia Virus reverse transcriptase, transcripts of the IL-8 gene were amplified by RT-PCR or assessed by real-time PCR using a LightCycler® 96 Real-Time PCR System (Roche, Germany) as described [ ]. .. PCR was performed using Taq PCR Kit.

    Amplification:

    Article Title: Dopamine Specifically Inhibits Forebrain Neural Stem Cell Proliferation, Suggesting a Novel Effect of Antipsychotic Drugs
    Article Snippet: .. Total neurosphere RNA was isolated (RNeasy extraction kit; Qiagen, Hilden, Germany), and 1 μg of total RNA was used to synthesize cDNA with oligo-dT 12-18 primers and Moloney murine leukemia virus reverse transcriptase (Superscript II; Roche Products, Welwyn Garden City, UK) in a 25 μl reaction mixture at 42°C for 1 h. The PCR mixture (20 μl) consisted of 1 μl of cDNA, 16 pmol each of 5′ and 3′ primers, 0.2 m m dNTP, 1.5 m m Mg2+ , 2 μl of PCR buffer, and 0.8 U of Taq polymerase (Promega, Madison, WI). cDNA was amplified in a thermal cycler (PerkinElmer, Wellesley, MA) with 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 40 s, and extension at 72°C for 40 s. The primers against D2 R cDNA used were as follows: sense, 5′-GTAGCAGCCGAGCTTTCAG-3′; and antisense, 3′-GGGATGTTGCAGTCACAGTG-5′. .. This pair of primers was designed to encompass at least one intron to avoid false-positive amplification from contaminated genomic DNA.

    Article Title: 7α-Hydroxycholesterol induces monocyte/macrophage cell expression of interleukin-8 via C5a receptor
    Article Snippet: .. Reverse transcription (RT)-polymerase chain reaction (PCR) After reverse-transcription of total RNAs for 1 h at 42°C with Moloney Murine Leukemia Virus reverse transcriptase, transcripts of the IL-8 gene were amplified by RT-PCR or assessed by real-time PCR using a LightCycler® 96 Real-Time PCR System (Roche, Germany) as described [ ]. .. PCR was performed using Taq PCR Kit.

    Synthesized:

    Article Title: Severe Global DNA Hypomethylation Blocks Differentiation and Induces Histone Hyperacetylation in Embryonic Stem Cells
    Article Snippet: .. cDNA was synthesized from total RNA using oligo(dT) and Moloney murine leukemia virus reverse transcriptase (Roche). .. The PCR primers were as follows: Oct4, 5′GGCGTTCTCTTTGGAAAGGTGTTC3′ and 5′CTCGAACCACATCCTTCTCT3′; β H1-globin , 5′AGTCCCCATGGAGTCAAAGA3′ and 5′CTCAAGGAGACCTTTGCTCA3′; α -globin , 5′CTCTCTGGGGAAGACAAAAGCAAC3′ and 5′GGTGGCTAGCCAAGGTCACCAGCA3′; Xist , 5′GTAACTCATCCCAGTGCAGG3′ and 5′CTGTATAGGCTGCAGG3′; Hnf4a , 5′ACACGTCCCCATCTGAAG3′ and 5′CTTCCTTCTTCATGCCAG3′; PL-1, 5′AGCTGACTTTGAATCTTTCAGGCTCCG3′ and 5′TTATGGATGTCCCTTTTAATGCAGCGGC3′; Tpbpa , 5′AATCTTCCTAGTCATCCTATGCC3′ and 5′CGCCACTCTCTGTGTAATCC3′; Albumin , 5′GATGAAACATATGTCCCCAAAGA3′ and 5′TGTGTTCCTAGGGTGTTGATTTTA3′; Hprt , 5′GCCTGTATCCAACACTTCG3′ and 5′AGCGTCGTGATTAGCGATG3′; β- tubulin , 5′GGAACATAGCCGTAAACTGC3′ and 5′TCACTGTGCCTGAACTTACC3′; Brachyury , 5′ATGCCAAAGAAAGAAACGAC3′ and 5′AGAGGCTGTAGAACATGATT3′; and Gapdh , 5′GGGTGGAGCCAAACGGGTC3′ and 5′GGAGTTGCTGTTGAAGTCGCA3′.

    Isolation:

    Article Title: Dopamine Specifically Inhibits Forebrain Neural Stem Cell Proliferation, Suggesting a Novel Effect of Antipsychotic Drugs
    Article Snippet: .. Total neurosphere RNA was isolated (RNeasy extraction kit; Qiagen, Hilden, Germany), and 1 μg of total RNA was used to synthesize cDNA with oligo-dT 12-18 primers and Moloney murine leukemia virus reverse transcriptase (Superscript II; Roche Products, Welwyn Garden City, UK) in a 25 μl reaction mixture at 42°C for 1 h. The PCR mixture (20 μl) consisted of 1 μl of cDNA, 16 pmol each of 5′ and 3′ primers, 0.2 m m dNTP, 1.5 m m Mg2+ , 2 μl of PCR buffer, and 0.8 U of Taq polymerase (Promega, Madison, WI). cDNA was amplified in a thermal cycler (PerkinElmer, Wellesley, MA) with 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 40 s, and extension at 72°C for 40 s. The primers against D2 R cDNA used were as follows: sense, 5′-GTAGCAGCCGAGCTTTCAG-3′; and antisense, 3′-GGGATGTTGCAGTCACAGTG-5′. .. This pair of primers was designed to encompass at least one intron to avoid false-positive amplification from contaminated genomic DNA.

    SYBR Green Assay:

    Article Title: HERG1 promotes esophageal squamous cell carcinoma growth and metastasis through TXNDC5 by activating the PI3K/AKT pathway
    Article Snippet: .. Invitrogen (Carlsbad, CA, USA) was the supplier of TRIzol, Moloney murine leukemia virus reverse transcriptase (M-MLV-RT), and Lipofectamine 2000, whereas Roche (Penzberg, Germany) provided SYBR Green I Master kits. .. Unless otherwise mentioned, biochemical reagents used were from Sigma (St. Louis, MO, USA).

    Polymerase Chain Reaction:

    Article Title: Dopamine Specifically Inhibits Forebrain Neural Stem Cell Proliferation, Suggesting a Novel Effect of Antipsychotic Drugs
    Article Snippet: .. Total neurosphere RNA was isolated (RNeasy extraction kit; Qiagen, Hilden, Germany), and 1 μg of total RNA was used to synthesize cDNA with oligo-dT 12-18 primers and Moloney murine leukemia virus reverse transcriptase (Superscript II; Roche Products, Welwyn Garden City, UK) in a 25 μl reaction mixture at 42°C for 1 h. The PCR mixture (20 μl) consisted of 1 μl of cDNA, 16 pmol each of 5′ and 3′ primers, 0.2 m m dNTP, 1.5 m m Mg2+ , 2 μl of PCR buffer, and 0.8 U of Taq polymerase (Promega, Madison, WI). cDNA was amplified in a thermal cycler (PerkinElmer, Wellesley, MA) with 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 40 s, and extension at 72°C for 40 s. The primers against D2 R cDNA used were as follows: sense, 5′-GTAGCAGCCGAGCTTTCAG-3′; and antisense, 3′-GGGATGTTGCAGTCACAGTG-5′. .. This pair of primers was designed to encompass at least one intron to avoid false-positive amplification from contaminated genomic DNA.

    Article Title: 7α-Hydroxycholesterol induces monocyte/macrophage cell expression of interleukin-8 via C5a receptor
    Article Snippet: .. Reverse transcription (RT)-polymerase chain reaction (PCR) After reverse-transcription of total RNAs for 1 h at 42°C with Moloney Murine Leukemia Virus reverse transcriptase, transcripts of the IL-8 gene were amplified by RT-PCR or assessed by real-time PCR using a LightCycler® 96 Real-Time PCR System (Roche, Germany) as described [ ]. .. PCR was performed using Taq PCR Kit.

    Incubation:

    Article Title: Anti-apoptotic role of the sonic hedgehog signaling pathway in the proliferation of ameloblastoma
    Article Snippet: .. Briefly, RNA was incubated for 15 min at 42°C with 25 U/μl of recombinant RNase inhibitor (Nacalai Tesque, Japan), 1.0 μl of 50 μM random hexamers (Applied Biosystems), 2.0 μl of each 2.0 μM dNTP (Toyobo, Japan) and 50 U/μl of Moloney murine leukemia virus reverse transcriptase (Roche Diagnostics, Switzerland). .. Reverse transcription-PCR (RT-PCR) For RT-PCR, 100 ng of template DNA, 0.5 μl of 20 pM sense and antisense primers, 1.0 μl of 25 mM MgCl2 , 1.25 μl of 10X Taq DNA polymerase buffer (Bio Basic, Canada), 5 U/μl of Taq DNA polymerase (Bio Basic), 0.5 μl of 2.0 mM dNTP mix (Toyobo) and 9.65 μl of sterilized water were used in a total volume of 13.5 μl.

    Article Title: Receptor Protein Tyrosine Phosphatase ? Is a Marker for Pyramidal Cells and Sensory Neurons in the Nervous System and Is Not Necessary for Normal Development
    Article Snippet: .. RNA (1 μg) of each genotype was incubated with or without the Moloney murine leukemia virus reverse transcriptase (Roche). .. PCR using primers located on the extracellular domain of RPTPγ (forward primer, 5′-GCACCGAGCAAGGACAGCGAG-3′; reverse primer, 5′-GAGGAGGACGAGGCACACAAG-3′) was then carried out.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: 7α-Hydroxycholesterol induces monocyte/macrophage cell expression of interleukin-8 via C5a receptor
    Article Snippet: .. Reverse transcription (RT)-polymerase chain reaction (PCR) After reverse-transcription of total RNAs for 1 h at 42°C with Moloney Murine Leukemia Virus reverse transcriptase, transcripts of the IL-8 gene were amplified by RT-PCR or assessed by real-time PCR using a LightCycler® 96 Real-Time PCR System (Roche, Germany) as described [ ]. .. PCR was performed using Taq PCR Kit.

    Recombinant:

    Article Title: Anti-apoptotic role of the sonic hedgehog signaling pathway in the proliferation of ameloblastoma
    Article Snippet: .. Briefly, RNA was incubated for 15 min at 42°C with 25 U/μl of recombinant RNase inhibitor (Nacalai Tesque, Japan), 1.0 μl of 50 μM random hexamers (Applied Biosystems), 2.0 μl of each 2.0 μM dNTP (Toyobo, Japan) and 50 U/μl of Moloney murine leukemia virus reverse transcriptase (Roche Diagnostics, Switzerland). .. Reverse transcription-PCR (RT-PCR) For RT-PCR, 100 ng of template DNA, 0.5 μl of 20 pM sense and antisense primers, 1.0 μl of 25 mM MgCl2 , 1.25 μl of 10X Taq DNA polymerase buffer (Bio Basic, Canada), 5 U/μl of Taq DNA polymerase (Bio Basic), 0.5 μl of 2.0 mM dNTP mix (Toyobo) and 9.65 μl of sterilized water were used in a total volume of 13.5 μl.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Roche revertaid h minus m mulv rt enzyme
    Revertaid H Minus M Mulv Rt Enzyme, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid h minus m mulv rt enzyme/product/Roche
    Average 89 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    revertaid h minus m mulv rt enzyme - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    92
    Roche moloney murine leukemia virus reverse transcriptase
    Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase/product/Roche
    Average 92 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    90
    Roche moloney murine leukemia virus reverse transcriptase mbi
    Moloney Murine Leukemia Virus Reverse Transcriptase Mbi, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase mbi/product/Roche
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase mbi - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    Image Search Results