moloney murine leukemia virus reverse transcriptase  (PerkinElmer)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    PerkinElmer moloney murine leukemia virus reverse transcriptase
    Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 92/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase/product/PerkinElmer
    Average 92 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2021-01
    92/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Mycobacterial Antigens Exacerbate Disease Manifestations in Mycobacterium tuberculosis-Infected Mice
    Article Snippet: .. Briefly, 1 μg of RNA was reverse transcribed using a Moloney murine leukemia virus reverse transcriptase and was amplified with Taq polymerase according to procedures given in the GeneAmp RNA PCR kit (Perkin-Elmer, Branchburg, N.J.). ..

    Article Title: Yersinia pseudotuberculosis Anti-Inflammatory Components Reduce Trinitrobenzene Sulfonic Acid-Induced Colitis in the Mouse
    Article Snippet: .. Ten micrograms of DNA-free RNA extract was reverse transcribed into cDNA by using Moloney murine leukemia virus reverse transcriptase as previously detailed ( ). cDNAs were further PCR amplified (40 cycles) in a Perkin-Elmer apparatus using custom-synthesized sense (s) and antisense (as) primers (Genset) specific for the genes coding for TNF-α (s, 5′-TCTCATCAGTTCTATGGCCC-3′; as, 5′-GGGAGTAGACAAGGTACAAC-3′) and β-actin (s, 5′-GGGTCAGAAGGATTCCTATG-3′; as, 5′-GGTCTCAAACATGATCTGGG-3′). .. Two linearized plasmid DNA competitors (pMus-3 and pQB3 for competition with TNF-α cDNA and β-actin cDNA, respectively) were added to the PCR mixture.

    Article Title: Immunopathologic Effects of Tumor Necrosis Factor Alpha in Murine Mycobacterial Infection Are Dose Dependent
    Article Snippet: .. Briefly, 1 μg of RNA was reverse transcribed with a Moloney murine leukemia virus reverse transcriptase and amplified with Taq polymerase according to procedures given in the GeneAmp RNA PCR kit (Perkin-Elmer, Branchburg, N.J.). ..

    Polymerase Chain Reaction:

    Article Title: Mycobacterial Antigens Exacerbate Disease Manifestations in Mycobacterium tuberculosis-Infected Mice
    Article Snippet: .. Briefly, 1 μg of RNA was reverse transcribed using a Moloney murine leukemia virus reverse transcriptase and was amplified with Taq polymerase according to procedures given in the GeneAmp RNA PCR kit (Perkin-Elmer, Branchburg, N.J.). ..

    Article Title: Yersinia pseudotuberculosis Anti-Inflammatory Components Reduce Trinitrobenzene Sulfonic Acid-Induced Colitis in the Mouse
    Article Snippet: .. Ten micrograms of DNA-free RNA extract was reverse transcribed into cDNA by using Moloney murine leukemia virus reverse transcriptase as previously detailed ( ). cDNAs were further PCR amplified (40 cycles) in a Perkin-Elmer apparatus using custom-synthesized sense (s) and antisense (as) primers (Genset) specific for the genes coding for TNF-α (s, 5′-TCTCATCAGTTCTATGGCCC-3′; as, 5′-GGGAGTAGACAAGGTACAAC-3′) and β-actin (s, 5′-GGGTCAGAAGGATTCCTATG-3′; as, 5′-GGTCTCAAACATGATCTGGG-3′). .. Two linearized plasmid DNA competitors (pMus-3 and pQB3 for competition with TNF-α cDNA and β-actin cDNA, respectively) were added to the PCR mixture.

    Article Title: Cloning and expression of the rabbit prostaglandin EP2 receptor
    Article Snippet: .. PCR ampification of Rabbit EP2 receptor Fragment Total RNA was purified from dissected nephron segments using Tri Reagent (Molecular Research Center) and reverse-transcribed to single-stranded cDNA using Moloney murine leukemia virus reverse transcriptase and 2.5 μM of random hexamers according to the manufacturer's protocol (GeneAmp RNA PCR kit, Perkin Elmer Cetus, Norwalk, CT). .. The cDNAs were then amplified using EP2 and GAPDH selective primers.

    Article Title: Cadherin-6 Mediates the Heterotypic Interactions between the Hemopoietic Osteoclast Cell Lineage and Stromal Cells in a Murine Model of Osteoclast Differentiation
    Article Snippet: .. PCR detection of the alternatively spliced isoforms of cadherin-6 was performed either on human osteoclast-like cell cDNA library as described above or on reverse-transcribed single-strand cDNA from total RNA preparations (1 μg) using Moloney murine leukemia virus reverse transcriptase and random hexamers primers ( Perkin Elmer Cetus, Norwalk, CT). ..

    Article Title: Immunopathologic Effects of Tumor Necrosis Factor Alpha in Murine Mycobacterial Infection Are Dose Dependent
    Article Snippet: .. Briefly, 1 μg of RNA was reverse transcribed with a Moloney murine leukemia virus reverse transcriptase and amplified with Taq polymerase according to procedures given in the GeneAmp RNA PCR kit (Perkin-Elmer, Branchburg, N.J.). ..

    Purification:

    Article Title: Cloning and expression of the rabbit prostaglandin EP2 receptor
    Article Snippet: .. PCR ampification of Rabbit EP2 receptor Fragment Total RNA was purified from dissected nephron segments using Tri Reagent (Molecular Research Center) and reverse-transcribed to single-stranded cDNA using Moloney murine leukemia virus reverse transcriptase and 2.5 μM of random hexamers according to the manufacturer's protocol (GeneAmp RNA PCR kit, Perkin Elmer Cetus, Norwalk, CT). .. The cDNAs were then amplified using EP2 and GAPDH selective primers.

    Concentration Assay:

    Article Title: High-Throughput Real-Time Reverse Transcription-PCR Quantitation of Hepatitis C Virus RNA
    Article Snippet: .. The reaction mixture for RT-PCR was prepared in a single tube as follows: 1× buffer A (50 mM KCl, 10 mM Tris-HCl, 0.01 mM EDTA, 60 nM Passive Reference [pH 8.3]), 5 mM MgCl2 , 20 pmol of primer C-149, 20 pmol of primer C-342, each deoxynucleoside triphosphate (Boehringer) at a concentration of 0.3 mM, 0.4 U of RNase inhibitor per μl, 0.4 U of Moloney murine leukemia virus reverse transcriptase per μl, and 0.025 U of Taq Gold Polymerase per μl (the enzymes and the buffer containing passive reference were from Perkin Elmer). .. Fluorogenic probe [FT-275 5′-(FAM)CACCCTATCAGGCAGTACCACAAGGCC(TAMRA)-3′] was added to the PCR mixture to a final concentration of 150 nM.

    cDNA Library Assay:

    Article Title: Cadherin-6 Mediates the Heterotypic Interactions between the Hemopoietic Osteoclast Cell Lineage and Stromal Cells in a Murine Model of Osteoclast Differentiation
    Article Snippet: .. PCR detection of the alternatively spliced isoforms of cadherin-6 was performed either on human osteoclast-like cell cDNA library as described above or on reverse-transcribed single-strand cDNA from total RNA preparations (1 μg) using Moloney murine leukemia virus reverse transcriptase and random hexamers primers ( Perkin Elmer Cetus, Norwalk, CT). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: High-Throughput Real-Time Reverse Transcription-PCR Quantitation of Hepatitis C Virus RNA
    Article Snippet: .. The reaction mixture for RT-PCR was prepared in a single tube as follows: 1× buffer A (50 mM KCl, 10 mM Tris-HCl, 0.01 mM EDTA, 60 nM Passive Reference [pH 8.3]), 5 mM MgCl2 , 20 pmol of primer C-149, 20 pmol of primer C-342, each deoxynucleoside triphosphate (Boehringer) at a concentration of 0.3 mM, 0.4 U of RNase inhibitor per μl, 0.4 U of Moloney murine leukemia virus reverse transcriptase per μl, and 0.025 U of Taq Gold Polymerase per μl (the enzymes and the buffer containing passive reference were from Perkin Elmer). .. Fluorogenic probe [FT-275 5′-(FAM)CACCCTATCAGGCAGTACCACAAGGCC(TAMRA)-3′] was added to the PCR mixture to a final concentration of 150 nM.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    PerkinElmer mulv
    Mulv, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 89/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mulv/product/PerkinElmer
    Average 89 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    mulv - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    92
    PerkinElmer moloney murine leukemia virus reverse transcriptase
    Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 92/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase/product/PerkinElmer
    Average 92 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    92
    PerkinElmer moloney murine leukemia virus
    Moloney Murine Leukemia Virus, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus/product/PerkinElmer
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    Image Search Results